CN110484631A - A kind of InDel molecular labeling relevant to pig sexual maturing period character - Google Patents
A kind of InDel molecular labeling relevant to pig sexual maturing period character Download PDFInfo
- Publication number
- CN110484631A CN110484631A CN201910719346.XA CN201910719346A CN110484631A CN 110484631 A CN110484631 A CN 110484631A CN 201910719346 A CN201910719346 A CN 201910719346A CN 110484631 A CN110484631 A CN 110484631A
- Authority
- CN
- China
- Prior art keywords
- pig
- maturing period
- molecular labeling
- sexual maturing
- indel
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to pig molecule mark screening technique fields, and in particular to a kind of InDel molecular labeling relevant to pig sexual maturing period character.By the heavy sequencing data for integrating 469 pigs disclosed in ncbi database and European Bioinformatics research institute comprising 58 kinds, it compares pig and obtains genotype data with reference to genome sequence, obtain the molecular labeling of InDel related to pig sexual maturing period character a kind of, molecular labeling of the invention is the missing occurred at 94356743bp on No. 15 chromosomes of pig, is A by original AG missing.When idiotype is AA, is conducive to individual and possesses longer sexual maturing period.Disclose the method for screening and pig sexual maturing period character related molecular marker and its application of association analysis.The present invention provides a new InDel molecular labeling for the marker assisted selection in pig sexual maturing period.
Description
Technical field
The present invention relates to pig molecule mark preparation technical fields, and in particular to a boar sexual maturing period character is relevant
InDel molecular labeling and its application.Molecular labeling of the present invention can be used for the assisted Selection and prediction in pig sexual maturing period.
Background technique
Pig is economic animal important in Livestock Production.One of the domestic animal that domestic pig is tamed earliest as the mankind, origin
In Eurasian wild boar (Sus scrofa), then Eurasia wild boar is in Europe and Asia respectively by independent domestication (Larson G, Dobney
K, Albarella U,et al.Worldwide phylogeography of wild boar reveals multiple
centers of pig domestication[J].Science,2005,307(5715):1618-1621.).Due to this only
Vertical domestication process, the germplasm characteristic for having difference clearly demarcated between European pig kind and Asia pig kind, such as European pig kind possess higher
Lean meat percentage and bigger figure, then fat content is higher for Asia pig kind, and possesses high litter size and precocious advantage.
Sexual maturing period is that animal reaches a sexually matured process, and zoogamy can be carried out by reaching sexually matured animal.
Some researches show that sow can give a birth more piglets earlier for sexal maturity, there is longer breeding period, (Patterson J L,
Beltranena E,Foxcroft G R.The effect of gilt age at first estrus and breeding
on third estrus on sow body weight changes and long-term reproductive
performance[J].Journal of Animal Science,2010, 88(7):2500-2513.).In the production of pig
The reproductive performance of Cheng Zhong, pig are important economic characters, and the reproductive life for extending sow can bring very big economic benefit.Cause
This, the related molecular marker of exploration discovery sexual maturing period genetic mechanism facilitates the breeding research that pig is preferably unfolded.
Whole-genome association (Genome-wide association study, GWAS) is used as a kind of association analysis
Method, in the correlative study of complex character have it is more preferable than linkage analysis effect, count the higher advantage of effect, be initially
(Risch N, the Merikangas K.The future of genetic studies being put forward for the first time by Risch in 1996
Of complex human diseases. [J] .Science, 1996,273 (3): 350-354.) as in full-length genome range
The interior powerful explored in identification experiment group with the associated genetic marker of desired phenotype, whole-genome association is
Be widely used in all kinds of researchs, including human diseases and domestic animal important economical trait etc. (Visscher P M,
Brown M A,McCarthy M I,et al. Five years of GWAS discovery[J].The American
Journal of Human Genetics,2012,90(1):7-24.)
InDel, that is, Insertion/Deletion (insertion/deletion) is a kind of heredity mark of length in 1bp to 10000bp
Note.Some researches show that considerable InDel to be located in the encoded exon of gene or in promoter, illustrates that InDel can be with shadow
The expression of gene is rung to influence its function (Mills R E, Pittard W S, Mullaney J M, et al.Natural
genetic variation caused by small insertions and deletions in the human
genome[J].Genome research,2011, 21(6):830-839.)。
It is also studied in recent years about pig sexual maturing period relevant whole-genome association, and reports dependency basis
Cause.The present invention is by integrating ncbi database (SRA, http://www.ncbi.nlm.nih.gov/sra/) and Europe biology letter
It include resurveying for 469 pigs of 58 kinds disclosed in breath research institute (EMBL-EBI, https: //www.ebi.ac.uk/)
Ordinal number evidence utilizes MLM model (Zhang Z, Ersoz E, Lai C Q, et al.Mixed linear using MVP software
model approach adapted for genome-wide association studies[J].Nature
Genetics, 2010,42 (4): 355.), filtering out InDel molecular labeling relevant to sexual maturing period, is pig sexual maturing period
Assisted Selection and sexual maturing period prediction improvement provide new molecular labeling basis, are of great significance for the breeding of pig.
The correlation of InDel label and pig sexual maturing period that the present invention screens has reached the level of signifiance, is the sexal maturity of pig
Phase correlative study provides new genetic resources.
Summary of the invention
It is an object of the invention to find molecular labeling relevant to pig sexual maturing period character, by the way that pig is weighed sequencing data
It compares pig to refer on genome, obtains InDel typing data, and use whole-genome association (GWAS) filters out and pig
The InDel of sexual maturing period trait associations is marked, and provides new molecular labeling resource for the related breeding of pig sexual maturing period character
And application.
It is described that technical scheme is as follows:
Applicant is by integrating ncbi database (SRA, http://www.ncbi.nlm.nih.gov/sra/) and Europe
It include 469 pigs of 58 kinds disclosed in biological information research institute (EMBL-EBI, https: //www.ebi.ac.uk/)
Heavy sequencing data, and by pig weight sequencing data compare to pig refer to genome (genome version 11.1, Sscrofa11.1)
On, InDel typing data is obtained, the InDel screened using GWAS is labeled as generation at 94356743bp on No. 15 chromosomes
Missing, i.e., be A by original AG missing.The nucleotide sequence of the label is as shown in SEQ ID NO:1.
ATAATTATTTTGGGAATTACACCTTTCTTTTTTGTTGTTGTTGTCTTTTAAG(AG/A)GG CCACACC
TGTGGCACATGGAGGTTCCCAGGGTAGGGGTCAAATTGGA,
The missing of G base occurs in the 51-52 bit base of the sequence, i.e., is A by original AG missing, to generate sequence
The variation of column.
The molecular labeling can be used as detection molecular labeling relevant to pig sexual maturing period character, and when idiotype lacks
When mistake is AA, is conducive to pig and possesses longer sexual maturing period.
Applicant provide a kind of method of the relevant InDel molecular labeling of screening pig sexual maturing period character, the sides
Method includes the following steps:
1. incorporating ncbi database (abbreviation SRA, http://www.ncbi.nlm.nih.gov/sra/) and Europe being raw
It include 469 of 58 kinds disclosed in object information research institute (abbreviation EMBL-EBI, https: //www.ebi.ac.uk/)
The heavy sequencing data of pig, and pig weight sequencing data is compared to pig and refers to genome (genome version 11.1, Sscrofa11.1)
On, obtain InDel typing data；
2. according to the corresponding kind information of individual in population, by consulting Animal Genetic Resources in China will (pig will), Wiki
Encyclopaedia, external correlation pig variety website, pig genetic resources pertinent literature etc. have counted the characteristic sexual maturing period of each kind, and
Using sexual maturing period character as phenotypic character；
3. the method for using mixed linear model carries out GWAS using the MLM model in MVP software package under R statistical environment
Analysis.Concrete model is as follows: y=X β+Z μ+e, wherein y represents the phenotypic number of individual, and it includes principal component that β, which is represented,
Fixed effect including (principle component), μ, which is represented, obeys distributionStochastic effects, this point
G represents the affiliation matrix calculated by the SNP of corresponding individual in cloth.X and Z represents the incidence matrix of β and μ, e represent residual error to
It measures (vector of residual errors).
The molecular labeling (sequence is as shown in SEQ ID NO:1) that the present invention screens can be applied to non-diagnostic purpose to pig property
It is the sexual maturing period character of pig in the genotype or the relevant association analysis of pig sexual maturing period character of maturity period trait related gene
Molecular marker assisted selection provide new molecular labeling resource.
The present invention has the advantages that compared with prior art
The present invention can pass through the evaluation in vitro using the genotype of biochip technology detection pig, as non-diagnostic purpose
In the sexual maturing period of pig, compared with the methods of current conventional PCR-RFLP, the present invention has simple, quick, high sensitivity and spy
Outstanding advantages of anisotropic good.
More detailed technical solution refers to " specific embodiment ".
Detailed description of the invention
Fig. 1: general technical flow diagram of the invention.
Fig. 2: the nucleotide sequence of molecular labeling upstream and downstream 50bp nucleotide sequence and molecular labeling of the present invention of the invention.
Description of symbols: there are the missings of the G base of an AG/A at the 51-52 bit base for the nucleotide sequence that Fig. 2 is shown.
Fig. 3: being Manhattan figure of the invention.Description of symbols: subject of the present invention is pig sexual maturing period character, black
Circle and arrow arrow mark are the molecular labeling that the present invention screens, which is located on No. 15 chromosome of pig.
Specific embodiment
To the explanation of sequence table:
SEQ ID NO:1 is the nucleotide sequence for the molecular labeling relevant to pig sexual maturing period character that the present invention screens.
Sequence and whole-genome association in the present invention is as a result, be based on 11.1 version of pig genome.
Embodiment 1: Genotyping detection
(1) integration downloading ncbi database (SRA, http://www.ncbi.nlm.nih.gov/sra/) and Europe biology
The weight of 469 pigs disclosed in information research institute (EMBL-EBI, https: //www.ebi.ac.uk/) comprising 58 kinds
Sequencing data；
(2) fastq file is converted raw data into using SRAToolkit (V2.8.2) software, then used
Trimmomatic (V0.36) software carries out preliminary Quality Control to fastq file.By using Burrows-after the step
Wheeler Aligner 0.7.17 (BWA) software by remaining high quality reads and pig with reference to genome (version 11.1) into
Row compares, and unique aligned sequences is selected to carry out parting.It is soft using GATK (V4.0.3.0) in order to obtain the variation data of high quality
Part by ' QUAL<30.0 | | QD<2.0 | | FS>60.0 | | MQ<40.0 | | SOR>4.0 | | ReadPosRankSum<-8.0 ' order
Quality Control is carried out, the genotype data that can be used for GWAS analysis is obtained.
(3) quality inspection is carried out to genotype data, finally has 399 individuals and 1,837,393 InDel are ground for GWAS
Study carefully.
Embodiment 2:chr15:94356743bp InDel molecular labeling classifying method is in pig sexual maturing period trait associations point
Application in analysis
Chr15:94356743bp InDel molecular labeling (if sequence is as shown in SEQ ID NO:1) and sexual maturing period character
Association analysis:
For genotype and phenotype main source that sexual maturing period trait associations are analyzed according to the corresponding product of individual in population
Kind information passes through and consults Animal Genetic Resources in China will (pig will) wikipedia, external correlation pig variety website, pig genetic resources
Pertinent literature etc., has counted the characteristic sexual maturing period of each kind, and will sexual maturing period as phenotype, amount to 399 individuals and
34 kinds.The specific mature phase of kind is divided into three classifications according to statistical result, i.e., precocious (1~3 month reaching property at
It is ripe), in it is ripe (reaching sexal maturity within 4~6 months) and late-maturing (reaching sexal maturity within 6 months or more), and according to the classification number consecutively
It is 1,2,3 as Digital phenotyping.Using the method for mixed linear model, the MLM mould in MVP software package under R statistical environment is utilized
Type carries out GWAS analysis.Concrete model is as follows: y=X β+Z μ+e, wherein y represents the phenotypic number of individual, and it includes principal component that β, which is represented,
Fixed effect including (principle component), μ, which is represented, obeys distribution u~NStochastic effects, the distribution
Middle G represents the affiliation matrix calculated by the SNP of corresponding individual.X and Z represents the incidence matrix of β and μ, and e represents residual vector
(vector of residual errors).The marker genetype is shown in Table 1 with corresponding phenotype individuals number, the significant water of full-length genome
It is flat to be shown in Table 2.
Number of individuals in the polymorphism of 1 chr15:94356743bp InDel of table and corresponding group
The full-length genome level of signifiance of 2 chr15:94356743bp InDel of table
Table 2 illustrates: being significant label when P value P < 0.05/1837393 (the Bonferroni correction) of label
As shown in Table 1, for genotype is the individual of AA, sexual maturing period is at 6 months or more.Using MLM
In the whole-genome association of model, it is significant that chr15:94356743bp InDel label of the invention has reached full-length genome
It is horizontal.It is understood that present invention screening InDel label is related to the sexual maturing period character of pig, and when genotype is AA,
Pig possesses longer sexual maturing period.
Leading reference:
[1]Larson G,Dobney K,Albarella U,et al.Worldwide phylogeography of
wild boar reveals multiple centers of pig domestication[J].Science,2005,307
(5715):1618-1621.
[2]Patterson J L,Beltranena E,Foxcroft G R.The effect of gilt age at
first estrus and breeding on third estrus on sow body weight changes and
long-term reproductive performance[J].Journal of Animal Science,2010,88(7):
2500-2513.
[3]Risch N,Merikangas K.The future of genetic studies of complex
human diseases.[J].Science, 1996,273(3):350-354.
[4]Visscher P M,Brown M A,McCarthy M I,et al.Five years of GWAS
discovery[J].The American Journal of Human Genetics,2012,90(1):7-24.
[5]Mills R E,Pittard W S,Mullaney J M,et al.Natural genetic variation
caused by small insertions and deletions in the human genome[J].Genome
research,2011,21(6):830-839.
[6]Zhang Z,Ersoz E,Lai C Q,et al.Mixed linear model approach adapted
for genome-wide association studies[J].Nature genetics,2010,42(4):355。
Sequence table
<110>Hua Zhong Agriculture University
<120>a kind of InDel molecular labeling relevant to pig sexual maturing period character
<141> 2019-07-19
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 101
<212> DNA
<213>pig (Sus scrofa)
<220>
<221> gene
<222> (1)..(101)
<220>
<221> mutation
<222> (51)..(52)
<400> 1
ataattattt tgggaattac acctttcttt tttgttgttg ttgtctttta agggccacac 60
ctgtggcaca tggaggttcc cagggtaggg gtcaaattgg a 101
Claims (2)
1. a kind of InDel molecular labeling relevant to pig sexual maturing period character, which is characterized in that the nucleosides of the molecular labeling
Sour sequence sequence is as follows:
ATAATTATTTTGGGAATTACACCTTTCTTTTTTGTTGTTGTTGTCTTTTAAG(AG/A)GGCCACACCTGTGG
CACATGGAGGTTCCCAGGGTAGGGGTCAAATTGGA,
The missing of G base occurs at the 51-52bp of the sequence, i.e., is A by AG missing, when idiotype is AA, has
There is longer sexual maturing period conducive to pig.
2. application of the molecular labeling described in claim 1 in pig sexual maturing period marker assisted selection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910719346.XA CN110484631A (en) | 2019-08-01 | 2019-08-01 | A kind of InDel molecular labeling relevant to pig sexual maturing period character |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910719346.XA CN110484631A (en) | 2019-08-01 | 2019-08-01 | A kind of InDel molecular labeling relevant to pig sexual maturing period character |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110484631A true CN110484631A (en) | 2019-11-22 |
Family
ID=68549516
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910719346.XA Pending CN110484631A (en) | 2019-08-01 | 2019-08-01 | A kind of InDel molecular labeling relevant to pig sexual maturing period character |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110484631A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030215783A1 (en) * | 2002-01-18 | 2003-11-20 | Thurston Lisa M. | Genetic markers for semen viability |
| CN107022604A (en) * | 2016-07-12 | 2017-08-08 | 华中农业大学 | Pig NTF3 promoter regions SNP is used as boar reproductive trait molecular labeling and application |
-
2019
- 2019-08-01 CN CN201910719346.XA patent/CN110484631A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030215783A1 (en) * | 2002-01-18 | 2003-11-20 | Thurston Lisa M. | Genetic markers for semen viability |
| CN107022604A (en) * | 2016-07-12 | 2017-08-08 | 华中农业大学 | Pig NTF3 promoter regions SNP is used as boar reproductive trait molecular labeling and application |
Non-Patent Citations (4)
| Title |
|---|
| HYUN-JUNG PARK等: "Stage-specific expression of Sal-like protein 4 in boar testicular germ cells", 《THERIOGENOLOGY》 * |
| JORGE SÁNCHEZ等: "Porcine Breed, Sex, and Production Stage Influence the Levels of Health Status Biomarkers in Saliva Samples", 《FRONT VET SCI》 * |
| 李文婷: "基于全基因组SNP对猪品种分子种质特性挖掘与保护的研究", 《中国优秀博硕士学位论文全文数据库(博士) 农业科技辑》 * |
| 罗立凡: "猪性成熟前后睾丸组织差异表达miRNA鉴定及功能分析", 《中国优秀博硕士学位论文全文数据库(硕士) 农业科技辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Huang et al. | A map of rice genome variation reveals the origin of cultivated rice | |
| Dixon et al. | A genome-wide association study of global gene expression | |
| Coop et al. | The role of geography in human adaptation | |
| Salmela et al. | Genome-wide analysis of single nucleotide polymorphisms uncovers population structure in Northern Europe | |
| CN111278994B (en) | Paralichthys olivaceus disease-resistant breeding gene chip and application thereof | |
| CN112011627B (en) | Molecular marker related to backfat thickness of captive white pig, screening method and application | |
| CN109371143A (en) | SNP marker associated with pig growth traits | |
| US20200087723A1 (en) | Methods and systems for determining paralogs | |
| Teng et al. | Performance of whole genome prediction for growth traits in a crossbred chicken population | |
| Zhang et al. | Recent origin of an XX/XY sex-determination system in the ancient plant lineage Ginkgo biloba | |
| Li et al. | Identification of additive–epistatic QTLs conferring seed traits in soybean using recombinant inbred lines | |
| CN110273011A (en) | A kind of InDel molecular labeling relevant to the long character of pig body | |
| Wu et al. | Pseudorogneria libanotica intraspecific genetic polymorphism revealed by fluorescence in situ hybridization with newly identified tandem repeats and wheat single-copy gene probes | |
| Chai et al. | Rapid identification of a genomic region conferring dwarfism in rapeseed (Brassica napus L.) YA2016-12 | |
| Cheng et al. | Evidence for selection events during domestication by extensive mitochondrial genome analysis between japonica and indica in cultivated rice | |
| CN110484631A (en) | A kind of InDel molecular labeling relevant to pig sexual maturing period character | |
| Figueiro et al. | Control region variability of haplogroup C1d and the tempo of the peopling of the Americas | |
| Yin et al. | Genetic variation between Schistosoma japonicum lineages from lake and mountainous regions in China revealed by resequencing whole genomes | |
| CN111041107B (en) | SNP molecular marker related to pig fetal distance character | |
| CN111118177B (en) | SNP molecular marker related to swine sexual maturity character | |
| CN109022611B (en) | Method for efficiently and accurately identifying rice variety based on whole-genome SNP | |
| Lin et al. | Assessment of genetic diversity and discovery of molecular markers in durian (Durio zibethinus L.) in China | |
| CN111154889A (en) | SNP molecular marker related to pig body weight and application and acquisition method thereof | |
| CN110408707B (en) | Molecular marker cloned from InDel fragment and related to pig hair color property | |
| Zhao et al. | Young SINEs in pig genomes impact gene regulation, genetic diversity, and complex traits |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191122 |