CN110484613B - Ankylosing spondylitis early diagnosis marker - Google Patents

Ankylosing spondylitis early diagnosis marker Download PDF

Info

Publication number
CN110484613B
CN110484613B CN201910604423.7A CN201910604423A CN110484613B CN 110484613 B CN110484613 B CN 110484613B CN 201910604423 A CN201910604423 A CN 201910604423A CN 110484613 B CN110484613 B CN 110484613B
Authority
CN
China
Prior art keywords
ankylosing spondylitis
pdcd10
mir
marker
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910604423.7A
Other languages
Chinese (zh)
Other versions
CN110484613A (en
Inventor
冷小敏
倪文娟
李伟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
First Affiliated Hospital of Xinxiang Medical University
Original Assignee
First Affiliated Hospital of Xinxiang Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by First Affiliated Hospital of Xinxiang Medical University filed Critical First Affiliated Hospital of Xinxiang Medical University
Priority to CN201910604423.7A priority Critical patent/CN110484613B/en
Publication of CN110484613A publication Critical patent/CN110484613A/en
Application granted granted Critical
Publication of CN110484613B publication Critical patent/CN110484613B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/10—Musculoskeletal or connective tissue disorders
    • G01N2800/101—Diffuse connective tissue disease, e.g. Sjögren, Wegener's granulomatosis

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an early diagnosis marker for ankylosing spondylitis. Specifically, the invention discloses application of PDCD10 and miR-495 as a diagnosis marker, a therapeutic effect marker and/or a drug screening marker. By using the marker provided by the invention, the early diagnosis of the ankylosing spondylitis can be carried out only by detecting the mRNA or protein expression condition of PDCD10 in peripheral blood mononuclear lymphocytes, the detection specificity is good, the sensitivity is high, and a very simple and effective mode is provided for the early diagnosis of the ankylosing spondylitis; the expression condition of the drug can be changed along with the treatment effect, and the drug can be used as a curative effect marker to effectively monitor the effectiveness of a treatment scheme, so that the treatment of the ankylosing spondylitis is more targeted and targeted; meanwhile, the protein can be used as a target for screening medicaments for treating the ankylosing spondylitis, and can be effectively screened for treating the ankylosing spondylitis.

Description

Ankylosing spondylitis early diagnosis marker
Technical Field
The invention relates to the technical field of biomedicine, in particular to an early diagnosis marker for ankylosing spondylitis.
Background
Ankylosing Spondylitis (AS) is a common chronic autoimmune disease, characterized by early onset and unclear pathogenesis. The disease can lead to a reduction in the quality of life of the patient by affecting the sacroiliac joint and the axial bones. The early onset age of AS is generally younger, affecting more men than women, in a ratio of about 2:1. the time interval between symptom onset and diagnosis of AS is 8-11 years due to the vague symptoms in early diagnosis. Despite the existing advanced imaging techniques, anti-inflammatory drugs and physical therapies, this still presents significant challenges for the early diagnosis and treatment of AS.
In the prior art, although the mRNA expression levels of miR-21 and programmed cell death molecule 4 (PDCD4) in AS patients are reported to be remarkably increased, the inventor further tests show that the mRNA expression levels can not be used AS a marker for early diagnosis and treatment evaluation of ankylosing spondylitis.
Programmed cell death molecule 10 (PDCD10), originally cloned in human cell line TF-1, was also called TFAR15 (TF-1 cell death related gene 15). Mutation of the gene can cause intracranial cavernous hemangiomas (CCMs) to occur, and cause symptoms of epilepsy, hemorrhage, stroke and the like of patients. PDCD10 may also be referred to as CCM3 as a causative gene of the 3 rd CCMs. The gene of PDCD10 is numbered 11235 in GeneID of NCBI, NM-007217 in GenBank and NP-009148 in protein access. Number Q9BUL8 in protein database UniProtKB. In recent years, it has been found that it can bind to and form interaction with various proteins such as VEGFR2, CCM2, ERM, etc. By regulating MAPK/ERK-pathway, PDCD10 can enhance the stability of MST4/VEGFR2 and promote corresponding signal transduction.
The prior art lacks effective early diagnosis markers for ankylosing spondylitis.
Disclosure of Invention
The invention aims to overcome the defect of difficulty in early diagnosis of ankylosing spondylitis in the prior art and provide an early diagnosis marker for ankylosing spondylitis.
The first purpose of the invention is to provide the application of PDCD10 gene and/or protein as a diagnostic marker of ankylosing spondylitis in the preparation of a diagnostic reagent or a kit for ankylosing spondylitis.
The second purpose of the invention is to provide application of PDCD10 gene and/or protein as a therapeutic effect marker of ankylosing spondylitis in preparation of a therapeutic effect evaluation reagent or kit for ankylosing spondylitis.
The third purpose of the invention is to provide the application of PDCD10 gene and/or protein as the ankylosing spondylitis drug screening marker in the preparation of ankylosing spondylitis drug screening reagent or kit.
The fourth purpose of the invention is to provide the application of miR-495 as a ankylosing spondylitis diagnostic marker in the preparation of ankylosing spondylitis diagnostic reagent or kit.
The fifth purpose of the invention is to provide application of miR-495 as a ankylosing spondylitis treatment effect marker in preparation of a ankylosing spondylitis treatment effect evaluation reagent or kit.
The sixth purpose of the invention is to provide application of miR-495 as a ankylosing spondylitis drug screening marker in preparation of a ankylosing spondylitis drug screening reagent or kit.
The seventh purpose of the invention is to provide a kit for diagnosis of ankylosing spondylitis, evaluation of treatment effect of ankylosing spondylitis, and/or drug screening of ankylosing spondylitis.
In order to realize the purpose, the invention is realized by the following technical scheme:
PDCD10 can regulate cell proliferation, differentiation and apoptosis in angiogenesis, oxidative stress and tumorigenesis. The inventor finds that PDCD10 presents up-regulated expression in AS through qPCR and Western blot; further mechanism research shows that miR-495 identifying the gene is in down-regulation expression in AS, and the expressions of PDCD10 and miR-495 are in negative correlation; in vivo and in vitro experiments show that PDCD10 is an important target gene of miR-495; ROC curve analysis shows that PDCD10 is a potential molecular marker for AS diagnosis; and PDCD10 may indicate therapeutic administration of AS, and PDCD10 exhibits down-regulated expression under the action of first-line anti-inflammatory drugs NSAIDs of AS.
The invention therefore claims the following:
the PDCD10 gene and/or protein is used as an ankylosing spondylitis diagnosis marker in the application of preparing ankylosing spondylitis diagnosis reagents or kits.
The PDCD10 gene and/or protein is used as a therapeutic effect marker of ankylosing spondylitis in the preparation of a therapeutic effect evaluation reagent or kit for ankylosing spondylitis.
The PDCD10 gene and/or protein is used as an ankylosing spondylitis drug screening marker in the preparation of ankylosing spondylitis drug screening reagents or kits.
The application of miR-495 as a ankylosing spondylitis diagnostic marker in preparation of ankylosing spondylitis diagnostic reagent or kit.
The application of miR-495 as a ankylosing spondylitis treatment effect marker in preparation of ankylosing spondylitis treatment effect evaluation reagents or kits.
Application of miR-495 as a ankylosing spondylitis drug screening marker in preparation of ankylosing spondylitis drug screening reagent or kit.
A kit for diagnosing ankylosing spondylitis, evaluating the treatment effect of ankylosing spondylitis and/or screening ankylosing spondylitis drugs comprises a detection reagent of one or more of a PDCD10 gene, a PDCD10 protein and/or miR-495.
Preferably, the PDCD10 gene detection reagent is a qPCR primer of PDCD 10.
More preferably, the nucleotide sequence of the qPCR primer of PDCD10 is as set forth in SEQ ID NO:1 to 2.
Preferably, the PDCD10 protein detection reagent is a detection antibody of PDCD 10.
Preferably, the miR-495 detection reagent is a qPCR primer of miR-495.
More preferably, the qPCR primers of miR-495 comprise the nucleotide sequence as set forth in SEQ ID NO:3, and the nucleotide sequence of the reverse transcription primer of miR-495 shown in SEQ ID NO:4 to 5.
A ankylosing spondylitis diagnostic kit detects mononuclear lymphocytes in peripheral blood, and compared with healthy people, the increase of PDCD10 gene and/or protein expression or the decrease of miR-495 expression indicates that a patient has the risk of suffering from ankylosing spondylitis.
A ankylosing spondylitis treats the evaluation kit of the effect, detect the mononuclear lymphocyte in peripheral blood of the patient treated, compared with not treating PDCD10 gene and/or protein expression is reduced, or miR-495 expression is risen and is shown that treating has effects; otherwise, the treatment effect is not obvious.
A ankylosing spondylitis drug screening kit detects a test substance treated with a drug to be tested, and if the expression of PDCD10 gene and/or protein is decreased or the expression of miR-495 is increased after the test substance is treated with the drug to be tested compared with that before the treatment, the treatment effect of the drug to be tested on ankylosing spondylitis is indicated.
Compared with the prior art, the invention has the following beneficial effects:
the invention can carry out early diagnosis of ankylosing spondylitis by only detecting the mRNA or protein expression condition of PDCD10 in peripheral blood mononuclear lymphocytes, has good detection specificity and high sensitivity, and provides a very simple and effective mode for early diagnosis of ankylosing spondylitis; the expression condition of the drug can be changed along with the treatment effect, and the drug can be used as a curative effect marker, so that the effectiveness of a quality scheme can be effectively monitored, and the treatment of the ankylosing spondylitis is more targeted and targeted; meanwhile, the screening target can be used as a screening target of the drug for treating the ankylosing spondylitis, and the screening for treating the ankylosing spondylitis can be effectively carried out.
Drawings
FIG. 1 shows the expression detection of PDCD family genes in AS; (A) heatmap of PDCD family gene expression, HC Control: healthy controls, AS: AS patients; (B) histogram of PDCD family gene expression,.: represents a significant difference, and P <0.01, hc: healthy controls, AS: patients with AS; (C) protein detection of PDCD10, HC-1, HC-2, HC-3: different healthy controls, AS-1, AS-2, AS-3: different AS patients, GADPH: an internal reference gene; (D) histogram of PDCD10 protein assay levels: represents a significant difference, and P <0.01, hc: healthy controls, AS: AS patients.
FIG. 2 shows the detection of miR-495 and miR-495 in relation to the expression of PDCD 10; (a) detection of miR-495,.: represents a significant difference, and P<0.01, HC: healthy controls, AS: AS patients; (B) Detection of correlation between miR-495 and PDCD10 expression and significant difference P<0.01, correlation coefficient R 2 ＝0.81。
FIG. 3 shows that miR-495 can identify 3' UTR of PDCD10 in vitro and in vivo experiments; (A) miR-495 recognizes the sequence of the 3' UTR region of PDCD10, bases paired with miR-495 and PDCD10 are indicated by a vertical line part, and the sequence of the base paired with Mut-miR-495: mutant miR-495, wherein the green portion represents the mutant sequence, mut-PDCD10: mutated PDCD10, wherein the green portion represents the mutated sequence; (B) In vitro dual-Luciferase experiments prove that miR-495 can recognize PDCD10, luciferase activity: dual luciferase activity, vector PDCD10: vector containing 3' UTR of wild type PDCD10, vector Mut-PDCD10: a vector comprising a 3' utr of mutant PDCD10, miR-495PDCD10: wild miR-495 and a wild PDCD10 expression vector, miR-495Mut-PDCD10: wild miR-495 and mutant PDCD10 expression vector, mut-MiR-495PDCD10: mutant miR-495 and wild type PDCD10 expression vector Mut-MiR-495Mut-PDCD10: mutant miR-495 and mutant PDCD10 expression vector, wherein: p <0.01; (C) influence of miR-495 overexpression on RNA level of PDCD 10; (D) Protein level effect of miR-495 overexpression on PDCD10, mock: untreated group, vector: overexpression empty vector group, control: overexpression control group, miR-495: miR-495 overexpression group.
FIG. 4 shows the expression detection of PDCD10 and miR-495 before and after the action of NSAIDs; (A) RNA expression detection of miR-495 before and after the action of NSAIDs; (B) RNA level detection of PDCD10 before and after NSAIDs effect; (C) Detection of PDCD10 protein levels before and after NSAIDs effect, BN-1, BN-2, BN-3 indicate different AS patients before taking NSAIDs, and AN-1, AN-2, AN-3 indicate different AS patients after taking NSAIDs.
FIG. 5 is a ROC curve for miR-495, PDCD10, PDCD4 and the correlation of PDCD10 to the AS disease assessment Scale mPASSS, BASDAI; (A) ROC curve for miR-495; assessment of specificity and sensitivity curves AS a diagnosis of AS disease showed that with an accuracy of 72.73% (Area = 0.7273) of AS prediction, the P value was 0.009851 (P value = 0.009851), the 95% confidence interval was 0.5736 to 0.8810: (B) ROC curve of PDCD 10; evaluation of specificity and sensitivity curves AS a diagnosis of AS disease showed that, with an accuracy of 84.09% (Area = 0.8409) for AS prediction, the P value was 0.0001089 (P value = 0.0001089), the 95% confidence interval was 0.7147 to 0.9671: (C) the ROC curve for PDCD 4; evaluation of specificity and sensitivity curves AS a diagnosis of AS disease showed a P value of 0.7963 (P value = 0.7963) with 95% confidence interval of 0.3503 to 0.6951 with an accuracy of 52.27% (Area = 0.5227) of AS prediction. Sensitivity: sensitivity, specificity: specificity, 95% confidence interval, P value: a P value; (E) correlation of PDCD10 to the AS disease assessment scale mSASSS. (F) relevance of PDCD10 to the AS disease assessment Scale BSDAI.
Detailed Description
The invention is described in further detail below with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.
qPCR detection primers for PDCD10 and miR-495 used in the following examples:
Figure BDA0002120338690000051
example 1 trends in expression of PDCD10 in ankylosing spondylitis patients
1. Experimental method
1. Extraction of RNA and qPCR
Whole blood from patients with AS was obtained in 3ml from clinical departments and collected using EDTA2Na anticoagulation tubes. The health control blood sample is from the outpatient physical examination population. The blood samples obtained were immediately subjected to the subsequent experimental procedures.
(1) Mononuclear lymphocytes from peripheral blood were obtained by separation using Ficoll (TBDscience, code No: LTS 1077) and by reference to the instructions.
(2) RNAiso Plus (Takara, code No: 9108) was added and total RNA from the cells was extracted for subsequent quantitative detection of RNA according to the instructions.
(3) Synthesis of cDNA PrimeScript TM RT reagent Kit with gDNA Eraser (Takara, code No: RR 047A) was performed as described
The specific reaction system is as follows:
5×gDNA Eraser Buffer 2μL
gDNA Eraser 1μL
total RNA 500ng
RNase-free H 2 O Adding to 10 μ L
Reacting at 42 deg.C for 2min, and storing at 4 deg.C.
To the above system the following reagents were added:
reagent Amount of the composition used
Reverse transcription reaction solution 10μL
PrimeScript RT Enzyme Mix I 1.0μL
RT Primer 1.0μL
5×PrimeScript Buffer 2(for ReaL Time) 4.0μL
RNase-free H 2 O 4.0μL
30min at 37 ℃; 5sec at 85 ℃; storing at 4 ℃.
(4) qPCR assay using SYBR (Takara, code No: RR 420A), reference manual
The amplification system was as follows:
Figure BDA0002120338690000061
Figure BDA0002120338690000071
the qPCR amplification reaction program was:
Figure BDA0002120338690000072
2. western blot detection
(1) Collecting a protein sample: peripheral mononuclear cells isolated from Ficoll were treated with protein lysate (reference picnic RIPA lysate). The protein concentration of each protein sample was then determined by BCA protein concentration assay. And finally, pretreating a sample: 5 xSDS-PAGE protein loading buffer was added to the collected protein samples. Heating at 100 deg.C for 10min, and cooling on ice. The loading amount of protein is 20ug.
(2) 10% SDS-PAGE electrophoresis: the concentrated gel is subjected to electrophoresis at a constant voltage of 90V for 30min, and when bromophenol blue enters the separation gel, the gel is subjected to electrophoresis at a constant voltage of 120V for 100min.
(3) Film transfer: and a PVDF membrane, a membrane rotating tank is placed in ice water, the membrane rotating current is 300mA, and the membrane rotating time is 90min.
(4) And (3) sealing: after the membrane is transferred, 5% skimmed milk is immediately used, and the shaking table is closed at low speed for 60-90 min at room temperature. After blocking, the membrane was washed 3 times 5min each with TBST.
(5) Primary anti-incubation: primary antibody was diluted with 5% skim milk according to the instructions for primary antibody and was allowed to cool overnight at 4 ℃. The next day, membranes were washed 3 times 5min with TBST.
(6) And (3) secondary antibody incubation: the secondary antibody was diluted with TBST according to the instructions for the secondary antibody and incubated at low speed in a shaker at room temperature for 1h. The membrane was washed 3 times 5min each time with TBST.
(7) Protein detection: according to the chemiluminescence method, ECL was used to detect the amount of protein expression.
2. Results of the experiment
From fig. 1A and 1B, it can be seen that RNA levels expressed by PDCD10 were significantly increased in AS. AS can be seen in fig. 1C and 1D, protein levels expressed by PDCD10 were significantly increased in AS. It can be seen that PDCD10 is up-regulated in the AS.
Example 2 detection of miR-495 and miR-495 in relation to expression of PDCD10
1. Experimental methods
RNA samples of AS patients and healthy controls were subjected to miR-495 expression assay. RNA extraction and qPCR methods were the same as in example 1. The reverse transcription primer of miR-495 adopts a specific primer, and the reverse transcription conditions are as follows: 30min at 37 ℃; 5sec at 85 ℃; storing at 4 ℃. Other conditions were the same as in example 1. When MiR-495 and PDCD10 expression correlation analysis is carried out, miR-495 as an independent variable in the same RNA sample is placed on the horizontal axis, and PDCD10 as a dependent variable is placed on the vertical axis and plotted.
RNA extraction and qPCR, as in example 1.
2. Results of the experiment
From fig. 2A, it can be seen that miR-495 significantly down-regulated expression in AS. And its expression level is inversely correlated with PDCD10 (FIG. 2B).
Example 3 identification of miR-495 to 3' UTR of PDCD10
1. Experimental methods
1. In vitro dual luciferase assay
The RNA mimic (5 'AAACAAAACAUGGUGCACUUCUU) -3' of MiR-495 and the corresponding mutation (5 'CAAAAAAAAAAAUGGUGCACUUCUU-3') were synthesized by Shanghai Jima (Shanghai Genephrma). The backbone vector used in this experiment was psiCHECKTM-2 (Promega). Amplification and cloning of wild type and mutant 3' UTR regions of PDCD10 was accomplished by warkinikari (GeneCreate). The dual-luciferase assay kit is derived from Biyun (Cat. No. RG027, a beyond enzyme assay of biotechnology). The detection instrument is Glomax (Promega).
The process is briefly divided into:
(1) The instrument Glomax was started in advance, and the measurement time was set to 10 seconds, and the measurement interval time was set to 2 seconds.
(2) After the reporter gene cell lysate was mixed well, a 48-well plate was used in this study, and 150 μ L of reporter gene cell lysate was added per well to lyse the cells sufficiently.
(3) After sufficient lysis, 10,000-15,000g was centrifuged for 3 minutes and the supernatant was taken for assay.
(4) And (3) melting the firefly luciferase detection reagent and the renilla luciferase detection buffer solution, and reaching the room temperature. Renilla luciferase assay substrate (100X) was placed on ice until use.
(5) According to the amount of 100 microliters required for each sample, a proper amount of renilla luciferase detection buffer solution was taken, and a renilla luciferase detection substrate (100 ×) was added according to 1.
(6) A sample (100. Mu.l) was taken, and RLU (relative light unit) was determined by adding 100. Mu.l of a reagent for detecting firefly luciferase, and homogenizing the sample with a gun or other appropriate means. Reporter cell lysates were used as blank controls.
(7) After completion of the above procedure for measuring firefly luciferase, 100. Mu.l of Renilla luciferase assay working solution was added, and RLU (relative light unit) was measured after homogenizing with a gun or other appropriate means.
(8) In this study, renilla luciferase was used as an internal control, and the relative luciferase activity was determined by dividing the RLU value of firefly luciferase by the RLU value of Renilla luciferase. This value was used to compare the extent of reporter gene activation between different samples.
2. Cell level adenovirus overexpression miR-495 expression experiment
(1) Peripheral monocyte in vitro culture:
mononuclear lymphocytes from peripheral blood were isolated using Ficoll (TBDscience, code No: LTS 1077) and according to the instructions;
using 1640 medium containing 10% fetal bovine serum, 1% diabody (penicillin and streptomycin), at 37 deg.C, 5% CO 2 The cell culture box is used for culturing cells.
(2) miR-495 overexpression and transfection of peripheral monocytes
Constructing miR-495 overexpression construction process: miRNA-495 was first cloned into the p DC316-m CMV-EGFP vector. The vector is then recombined with Ad Easy and packaged to purify adenovirus miRNA-495 with infectivity. Finally, detecting the expression quantity of miR-495 by observing GFP and qPCR through a fluorescence microscope. The miR-495 expression of adenovirus and the control were performed by Shanghai Jikai ((Shanghai Genechem) Inc.. Under the transfection condition of 70-80% cell density, using a 6-well plate, after 48 hours of transfection, the cells were collected and subjected to the subsequent RNA and protein expression detection experiments (the specific method is the same as in example 1).
2. Results of the experiment
In vitro dual luciferase experiments showed that: miR-495 can identify the 3' UTR region of PDCD10 (FIGS. 3A and 3B). Further in vivo overexpression experiments showed that: the RNA level of PDCD10 is not basically influenced by miR-495, but the protein level thereof is regulated by miR-495 (FIGS. 3C and 3D). This fully suggests that PDCD10 is a target gene for miR-495.
Example 4 expression of PDCD10 and miR-495 by NSAIDs
1. Experimental method
NSAIDs (non-steroidal anti-inflammatory drugs) are first line drugs for AS treatment. To evaluate the efficacy of PDCD10 and miR-495 in the treatment of AS by NSAIDs, the expression of PDCD10 and miR-495 in peripheral lymphocytes of AS patients was examined under the action of NSAIDs. The usage of NSAIDs (national Standard character number: H41020415): 100mg (1 capsule), 1 time daily. The treatment course is 16 weeks and is recorded on the table. Blood samples from patients who were diagnosed and who were pre-and post-treatment with written informed consent for expression of PDCD10 and miR-495 were tested AS in examples 1 and 2.
2. Results of the experiment
The results show that miR-495 is upregulated in RNA level expression (fig. 4A) and PDCD10 is downregulated in RNA and protein level expression (fig. 4B and 4C) under the effect of first-line drugs NSAIDs in AS treatment. This also indicates that PDCD10 may be well used for assessment of AS prognosis.
Example 5 correlation of PDCD10 with AS
1. Experimental methods
The ROC (receiver operating characteristic) curve can objectively reflect the quality of the diagnostic method and comprises sensitivity, specificity and accuracy indexes. PDCD10 expression data was divided into a group a (AS patient group) and a group B (healthy control group) under column mode using Graphpad prism software. ROC curve analysis was performed. ROC curve analysis of miR-495 and PDCD4 is carried out once according to the method.
Stoke ankylosing spondylitis spine scoring system (modified Stoke and spinal grading spine score, mSASSS): spinal structural damage was assessed in patients with AS. The higher the overall score, the more severe the spinal damage. The bye disease activity score (basedia) was used for the assessment of ankylosing spondylitis disease status, the higher the assessment score, the more severe the AS disease.
The PDCD10 and mASSS, PDCD10 and BASDAI analyses were analyzed using Graphpad prism software, where the amount of PDCD10 expression in AS patients is plotted on the ordinate and mASSS and BASDAI are plotted on the abscissa, respectively. R is a correlation coefficient, and the P value is less than 0.001.
2. Results of the experiment
To investigate the application of PDCD10 and miR-495 in clinical diagnosis and detection, the sensitivity and specificity in AS disease diagnosis were evaluated using the ROC curve (fig. 5). The results show that: within the 95% confidence interval, the accuracy can reach 84.09% (P = 0.0001089) and 72.73% (P = 0.009851), respectively, which can be used AS molecular markers in AS diagnosis. In contrast, previously reported PDCD4 associated with ankylosing spondylitis achieved only 52.27% accuracy (P = 0.7963) in the 95% confidence interval, and was not used at all for AS diagnosis.

Claims (3)

  1. The PDCD10 gene and/or protein is used as a diagnostic marker of ankylosing spondylitis in the preparation of a diagnostic reagent or a kit for ankylosing spondylitis.
  2. And 2, the PDCD10 gene and/or protein is used as a therapeutic effect marker of the ankylosing spondylitis in the preparation of a therapeutic effect evaluation reagent or kit for the ankylosing spondylitis.
  3. The PDCD10 gene and/or protein is used as a ankylosing spondylitis drug screening marker in the preparation of ankylosing spondylitis drug screening reagents or kits.
CN201910604423.7A 2019-07-05 2019-07-05 Ankylosing spondylitis early diagnosis marker Active CN110484613B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910604423.7A CN110484613B (en) 2019-07-05 2019-07-05 Ankylosing spondylitis early diagnosis marker

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910604423.7A CN110484613B (en) 2019-07-05 2019-07-05 Ankylosing spondylitis early diagnosis marker

Publications (2)

Publication Number Publication Date
CN110484613A CN110484613A (en) 2019-11-22
CN110484613B true CN110484613B (en) 2022-11-22

Family

ID=68546111

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910604423.7A Active CN110484613B (en) 2019-07-05 2019-07-05 Ankylosing spondylitis early diagnosis marker

Country Status (1)

Country Link
CN (1) CN110484613B (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113621618A (en) * 2020-05-25 2021-11-09 天津市环湖医院(天津市神经外科研究所、天津市脑系科中心医院) Autosomal dominant CCM2 gene mutant and application thereof
CN112266955B (en) * 2020-10-26 2023-10-20 川北医学院附属医院 Ankylosing spondylitis diagnostic marker and application thereof
CN112210600B (en) * 2020-11-15 2022-02-08 安徽中医药大学第一附属医院(安徽省中医院) Application and detection method of circRNA0003307 gene
CN114622008B (en) * 2022-01-27 2023-05-30 赣南医学院 Application of MST4 gene as ankylosing spondylitis diagnostic marker

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106434907A (en) * 2016-09-19 2017-02-22 新乡医学院第附属医院 Application of miR-495 as marker for detecting ankylosing spondylitis

Also Published As

Publication number Publication date
CN110484613A (en) 2019-11-22

Similar Documents

Publication Publication Date Title
CN110484613B (en) Ankylosing spondylitis early diagnosis marker
EP3350345B1 (en) Biomarkers for heart failure
CN106978480A (en) Molecular diagnostic assay for cancer
US11339438B2 (en) Method for assessing the risk of complications in patients with systemic inflammatory response syndrome (sirs)
CN112961913B (en) Application of lncRNA in diagnosis and treatment of recurrent abortion
JP2013526845A (en) Genes and combinations of genes that predict an initial response or non-response of a subject suffering from an inflammatory disease to a cytokine targeted drug (CyTD)
CN110564850B (en) EWSR1-TFEB fusion gene and detection primer and application thereof
CN114107492B (en) Molecular marker for tumor molecular typing and therapeutic drug evaluation, and detection primer and kit thereof
CN109022433B (en) New translocation partner of TFEB (TFEB), detection primer and application thereof
JP7209930B2 (en) Parkinson&#39;s disease determination marker and determination method
CN110331207A (en) Adenocarcinoma of lung biomarker and related application
CN111979315A (en) Application of annular TP63 as lung squamous carcinoma diagnosis or treatment target
CN110820051B (en) High-sensitivity fusion gene detection method and application thereof
CN114582509A (en) Grape membrane melanoma prognosis risk scoring model and application thereof
CN113234812A (en) Diagnostic reagent for diagnosing Alzheimer disease
CN100519748C (en) Human genetic deaf related GJB6 mutant gene and its uses in gennetic deaf diagnosis
CN111733227A (en) Molecular marker circRNA for diagnosing idiopathic optic neuritis, kit and application
RU2745424C1 (en) Method for diagnosing breast cancer and ovarian cancer by mmp-9 mrna level in blood plasma
CN114908171B (en) Application of human HHIPL2mRNA in targeted therapy and prognosis evaluation of non-small cell lung cancer and kit
CN114015781B (en) Detection kit for LncRIM gene and application thereof
CN113403390B (en) Application of lncRNA in diagnosis and treatment of children myocarditis
CN115896263B (en) Application of LncRNA ENST00000440246.1 in Alzheimer disease
CN111235276B (en) Castration-resistant prostate cancer diagnosis and/or prognosis evaluation marker LncRNA ZNF518A and application thereof
US20220259661A1 (en) Kit for assessing the risk of complications in patients with systemic inflammatory response syndrome (sirs)
WO2023020638A1 (en) Method for predicting a severity of an infectious disease and biomarker for use in carrying out the method and monitoring a therapy of an infectious disease

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant