CN110499255B - Fusarium grown in Bozhou chrysanthemum and application thereof - Google Patents
Fusarium grown in Bozhou chrysanthemum and application thereof Download PDFInfo
- Publication number
- CN110499255B CN110499255B CN201910736315.5A CN201910736315A CN110499255B CN 110499255 B CN110499255 B CN 110499255B CN 201910736315 A CN201910736315 A CN 201910736315A CN 110499255 B CN110499255 B CN 110499255B
- Authority
- CN
- China
- Prior art keywords
- fusarium
- bjf6
- chrysanthemum
- infection
- pathogenic bacteria
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D3/00—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances
- A62D3/02—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances by biological methods, i.e. processes using enzymes or microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D2101/00—Harmful chemical substances made harmless, or less harmful, by effecting chemical change
- A62D2101/20—Organic substances
- A62D2101/28—Organic substances containing oxygen, sulfur, selenium or tellurium, i.e. chalcogen
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/77—Fusarium
Abstract
The invention relates to a Bo-Chrysanthemum endophytic fusarium and application thereof. The Fusarium Botani is Fusarium Botani (Fusarium sp) BJF6 with the deposit number of GDMCC No. 60047. Compared with the existing Fusarium, the Fusarium sp (BJF 6) has the following characteristics: (1) the antibacterial effect on various pathogenic bacteria is exerted; (2) has the function of potassium removal; (3) has nitrogen fixation function; (4) can degrade cellulose.
Description
Technical Field
The invention relates to the technical field of microorganisms, in particular to a chrysanthemum endophytic fusarium and application thereof.
Background
Endophytes (endophytes) refer to a group of microorganisms that live in healthy plant tissues or cells and do not cause significant symptoms of infection of the host plant. Infected host plants do not exhibit extrinsic disorders and their endogenesis can be demonstrated by histological isolation from strictly surface-sterilized plant tissue or by direct amplification of microbial DNA from within plant tissue. Endophytes can be classified by species as endophytes, and endophyte actinomycetes.
Boju (Chrysanthemum morifolium cv. Boju) is mainly produced in Bozhou of Anhui, and is a good product in medicinal Chrysanthemum as a medicinal material in the way of Anhui. The chrysanthemum has the functions of resisting tumor, bacteria, virus, cardiovascular disease, oxidation, senility, coagulation, lead expelling, pain relieving, etc.
At present, the research on the chrysanthemum morifolium ramat is mainly focused on the aspects of chemical component analysis, processing technology research, virus-free seedling technology, cultivation technology and the like at home and abroad, but the research on the domestic fusarium inside the chrysanthemum morifolium ramat is less, in particular to the domestic fusarium inside the chrysanthemum.
Disclosure of Invention
Based on the above, the main purpose of the invention is to provide Fusarium Botanioides. The strain has antagonistic action on pathogenic bacteria, and also has the functions of decomposing potassium, fixing nitrogen and degrading cellulose.
The main purpose of the invention is realized by the following technical scheme:
fusarium stolonifera (Fusarium sp) BJF6 with the preservation number of GDMCC No. 60047.
The molecular classification position of the Fusarium Botani (Fusarium sp) BJF6 is determined. The ITS sequence of the Bozhou chrysanthemum endophytic Fusarium (Fusarium sp) BJF6 is shown as SEQID No. 3.
Compared with the existing Fusarium, the Fusarium sp (BJF 6) has the following characteristics: (1) the antibacterial effect on various pathogenic bacteria is exerted; (2) has the function of potassium removal; (3) has nitrogen fixation function; (4) can degrade cellulose.
Another object of the present invention is to provide the use of the above Fusarium Botanicum (Fusarium sp) BJF6 as an antagonist for controlling crop diseases.
In some embodiments, the crop disease is a disease caused by infection with Curvularia zeae and Colletotrichum cucurbitacearum.
In some of these embodiments, the crop disease is a disease caused by infection with fusarium moniliforme, fusarium oxysporum.
In some embodiments, the crop disease is a disease caused by infection with tea leaf verticillium, tea leaf anthrax.
In some embodiments, the crop disease is a disease caused by infection with gibberella zeae or fusarium graminearum.
Still another object of the present invention is to provide the use of the above described Fusarium Botani (Fusarium sp) BJF6 as a nitrogen-fixing bacterium for enhancing soil nitrogen content.
The invention also aims to provide application of the Fusarium Botanicum (Fusarium sp) BJF6 as a fiber degrading bacterium in decomposing waste fibers.
Still another objective of the present invention is to provide the application of the above mentioned Fusarium Botani (Fusarium sp) BJF6 as potassium-decomposing bacterium in reducing soil-incompatible potassium content.
It is still another object of the present invention to provide a biological agent comprising the above Fusarium Botanioides (Fusarium sp) BJF6 and/or its metabolite as an active ingredient.
The strain provided by the invention is preserved in Guangdong province microbial culture collection center (GDMCC), and the address is No. 59 building 5 of Michelia furiosa No. 100 college in Guangzhou city, Guangdong province microbial research institute, postal code 510075; the information of the strain of the invention is as follows: fusarium maritimum (Fusarium sp) BJF 6; the accession number is GDMCC No. 60047; the preservation date is 2016, 6 and 16.
Drawings
FIG. 1, 8 are the morphological features of the pathogenic bacteria on the PDA plate.
FIG. 2 shows the cultivation of true strains of Bo-Chrysanthemum BJF6 against 8 pathogenic bacteria.
FIG. 3 is a statistical chart of the bacteriostatic rate of true strains BJF6 in chrysanthemum morifolium on 8 pathogenic bacteria respectively.
FIG. 4 is a microscopic observation of the true strain BJF6 in chrysanthemum morifolium and 8 pathogenic bacteria in the opposite culture, wherein the left part of two pictures marked by the same letter is the pathogenic bacteria hypha of a control group, and the right part is the pathogenic bacteria hypha in the opposite culture.
FIG. 5 is a biological activity test chart of true strain BJF6 in Bozhou chrysanthemum.
Detailed Description
In order that the invention may be more fully understood, reference will now be made to the following description. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.
1 materials and methods
1.1 materials
1.1.1 test pathogens
Curvularia zeae (Curvularia lunata), Colletotrichum cucumerinum (Colletotrichum lagenarium), Fusarium moniliforme (Fusarium moniliforme), Fusarium oxysporum (Fusarium oxysporum), Verticillium theae (Pestalotiopsis theae), Anthragma theae (Colletotrichum lagenarium), Gibberella tritici (Fusarium graminearum), Fusarium graminearum (Fusarium graminearum), and are deposited at the Microbiol laboratory of the institute of Sakyo Fuyang. The pathogenic bacteria to be tested of the invention are all known strains and can be obtained by the way of market purchase and the like. 1.1.2 endophytic fungi tested
The Bo-Chrysanthemum endophytic fungus BJF6 is stored in a microbiological laboratory of the faculty of the thoroughfare and the Anhui, and sent to the culture Collection center (GDMCC) of Guangdong province for completion of the preservation.
The strain is obtained by screening through the following steps:
(1) obtaining the endophytic fungi of the chrysanthemum: the healthy Bo-Chrysanthemum plants are washed clean by running water and dried in the air, cut into a plurality of parts and put into an ultra-clean workbench, soaked in 75% alcohol for 3min, washed by sterile water for 3 times, rinsed by 0.1% mercuric chloride for 30sec, and then washed by the sterile water for 3-4 times. The culture was carried out with PDA and LB media, respectively, and the bacterial culture temperature was 37 ℃ and the fungal culture temperature was 28 ℃. After 3-4 days of culture, selecting colonies according to the colony morphology, color and the like on the cross section, repeatedly purifying the strains by a scribing method, and storing at 4 ℃ for later use.
(2) Primary screening: adopting a plate confronting method, beating pathogenic bacteria to be tested which are cultured for 3d by a PDA plate into fungus cakes with the diameter of 6mm, inoculating the fungus cakes into the center of a culture dish of a PDA culture medium, respectively inoculating 2 chrysanthemum endophytic fungus cakes (6mm) on two points which are 3cm away from the center of the PDA plate and are positioned on the same straight line, comparing the fungus cakes without the chrysanthemum endophytic fungus cakes, repeating the culture dish for 3 days, culturing for 5-7 days at the temperature of 28 ℃, observing and recording the bacteriostasis condition every day, selecting endophytic fungus strains which have obvious inhibition on the growth of the pathogenic bacteria and are inhibited and have flush hypha edges, and entering subsequent rescreening.
(3) Re-screening: and (3) carrying out experiment on the endophytic fungi strains entering the re-screening by a plate confronting method, culturing at 28 ℃ until the plates of the control group are full of pathogenic bacteria, measuring the radius of the pathogenic bacteria of the treatment group, calculating the bacteriostasis rate, and calculating the bacteriostasis rate by the following method: the bacteriostasis rate is (control pathogen colony radius-opposing culture pathogen colony radius)/control pathogen colony radius x 100%.
According to the result of rescreening, the Bo-Chrysanthemum endophytic fungus BJF6 has an inhibiting effect on various pathogenic bacteria.
1.1.3 culture Medium
The fungus culture medium adopts PDA culture medium, Behcet's culture medium, potassium bacteria isolation culture medium, and sodium carboxymethylcellulose culture medium.
1.2 methods
1.2.1 activation of the bacterial species
Preparing the test endophytic fungus (Bo chrysanthemum endophytic fungus BJF6) and the test pathogenic bacteria stored in a refrigerator at 4 ℃ into a fungus cake with the diameter of 6mm, transferring the fungus cake to the center of a sterile PDA (personal digital assistant) plate, and culturing at 28 ℃ for 3-4 days for later use. 1.2.2 PCR amplification and detection of ITS segments
According to a conventional molecular biological method, genomic DNA of the Bo-Chrysanthemum endophytic fungus BJF6 is extracted, and PCR amplification is carried out by adopting ITS fungus universal primers ITS4 and ITS 5. The 25. mu.L reaction system is shown in Table 1. After 5min of pre-denaturation at 95 ℃ the reaction sequence is shown in Table 2.
ITS4(SEQ ID No.1)：5’-tcctccgcttattgatatgc-3’
ITS5(SEQ ID No.2)：5’-ggaagtaaaagtcgtaacaagg-3’
The PCR product was electrophoresed on 1% agarose gel at 110mV, stained with EB for 20min, and photographed with a gel imager.
1.2.3 bacteriostatic Activity of endophytic fungi
(1) Bacterial strain bacteriostatic activity.
Adopting a confronting culture method, taking activated endophytic fungi and pathogenic bacteria to be tested under aseptic condition, preparing fungus cakes with diameter of 6mm by a puncher, respectively transferring the fungus cakes onto PDA plates, keeping the distance between the fungus cakes and the PDA plates at 1.5cm, using the fungus cakes only inoculated with the pathogenic bacteria as a control (the treatment and the control are repeated for 3 times), and culturing at the constant temperature of 28 ℃ in a dark place. 4d, observing and recording the growth condition and the bacteriostatic action of the pathogenic bacteria colony, measuring the hypha extension radius, and calculating the bacteriostatic rate:
the inhibition ratio (%) < ratio (control colony radius-treated colony facing radius)/(control colony radius) × 100%
(2) Microscopic observation of the confronting culture hyphae.
Dipping the sterilized PDA culture medium with a sterilizing brush, brushing the sterilized PDA culture medium on a sterilized glass slide to prepare a PDA film with the thickness of 1mm, respectively inoculating endophytic fungi with the diameter of 6mm and fungus cakes of pathogenic bacteria to be tested at the two ends of the glass slide, culturing the two at the temperature of 28 ℃ for 3-4 days at the distance of 2cm, and observing and taking pictures by using a microscope.
1.2.4 endophytic fungi Nitrogen fixation Activity
The purified BJF6 strain was inoculated onto an Artobia medium plate and incubated at 28 ℃ for several days with daily observation. Growth is considered to be nitrogen fixation activity.
1.2.5 endophytic fungi Potassium-solubilizing Activity
The purified BJF6 strain is inoculated on a potassium bacteria separation culture medium which takes potassium feldspar as a unique potassium source, and is placed in a constant temperature incubator at 28 ℃ for culturing for a plurality of days and observed every day. Growth is considered to be potassium-releasing. The results were recorded after 4 d.
1.2.6 cellulolytic Activity of endophytic fungi
The purified BJF6 strain is inoculated on a sodium carboxymethyl cellulose culture medium and is placed in a constant temperature incubator at 28 ℃ for several days. Dyeing with 1mg/ml congo red for 15 minutes, pouring off the dye solution, adding 1mol/L sodium chloride solution for rinsing, pouring off the sodium chloride solution after 15 minutes, measuring the diameter of a transparent ring and the diameter of a bacterial colony, and judging the strength of the cellulose degradation capacity of the strain according to the ratio of the diameter of the transparent ring to the diameter of the bacterial colony.
2 results and analysis
2.1 identification results
(1) Morphological identification
The Bo-chrysanthemum endophytic fungus BJF6 provided by the invention has the advantages of relatively regular edges, pink colonies and yellowish middle parts.
(2) Molecular biological identification
The ITS sequence SEQ ID No.3 of the Bozhou chrysanthemum endophytic fungus BJF6 is shown as follows:
tggaagtaaaagtcgtaacaaggtctccgttggtgaaccagcggagggatcattaccgagtttacaactcccaaacccctgtgaacataccttaatgttgcctcggcggatcagcccgcgccccgtaaaacgggacggcccgccagaggacccaaactctaatgtttcttattgtaacttctgagtaaaacaaacaaataaatcaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcaaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgcccgctggtattccggcgggcatgcctgttcgagcgtcatttcaaccctcaagcccccgggtttggtgttggggatcggctctgcccttctgggcggtgccgcccccgaaatacattggcggtctcgctgcagcctccattgcgtagtagctaacacctcgcaactggaacgcggcgcggccatgccgtaaaaccccaacttctgaatgttgacctcggatcaggtaggaatacccgctgaacttaagcatatcaataagcggaggaa
the bacterium was analyzed to be Fusarium.
2.2 bacteriostatic Activity of the Strain
The morphological characteristics of 8 pathogenic bacteria on a PDA (personal digital assistant) plate and the pathogenic bacteria inhibition phenomenon of the Bo-Chrysanthemum endophytic fungus BJF6 are respectively shown in figures 1 and 2 (the left side of the plate is the Bo-Chrysanthemum endophytic fungus BJF6, and the right side is the pathogenic bacteria). Through the plate confrontation experiment of the Bozhou chrysanthemum endophytic fungus BJF6 strain and pathogenic bacteria, the BJF6 has obvious bacteriostatic action on 8 pathogenic bacteria of corn curvularia, melon anthracnose, bead fusarium, cucumber fusarium wilt, tea shift bacteria, tea anthracnose, wheat gibberellic disease and graminearum, and most of the pathogenic bacteria are accompanied with bacteriostasis. In fig. 1: A. curvularia zeae; B. melon anthracnose pathogen; C. fusarium moniliforme; D. cucumber fusarium wilt bacteria; E. tea shift bacteria; F. anthracnose bacteria of tea; G. wheat scab bacteria; H. fusarium graminearum. In fig. 2: A. curvularia zeae; B. melon anthracnose pathogen; C. fusarium moniliforme; D. cucumber fusarium wilt bacteria; E. tea shift bacteria; F. anthracnose bacteria of tea; G. wheat scab bacteria; H. fusarium graminearum.
The statistics of the bacteriostasis rate of the Bozhou chrysanthemum endophytic fungus BJF6 on 8 pathogenic bacteria are shown in figure 3. According to the figure 3, the inhibition rate of the Bo-Chrysanthemum endophytic fungus BJF6 on 8 pathogenic bacteria is over 58%, wherein the inhibition rate on tea shift bacteria is the highest (72%).
Through the microscopic observation of the culture hyphae (please refer to fig. 4), the hyphae of the chrysanthemum endophytic fungus BJF6 is not observed, the chrysanthemum endophytic fungus BJF6 does not interact with the hyphae of the pathogenic bacteria, and the BJF6 can be speculated to compete with the pathogenic bacteria for nutrient substances, so that the branches of the pathogenic bacteria hyphae become more and more dense, and even the hyphae of the pathogenic bacteria become malformed by combining with the fig. 2. In fig. 4: A. curvularia zeae; B. melon anthracnose pathogen; C. fusarium moniliforme; D. cucumber fusarium wilt bacteria; E. tea shift bacteria; F. anthracnose bacteria of tea; G. wheat scab bacteria; H. fusarium graminearum.
2.2 biological Activity of the Strain
The strain BJF6 can grow on Behcet's medium (A in FIG. 5). After being cultured at 28 ℃ for 4 days, the colony diameter is 30.75 +/-2.99 mm, which indicates that the strain BJF6 has the nitrogen fixation effect.
The strain BJF6 can grow on the potassium-dissolving bacteria isolation medium with potassium feldspar as the only potassium source (B in figure 5). After being cultured at 28 ℃ for 4 days, the colony diameter is 26.50 +/-2.12 mm, which indicates that the strain BJF6 has the potassium-removing effect.
The bacterial colony BJF6 can grow in a sodium carboxymethylcellulose culture medium, and after Congo red staining and sodium chloride solution rinsing, a transparent ring phenomenon can be obviously observed (C in figure 5). After culturing at 28 ℃ for 4 days, the ratio of the diameter of the transparent ring to the diameter of the colony is 1.21 +/-0.06, which indicates that the strain BJF6 has the capacity of degrading cellulose.
The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> university of fuyang teacher's university
<120> chrysanthemum endophytic fusarium and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tcctccgctt attgatatgc 20
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ggaagtaaaa gtcgtaacaa gg 22
<210> 3
<211> 589
<212> DNA
<213> Fusarium endozogenes (Fusarium)
<400> 3
tggaagtaaa agtcgtaaca aggtctccgt tggtgaacca gcggagggat cattaccgag 60
tttacaactc ccaaacccct gtgaacatac cttaatgttg cctcggcgga tcagcccgcg 120
ccccgtaaaa cgggacggcc cgccagagga cccaaactct aatgtttctt attgtaactt 180
ctgagtaaaa caaacaaata aatcaaaact ttcaacaacg gatctcttgg ttctggcatc 240
gatgaagaac gcagcaaaat gcgataagta atgtgaattg cagaattcag tgaatcatcg 300
aatctttgaa cgcacattgc gcccgctggt attccggcgg gcatgcctgt tcgagcgtca 360
tttcaaccct caagcccccg ggtttggtgt tggggatcgg ctctgccctt ctgggcggtg 420
ccgcccccga aatacattgg cggtctcgct gcagcctcca ttgcgtagta gctaacacct 480
cgcaactgga acgcggcgcg gccatgccgt aaaaccccaa cttctgaatg ttgacctcgg 540
atcaggtagg aatacccgct gaacttaagc atatcaataa gcggaggaa 589
Claims (10)
1. Fusarium stolonifera (Fusarium sp) BJF6, which is characterized in that the preservation number is GDMCC No. 60047.
2. Use of Fusarium Boehmerinum (Fusarium sp) BJF6 as an antagonist in the control of crop diseases.
3. The use according to claim 2, wherein the crop diseases are diseases caused by infection with Curvularia zeae and Colletotrichum cucurbitacearum.
4. The use according to claim 2, wherein the crop disease is a disease caused by infection with fusarium moniliforme, fusarium oxysporum.
5. The use according to claim 2, wherein the crop disease is a disease caused by infection with tea leaf verticillium, tea leaf anthrax.
6. The use according to claim 2, wherein the crop disease is a disease caused by infection with gibberella tritici, fusarium graminearum.
7. The use of Fusarium Boehmerinum (Fusarium sp) BJF6 as a nitrogen-fixing bacterium in enhancing soil nitrogen content.
8. The use of Fusarium Botanium (Fusarium sp) BJF6 of claim 1 as a fiber degrading bacterium in the decomposition of waste fibers.
9. The use of Fusarium Botanium (Fusarium sp) BJF6 of claim 1 as a potassium-solubilizing bacterium for reducing soil recalcitrant potassium content.
10. A biological agent characterized in that it comprises the Fusarium Botanioides (Fusarium sp) BJF6 of claim 1 as an active ingredient.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910736315.5A CN110499255B (en) | 2019-08-09 | 2019-08-09 | Fusarium grown in Bozhou chrysanthemum and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910736315.5A CN110499255B (en) | 2019-08-09 | 2019-08-09 | Fusarium grown in Bozhou chrysanthemum and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110499255A CN110499255A (en) | 2019-11-26 |
| CN110499255B true CN110499255B (en) | 2021-04-16 |
Family
ID=68586290
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910736315.5A Active CN110499255B (en) | 2019-08-09 | 2019-08-09 | Fusarium grown in Bozhou chrysanthemum and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110499255B (en) |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2013158314A (en) * | 2012-02-07 | 2013-08-19 | Sankei Kagaku Kk | Filamentous fungus |
| CN102676398B (en) * | 2012-03-14 | 2014-01-15 | 安徽农业大学 | Separation and purification method of endophytic fungi from ginkgo biloba |
| JP6078877B2 (en) * | 2013-03-26 | 2017-02-15 | 鳥取県 | Plant disease control agent and plant disease control method |
| CN103667152A (en) * | 2013-12-19 | 2014-03-26 | 云南晋企生物科技有限公司 | Universal microorganism bacterial agent |
| CN108179115B (en) * | 2018-01-22 | 2021-05-11 | 阜阳师范学院 | Chrysanthemum endophytic spore shell bacteria and application thereof |
| CN109439582B (en) * | 2018-11-16 | 2021-10-15 | 阜阳师范学院 | Bacillus megaterium grown in chrysanthemum morifolium and application thereof |
-
2019
- 2019-08-09 CN CN201910736315.5A patent/CN110499255B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN110499255A (en) | 2019-11-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113801799B (en) | Yeast SLL12 and application thereof in preparation of biological control agent for controlling postharvest diseases of jujube fruits | |
| CN113308392B (en) | Application of Nori endophytic Siamese bacillus | |
| CN112143658A (en) | Beauveria bassiana strain MQ-08 and application and microbial preparation thereof | |
| CN110317747B (en) | Bacillus amyloliquefaciens JT68 and application thereof in prevention and treatment of tea anthracnose | |
| CN113444651B (en) | Saffron endophytic fungus and application thereof in preventing and treating bulb rot | |
| CN108913622B (en) | Bacillus megaterium BM22 and preparation and application of spore powder thereof | |
| CN110551637B (en) | Echinospora echinocandii from radix astragali root for efficiently inhibiting botrytis cinerea and application thereof | |
| CN110499255B (en) | Fusarium grown in Bozhou chrysanthemum and application thereof | |
| CN114540249B (en) | Antagonistic strain 1X1Y and application thereof | |
| CN114836329B (en) | Trichoderma harzianum HB40609 and application thereof | |
| CN114574381B (en) | Antagonistic strain JYC314 and application thereof | |
| Mandal et al. | Biochemical and molecular identification of antibiotic-producing bacteria from waste dumpsite soil | |
| CN110373358A (en) | Rose streptomyces verticillus Sr-63 and application thereof | |
| CN107058183B (en) | Bacillus methylotrophicus, and biocontrol microbial inoculum and application thereof | |
| CN113549558B (en) | Novel tea tree endophytic biocontrol fungus Diaporthe australiana and application thereof | |
| CN112961784B (en) | Endophytic Alternaria alternata Aa-Lcht and application thereof in preventing and treating apple tree rot | |
| CN111187724B (en) | Endophytic fungus with dark blueberry root and application thereof | |
| CN110484463B (en) | Bacillus mojavensis B282 and application thereof | |
| CN113812422B (en) | Application of paenibacillus polymyxa and/or fermentation liquor thereof | |
| CN117305135B (en) | Trichoderma pseudokoningii T0027 and application thereof in preventing and treating soft rot of kiwi fruits | |
| CN114672424B (en) | Tea tree endophyte and application thereof in plant disease control | |
| CN113684135B (en) | Chaetomium fortunei, application and screening method | |
| CN115197853B (en) | Endophyte Epicoccum thailandicum LF-28 strain and application thereof | |
| CN115851507B (en) | Paenibacillus elgii, microbial inoculum and application thereof | |
| CN116590199A (en) | Paenibacillus piri and application thereof in prevention and treatment of corn ear rot |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |