CN110484541A

CN110484541A - A kind of hirudin coding gene and the host system comprising the gene

Info

Publication number: CN110484541A
Application number: CN201910832553.6A
Authority: CN
Inventors: 石萍; 鲁增辉; 游华建; 陈仕江
Original assignee: Chongqing Academy of Chinese Materia Medica
Current assignee: Chongqing Academy of Chinese Materia Medica
Priority date: 2019-09-04
Filing date: 2019-09-04
Publication date: 2019-11-22

Abstract

The invention discloses a kind of hirudin coding gene and include the host system of the gene.The present invention obtains the encoding gene using a variety of PCR methods from Hirudo japonica salivary organization for the first time, breaches the nucleotide sequence for speculating gene according to the amino acid sequence of known albumen or polypeptide in the past, then carries out artificial synthesized conventional method.It is recombinated in expression vector after obtaining encoding gene using the method in the present invention, and expression vector is converted into host cell, hirudin can be efficiently produced using host cell, can effectively solve the problems, such as that pharmacopeia leech kind is unable to satisfy people's medication demand because of the problems such as biomass is small, resource constraint.

Description

A kind of hirudin coding gene and the host system comprising the gene

Technical field

The invention belongs to gene engineering technology fields, and in particular to a kind of hirudin coding gene and the place comprising the gene Main system.

Background technique

Hirudin is strongest natural anticoagulin in the nature being currently known, in terms for the treatment of cardiovascular and cerebrovascular disease It is strong with target, rapid-action, the unique advantages such as have no toxic side effect.Since natural hirudin raw material is limited, low output, cost Height limits its clinical application.It is unique containing hirudin that Hirudo japonica (Hirudo nipponia) is that Chinese Pharmacopoeia records Leech medicinal material kind has extremely strong antithrombin activity and antiplatelet aggregative activity, clinical treatment cardiovascular and cerebrovascular disease effect Fruit is splendid, and supply falls short of demand for medicinal material and product, in addition scarcity of resources, it is difficult to solve the medication demand of the people.

Hirudin gene sequence is obtained at present and is all made of full artificial synthesis, i.e., according to known albumen or the ammonia of polypeptide Base acid sequence deduces the nucleotide sequence of corresponding construction gene, then carries out artificial synthesized.This method is although easy to operate, but Since natural hirudin is there are a variety of variants, it is difficult to obtain target gene sequence.

Pichia pastoris (Pichia pastoris) expression system is in recent years in terms of exogenous protein expression using relatively wider General kit, and be widely used in vaccine antigen, cell factor, protease, protein hormone and antibody etc. biology is living The expression of property albumen.Having in the research and development of protein formulation compared to other expression vectors pichia yeast expression system can not The advantage of analogy.In medicine and clinically have broad application prospects.

Summary of the invention

For the above-mentioned prior art, the present invention provides a kind of hirudin coding gene and obtains the side of the encoding gene Method, and a kind of new recombinant plasmid and host system are obtained based on the encoding gene, to solve pharmacopeia leech kind because of biomass The problem of the problems such as small, resource constraint, is unable to satisfy people's medication demand.

In order to achieve the above object, the technical scheme adopted by the invention is that: a kind of hirudin coding gene is provided, encode The coded sequence of gene is as shown in SEQ ID NO.4.

The acquisition of hirudin coding gene the following steps are included:

S1: taking Hirudo japonica, its salivary organization of picking is put into spare in RNAwait；

S2: the RNA in salivary organization is extracted；

S3: the synthesis of the first chain of cDNA is carried out according to the RNA of extraction, and carries out expanding to obtain core sequence, core sequence accordingly Column are as shown in SEQ ID NO.1；

S4: 5 ' ends and 3 ' end rapid amplifyings are carried out to cDNA, and are sequenced respectively, sequencing result is respectively such as SEQ ID Shown in NO.2 and SEQ ID NO.3；

S5: go out hirudin coding gene according to sequence assembly is obtained in core sequence and S4.

The synthesis of the first chain of cDNA includes the following steps: in S3

(1) RNA is mixed with the oligo primer that concentration is 100uM by the solid-liquid ratio of 1:1 μ g/ μ L；

(2) said mixture is placed into 5min, then cooled on ice 1min at 65 DEG C；Then it is added into mixture 5Xreaction buffer, RiboLock RNase Inhibitor, dNTP mix and RevertAid M-MuLV Reverse Transcriptase is then centrifuged；

(3) mixed liquor after centrifugation is placed in PCR instrument, 42 DEG C of incubation 1h；Then 5min is assigned at 70 DEG C, is completed The synthesis of the first chain of cDNA.

PCR amplification system in S3 are as follows:

Wherein, primer F and primer R is respectively as shown in SEQ ID NO.1 and SEQ ID NO.2.

The present invention also provides the expression vectors of a kind of recombinant plasmid, and recombinant plasmid preferentially to select Pichia pastoris pPIC9K。

Based on obtained recombinant plasmid, the present invention gives a kind of host system, and host system comprising hirudin by compiling The recombinant plasmid transformed eukaryotic host cell of code gene obtains.

Eukaryotic host cell is preferably Pichia pastoris GS115 in the present invention.

The beneficial effects of the present invention are:

1. the present invention obtains Hirudo japonica hirudin gene overall length in the way of clone for the first time.

2. the present invention obtains recombined engineering yeast strain, there is high expression hirudin activity, medicine with higher and face Bed application value；Hirudo japonica engineering hirudin research blank has been filled up simultaneously, fills up the huge notch in China hirudin market, Meet cardiovascular and cerebrovascular disease there is an urgent need to ward off shortcut separately for the modernization of Chinese medicine of Hirudo japonica medicinal material.

Detailed description of the invention

Fig. 1 is the target fragment electrophoresis detection result of the first chain of Hirudo japonica cDNA；

Fig. 2 is in 5 ' RACE experimentations to the electrophoresis detection result after the cDNA progress wheel amplification of PCR second for adding dC tail；

Fig. 3 is to carry out the electrophoresis detection result after the wheel amplification of PCR second to cDNA in 3 ' RACE experimentations；

Fig. 4 is PCR amplification target fragment recovery purifying electrophoretogram in gene cloning procedures；

Fig. 5 is bacterium solution PCR qualification result；

Fig. 6 is positive bacterium solution digestion verification result；

Fig. 7 is pPIC9K target gene plasmid linearization result；

Fig. 8 is that plasmid pPIC9K PCR screens (empty control plasmid) agarose gel electrophoresis results figure；

Fig. 9 is that positive transformant PCR screens agarose gel electrophoresis results；

Figure 10 is positive transformant -7SDS-PAGE electrophoresis detection result figure；

Figure 11 is positive transformant -8SDS-PAGE electrophoresis detection result figure；

Figure 12 is Western blotting sample electrophoresis results of comparison；

Figure 13 is Western blotting result；

Figure 14 is pPIC9K Vector map.

Specific embodiment

Below with reference to embodiment, specific embodiments of the present invention will be described in detail.

Embodiment one: hirudin gene is obtained

1. experimental material

Hirudo japonica salivary organization sample.The present invention is dissected using low temperature on ice, rinses dissection beginning portion with DEPC water, Removal residual external source blood and other impurities, quick picking salivary organization, being put into RNAwait prevents tissue sample RNA from dropping Solution.

2. the RNA of tissue sample is extracted

(1) Trizol of 1mL is added in tissue after liquid nitrogen grinding, and mixture is placed at room temperature for 5min, so as to sample quilt Trizol is sufficiently cracked；

(2) chloroform (chloroform) is added into the sample after cracking, 200 μ are added with 1mL lysed sample in chloroform additive amount Subject to L chloroform；Then pipe lid is covered tightly, acutely rocks 15s up and down, then be placed at room temperature for 3min, then 12000g is centrifuged at 4 DEG C 15min；

(3) after being centrifuged, liquid layered in pipe, shift the colourless liquid (about total volume 50% or so) of top layer to one it is new The EP pipe without RNA enzyme in；It cannot be drawn onto the liquid of lower layer in transfer process and be suspended in intermediate white depositions, draw In the process, EP pipe is inclined to 45° angle；

(4) 100% isopropanol of 500 μ L is added into the supernatant liquid being transferred out of, is placed at room temperature for 10min, then at 4 DEG C Lower 12000g is centrifuged 10min；

(5) supernatant is carefully sucked, 75% ethyl alcohol (75% ethyl alcohol is configured with DEPC water) is added and turns upside down eight times, then exists 7500g is centrifuged 5min at 4 DEG C；

(6) it after removing ethyl alcohol, uncaps and is placed at room temperature for 5~10min to get the RNA for arriving purifying.

The synthesis of the first chain of 3.cDNA

(1) total serum IgE of 1 μ g and oligo (dT) primer of the 100uM of 1 μ L are added in the PCR pipe of no RNA enzyme, is used in combination It is 12 μ L that the processed aqua sterilisa of DEPC, which adds to volume,；

(2) 1min is cooled down on ice immediately after above-mentioned mixed liquor to be placed to 5min at 65 DEG C；Then into mixed liquor according to 4 μ L 5Xreaction buffer of secondary addition, 1 μ L RiboLock RNase Inhibitor (20u/ μ L), 2 μ L 10mM DNTP mix, 1 μ L RevertAid M-MuLV Reverse Transcriptase (200u/ μ L), jog mix, and of short duration Centrifugation；

(3) mixed liquor after centrifugation is placed in PCR instrument, 42 DEG C of incubation 1h；Then 5min is assigned at 70 DEG C, is terminated anti- It answers, completes the synthesis of the first chain of cDNA.

4. design of primers and sequence amplification

(1) design of primers is carried out using Primer Premier5.0 software, You Shenggong bioengineering (Shanghai) share is limited Company is synthesized, and carries out PCR amplification.Designed primer is as shown in table 1.

1 Primer of table and sequence

(2) reaction system and condition for PCR amplification being carried out in the present invention are respectively as shown in table 2 and table 3.

2 PCR reaction system of table

3 PCR reaction condition of table

(3) recovery purifying of target fragment

PCR product carries out electrophoresis in 1.0% Ago-Gel, adjusts voltage to 120V, electrophoresis 0.5h, film recording electricity Swimming cuts rapidly purpose band as a result, observe in the UV lamp.Target fragment is recycled with plastic recovery kit (OMEGA), specifically Method is carried out by kit specification.Shown in target fragment electrophoresis detection result figure 1.

(4) be sequenced: PCR product after purification is sent to the raw work sequencing in Shanghai, and sequencing result is as follows:

GATCTGAAAAAATCTCAACGATGTTCTCTCTGAAATTGTTCGTCGTTCTGTTGGCAGTTTGCATCTGC ACGTCTCAAGCTCAGCATTTCAAAGATTGCTCAGACAGCAATCCGACTCCATGCTTGTGCGAAAATAGTAATCTCT GTGCTTTTGGTAACACTTGTGATCTGGGCCCACCAAAGAAATGCATCATAAAAGTATCACCACCTCCCACCTCGGA GAAAGAGAAAAATAACAACAAAGGAAGTAAATCTGATTACGATTATATACAGCCACC(SEQ ID NO.3)。

5.5 ' RACE experiment

(1) design and sequence of primer

Using above-mentioned sequence results, using 5.0 software design of Primer Premier, three specificity, 5 ' RACE primer, It is synthesized by Sangon Biotech (Shanghai) Co., Ltd..The primer of synthesis is as shown in table 4.

Table 4:5 ' RACE Primer and sequence

(2) synthesis of the first chain of target gene cDNA

The conjunction of the first chain of target gene cDNA is carried out to total serum IgE using SUPERSCRIPT II RT enzyme and primer GSP-1 At carrying out RNA using cDNA of the RNase Mix to synthesis and handle.Specifically comprise the following steps:

S1: it is added by following system:

Then S2:70 DEG C of incubation said mixture 10min cools down 1min on ice；Brief centrifugation is added by following system Enter:

Adjusting final volume with sterile water is 24 μ L；

S3: tenderness mixing and centrifugation, 42 DEG C of incubation 1min；

S4: 1 μ L of SUPERSCRIPT II RT, 42 DEG C of incubation 50min of addition；

S5:70 DEG C of incubation 15min；

S6: brief centrifugation is simultaneously reacted at 37 DEG C；

S7: 1 μ L of RNase mix of addition is briefly blended in 37 DEG C of reaction 30min, brief centrifugation is placed on ice, complete At the synthesis of the first chain cDNA.

(3) it is purified to through the processed cDNA of RNAase, purifying includes the following steps:

S1: in the system after the adhesive solution (6M sodium iodide) of 120 μ L of addition to the first chain cDNA synthesis, and by mixed liquor (gene/IodineSodium Solution) is transferred to GLASSMAX rotation cylinder, and centrifuge 13000g is centrifuged 20s；Then the solution after centrifugation is turned It moves in centrifuge tube, solution is saved, until being confirmed for cDNA；

S2: for addition 0.4mL cold (4 DEG C) 1X washing buffer into rotation cylinder, 13000g is centrifuged 20s, and discarding penetrates liquid；Weight This multiple washing step is three times；

S3: being added the ethyl alcohol of cold (4 DEG C) 70% of 400 μ L in by S2 treated rotation cylinder, clear by the method in S2 It washes twice；Then it removes ethyl alcohol and is centrifuged 1min under the conditions of 13000g；

S4: rotation cylinder being inserted into a new sample recovery tube, 50 μ L sterile distilled waters (being preheated to 65 DEG C) are added, from Heart 13000g is centrifuged 20s, to elute cDNA.

(4) poly C is added using the end cDNA of TdT enzyme and dCTP after purification, specifically includes the following steps:

S1: it is added by following system:

S2:94 DEG C of 2~3min of incubation, then cooled on ice 1min；

S3: 1 μ L TdT, 37 DEG C of incubation 10min is added；

S4:65 DEG C of heating 10min, inactivates TdT, and brief centrifugation is placed on ice.

(5) the cDNA progress PCR first round amplification to dC tail is added

S1: thermal cycler is arranged 94 DEG C；Then it is added into the thin-wall PCR tube of 0.2or 0.5ml as follows System is placed on ice:

PCR reaction is carried out, program is as shown in table 5:

Table 5:PCR reaction condition

(6) the cDNA progress wheel amplification of PCR second to dC tail is added

Second wheel PCR amplification system is as follows:

(7) recovery purifying of target fragment

Second wheel PCR product is subjected to electrophoresis and gel extraction purifying is carried out to purpose band, step presses QIAquick Gel Extraction Kit Specification carries out, shown in electrophoresis detection result figure 2.

(8) clone of target fragment and sequencing

PCR product after purification is sequenced, or is attached with pMD18T, and positive colony is sequenced after conversion, knot Fruit is as follows:

CCTGGCCACGCGTCGACTAGTACGGGGGGGGGGGTGGCGGGG (joint sequence) TGTTCTTTATTCGCGA GTGAGTCTTAGCGGGGGGCCGGTGCGCTGTCCGAGGCGGGCTGCTTGCGCGGCGGGTTGGGGGGGAGCCTTTCAGG ATCTTCAATCGGATCTGAAAAAATCTCAACGATGTTCTCTCTGAAATTGTTCGTCGTTCTGTTGGCA(SEQ ID NO.7)。

6.3 ' RACE experiment

(1) design and sequence of primer

Using transcript profile sequence verification as a result, using 5.0 software design of Primer Premier, two 3 ' RACE of specificity Primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd..Primer is as shown in table 6.

Table 6:3 ' RACE Primer and sequence

(2) experimental method and result

S1: reverse transcriptase SMARTScribe is used^TM3 ' CDS primer A of Reverse Transcriptase and primer Reverse transcription is carried out to total serum IgE and synthesizes cDNA；

S2: using primer C-1 and UPM, carries out first round PCR amplification as template using the cDNA synthesized above.

Pcr amplification reaction system is as follows:

Pcr amplification reaction condition is as shown in table 7:

Table 7:PCR response procedures

S3: diluting 50 times for first round pcr amplification product, then carries out the second wheel PCR amplification with primer C-2 and UPM.Instead Answer condition and the program same first round.

S4: the second wheel PCR product is subjected to electrophoresis and gel extraction purifying, electrophoresis result Fig. 3 institute are carried out to purpose band Show.

S5: PCR product after purification is attached with pMD18T, is sent after conversion to the raw work sequencing in Shanghai, as a result as follows:

GGGCCCACCAAAGAAATGCATCATAAAAGTATCACCACCTCCCACCTCGGAGAAAGAGAAAAATAACA ACAAAGGAAGTAAATCTGATTACGATTATTATTAAACAAACCCAGAATAAGCACCAATTGCAGATAAATTGGTTTT AAAACGTTTCCACGGTTGTGATCAATAAACGACGTTTTCCAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA(SEQ ID NO.10)。

7. full length gene sequence

According to core sequence and 5 ' RACE and 3 ' RACE as a result, being spliced into the full length cDNA sequence of experiment purpose gene, Then starting and the terminator codon position that analysis predicts gene are compared by NCBI, is marked with overstriking font.As a result as follows:

Embodiment two: construction of expression vector

1. experimental material

(1) Hirudo japonica hirudin gene Hirudin mRNA full length sequence；

(2) Yeast expression carrier pPIC9K.

2. gene cloning

Design of primers and sequence: it is designed according to the map (Figure 14) of whole carrier pPIC9K using EcoRI-NotI as insertion point Primer simultaneously synthesizes the primer, and increases 6*His label on primer, while carrying out PCR amplification.Designed primer such as 8 institute of table Show.

Table 8: Primer and sequence

PCR reaction system and condition difference are as shown in Table 9 and Table 10:

Table 9:PCR reaction system

Table 10:PCR reaction condition

The recovery purifying of target fragment:

PCR product carries out electrophoresis in 1.0% Ago-Gel, adjusts voltage to 120V, electrophoresis 0.5h, film recording electricity Swimming cuts rapidly purpose band as a result, observe in the UV lamp.Target fragment is recycled with plastic recovery kit (OMEGA), specifically Method is carried out by kit specification.The agarose gel electrophoresis results of the recovered purifying of target fragment are as shown in figure 4, wherein S For purpose segment band, M is Marker DL2000 band.

3. the building of fusion expression vector

(1) digestion of target fragment and carrier, digestion system used are as shown in table 11.

Table 11: the digestion system of target fragment and carrier

(2) connection of target fragment and carrier:

Body will be carried out with the carrier pPIC9K of EcoRI-NotI digestion with same with the target gene of EcoRI-NotI digestion Outer connection, linked system are as shown in table 12.

Table 12: the linked system of target fragment and carrier

Mixing is played in suction, and after being slightly centrifuged plus a drop mineral oil is put into 4 DEG C of refrigerators after having connected and protects in 16 DEG C of connection 2h It deposits overnight.

(3) conversion of connection product:

S1: superclean bench sterilizing 30min takes out the DH5 α competent cell of 100 μ L from -80 DEG C of ultra low temperature freezers, It is put on ice, 10min is pre-chilled；

S2: taking out an Ep pipe, put signs on, and is placed in the connection production of competent cell and 10 μ L that 80 μ L are added on ice Object (operates) on ice, and ice bath 30min after mixing is beaten with liquid-transfering gun suction；

S3: after ice bath, it is placed on heat shock 90s in 42 DEG C of thermostat water bath, is then put into ice cube rapidly, ice bath 2min；

S4: LB liquid medium of the 500 μ L without Amp is inhaled into Ep pipe, mixes, is placed in 160rpm in shaking table, 37 DEG C are shaken 1h；

S5: taking out the Ep pipe that shaking table terminates, and 2000~3000rmp is centrifuged 5min, abandons 300 μ L of supernatant, and remaining bacterium solution is light Soft suction is added in the LB solid culture ware containing Kan after playing mixing, is applied stick with glass and is smoothened, Tu Gan；

16~20h is cultivated in S6:37 DEG C of constant incubator.

(4) identification of fusion expression vector:

It will be converted to the single colonie come and carry out bacterium solution with the universal primer (α Factor/3 ' AOX) of empty carrier after bacterium by shaking PCR identification, for bacterium solution PCR amplification electrophoresis as shown in figure 5, wherein swimming lane 1~6 is purpose segment band, M is Marker DL2000 Band.PCR identification system and reaction condition are respectively as shown in table 13 and table 14.

Table 13: single colonie detects PCR system

Table 14: single colonie detects PCR reaction condition

Sequencing and plasmid extraction and digestion verification, digestion verification result will be carried out by the positive bacterium solution of bacterium solution PCR identification As shown in fig. 6,1 being the band after digestion recombinant plasmid in figure, 2 be the band before digestion recombinant plasmid, M1 Marker DL2000 band, M2 are Marker DL10000 band；Bacterium solution sequencing result is as follows:

4. protein expression assay

1. experimental material: yeast strain GS115；PPIC9K plasmid (pPIC9K-Hirudin) containing target gene.

2. experimental method:

(1) yeast plasmid converts

S1: plasmid enzyme restriction linearisation

Linearization process is carried out to recombinant plasmid using TaKaRa Sac I.10 are added in 1.5mL Eppendorf pipe 10 μ L of × Buffer, recombinant plasmid 10 μ L, restriction endonuclease Sac I (10U/ μ L) 3 μ L, ddH of said extracted₂O 77 μ L, 37 DEG C of placement 4h.1% agarose gel electrophoresis detects and recycles target fragment.Plasmid linearization result as shown in fig. 7, In figure 1 be pPIC9K protoplasm grain band, 2 be the band after pPIC9K Sac I digestion, and 3 be the protoplasm grain containing target gene Band, 4 be the band after the protoplasm grain Sac I digestion containing target gene.

S2: gel recycling

Gel extraction purpose product uses TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (Code No.9762) is handled, and precipitating is dissolved in 15 μ L ddH₂In O.

S3: the preparation and electrotransformation of competent yeast cells

YPD liquid and solid medium are configured first, and in the flat lining out culture Pichia yeast GS115 of YPD, 28 DEG C are incubated The single bacterium colony of picking, is inoculated in YPD fluid nutrient medium after educating 2 days, and 28 DEG C of shaking table concussions are stayed overnight, collection bacterium solution, and 4 DEG C, 1500g It is centrifuged 5min, abandons supernatant, 120mL ice water is added, precipitating is resuspended, 0 DEG C, 1500g is centrifuged 5min, repetitive operation.

Sample blending after the GS115 competent cell of 100 μ L and 10 μ L are stood, clicks conversion, and conversion fluid is coated with MD Plate, 30 DEG C are cultivated 3 days.

(2) yeast-positive transformant screening

S1:PCR screens positive transformant:

The single colonie on conversion plate is dipped with sterilizing toothpick, uses Lysis Buffer for Microorganism To Direct PCR, 80 DEG C of denaturation 15min are carried out PCR amplification and are examined bacterium as template using TaKaRa LA Taq.

PCR amplification system: 4 μ L, 10XLA PCR Buffer II (Mg of dNTP Mixture (2.5mM)²⁺Plus) 2.5 μ L, 3 ' AOX I primer (20pm), 0.25 0.25 μ L, pPIC9K/ recombinant clone bacterium solution of μ L, 5 ' AOX I primer (20pm) Each 0.25 μ L of template supplements ddH₂O to 25 μ L of final volume.

PCR reaction condition: 94 DEG C of initial denaturation 1min；98 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 1.5min carry out 30 circulations；72 It is DEG C final to extend 7min.10 μ L are taken to carry out 1% agarose gel electrophoresis detection.Testing result is as shown in Figure 8 and Figure 9, and Fig. 8 is matter Grain pPIC9K PCR screens (empty control plasmid) agarose gel electrophoresis results figure (M:DL2000 DNA Marker；1-16: matter Grain pPIC9K PCR the selection result), Fig. 9 is that positive transformant PCR screens agarose gel electrophoresis results (M:DL2000 Marker；1-16: positive transformant PCR the selection result).

The sequencing of S2:PCR product:

Choosing positive transformant PCR product, (8) Fig. 9, swimming lane 7 and is recycled, and carry out sequence verification.Use AOX5P It is sequenced with AOX3P primer.The sequencing result of PCR product proves that target gene has been integrated into yeast chromosomal.

(3) culture and inducing expression

S1: Spawn incubation:

Picking MD plate 1,2 thallus of positive clone, which are seeded in 50mL BMGY culture medium, is incubated overnight about 18h to OD value Thalline were collected by centrifugation when being 2~4.

Take 120OD centrifugation thallus be added 80mL BMGY culture medium in thallus is resuspended, make it is suspended after bacterium solution OD600 1.5；Every adding 100% methanol into culture solution for 24 hours, make methanol final concentration of 0.5%.Respectively collect 24 hours, 48 hours, 72 hours thallus 2OD and extracellular fluids.

S2: the extraction of yeast holoprotein:

The PBS of 200 μ L is added into 2OD thallus sample respectively, 4 DEG C, 12000g carefully removes supernatant after being centrifuged 2min, adds Enter 2000 μ L Yeast Protein Extraction Reagent (TaKaRa) mixing.It is put into 30min in 30 DEG C of water-baths, phase Between gently shake 2 times, centrifuge tube is taken out from 30 DEG C of water-baths, 4 DEG C, 12000rpm be centrifuged 5min.After careful removal supernatant, then 50 μ L PBS soluble proteins are added.1.5 μ L protein samples are taken to carry out total protein concentration measurement using NanoDrop 2000c respectively, Take the total protein of 100 μ g or so and 4 × SDS PAGE Loading mixing of 1/4 volume respectively according to the measured value of total protein. 95 DEG C of heating 10min carry out SDS-PAGE electrophoresis.

(4) concentration of extracellular fluid

Take the bacterium solution 10mL of above-mentioned positive colony 1,2 thallus cultures for 24 hours, after 48h and 72h respectively, 4 DEG C, 8000rpm centrifugation 10min collects supernatant.Supernatant is used respectively Sartorius VLVASPIN20 10,000MWCO pipe progress is concentrated by ultrafiltration dense Contracting, and carry out 1000 times of Buffer using PBS and replace, the culture solution of 10mL is concentrated into about 100 μ L PBS Buffer.

(5) extract electrophoresis

8 μ L of each extract (holoprotein, supernatant, precipitating) is taken, 2 μ L 4 × SDS Loading Buffer are added, 95 DEG C add Hot 10min carries out SDS-PAGE electrophoresis.

Deposition condition: 25mA/ pieces, about 70 points.Using gel:15%polyacrylamide gel, (polyacrylamide is solidifying Glue), after electrophoresis, Coomassie brilliant blue CBB-R250 dyeing uses destainer (16% methanol, 7% glacial acetic acid) to decolourize.

Electrophoresis result is as shown in Figure 10 and Figure 11.In Figure 10,1 is the holoprotein after pPIC9K induction for 24 hours, and 2 be pPIC9K Holoprotein after inducing 48h, 3 induce the holoprotein after 72h for pPIC9K, and 4 be the shell egg after the induction for 24 hours of positive transformant -7 It is white, 5 for positive transformant -7 induce for 24 hours after extracellular concentrate, 6 for positive transformant -7 induce 48h after holoprotein, 7 Extracellular concentrate after inducing 48h for positive transformant -7,8 induce the holoprotein after 72h for positive transformant -7, and 9 be sun Property transformant -7 induce 72h after extracellular concentrate, M be Protein MW marker (Broad)；In Figure 11,1 is Holoprotein after pPIC9K induction for 24 hours, 2 induce the holoprotein after 48h for pPIC9K, and 3 induce the shell egg after 72h for pPIC9K It is white, 4 for positive transformant -8 induce for 24 hours after holoprotein, 5 for positive transformant -8 induce for 24 hours after extracellular concentrate, 6 Holoprotein after inducing 48h for positive transformant -8,7 induce the extracellular concentrate after 48h for positive transformant -8, and 8 be sun Property transformant -8 induce 72h after holoprotein, 9 for positive transformant -8 induce 72h after extracellular concentrate, M Protein MW marker(Broad)。

(6) Western Blotting sample electrophoresis compares

2 μ 4 × SDS of L Loading are added in each 8 μ L (0.05OD is suitable) of extract (holoprotein, supernatant, precipitating) Buffer, 99 DEG C of heating 10min carry out SDS-PAGE electrophoresis using color M arker and histidine tag Marker.Electrophoresis strip Part: 25mA/ pieces, about 70 minutes；Use gel:15%polyacrylamide gel.Western Blotting sample electrophoresis pair As shown in figure 12 according to result, in figure, 1 is the holoprotein after pPIC9K induction for 24 hours, and 2 be complete after the induction for 24 hours of positive transformant -7 Albumen, 3 be the extracellular concentrate after the induction for 24 hours of positive transformant -7, and 4 induce the holoprotein after 72h for positive transformant -7, 5 induce the extracellular concentrate after 72h for positive transformant -7, and 6 be the holoprotein after the induction for 24 hours of positive transformant -8, and 7 be sun Property the induction for 24 hours of transformant -8 after extracellular concentrate, 8 induce the holoprotein after 72h for positive transformant -8, and 9 turn to be positive Beggar -8 induces the extracellular concentrate after 72h, and 10 induce the extracellular concentrate after 48h for positive transformant -7, and M1 is Precision Plus Protein Standards, M2 are Perfect protein marker.

(7)Western Blotting

By pvdf membrane, filter paper cut into respectively with gel same size, using transferring film buffer handle after, by filter paper, Pvdf membrane, gel, filter paper sequence be successively placed between transferring film instrument electrode plate, start transferring film, be arranged transferring film instrument parameter are as follows: electric current 54mA, transfer time 80min.

Pvdf membrane is placed in the 12ml Blocking buffer containing 1.5% bovine serum albumin(BSA) (BSA), 4 DEG C lay flat Closing overnight.Using the Penta-His Antibody solution 9mL after dilution, an antibody response 1h is carried out.TBST buffer (20mL) is washed 2 times；TBS buffer is washed to rinse 3 times.Use the HRP-Rabbit Anti-Mouse IgG antibody after dilution Solution 9mL carries out secondary antibodies and reacts 1h.TBST buffer (20mL) washs 2 times；TBS buffer is washed to rinse 3 times. Western Blotting result is as shown in figure 13, and in figure, A is 1ml TrueBlue Peroxidase Substrate colour developing 1min；B is 10ml WesternBrightTM ECL colour developing 5min；1 is the holoprotein that 1 is after pPIC9K induction for 24 hours, and 2 be positive Property the induction for 24 hours of transformant -7 after holoprotein, 3 induced for 24 hours for positive transformant -7 after extracellular concentrate, 4 turn to be positive Beggar -7 induces the holoprotein after 72h, and 5 induce the extracellular concentrate after 72h for positive transformant -7, and 6 be positive transformant - Holoprotein after 8 inductions for 24 hours, 7 induce for the extracellular concentrate after the induction for 24 hours of positive transformant -8,8 for positive transformant -8 Holoprotein after 72h, 9 induce the extracellular concentrate after 72h for positive transformant -8, and 10 induce 48h for positive transformant -7 Extracellular concentrate afterwards, M1 are Precision Plus Protein Standards, and M2 is Perfect protein marker。

Although be described in detail with attached drawing to a specific embodiment of the invention in conjunction with the embodiments, should not be understood For the restriction of the protection scope to this patent.In range described by claims, those skilled in the art are without creation Property the various modifications that can make of labour and deformation still belong to the protection scope of this patent.

Sequence table

<110>Chongqing Institute of Chinese Medicine

<120>a kind of hirudin coding gene and the host system comprising the gene

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

gatctgaaaa aatctcaacg 20

<210> 2

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

ttaataataa tcgtaatcag 20

<210> 3

<211> 277

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

gatctgaaaa aatctcaacg atgttctctc tgaaattgtt cgtcgttctg ttggcagttt 60

gcatctgcac gtctcaagct cagcatttca aagattgctc agacagcaat ccgactccat 120

gcttgtgcga aaatagtaat ctctgtgctt ttggtaacac ttgtgatctg ggcccaccaa 180

agaaatgcat cataaaagta tcaccacctc ccacctcgga gaaagagaaa aataacaaca 240

aaggaagtaa atctgattac gattatatac agccacc 277

<210> 4

<211> 16

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

tcggattgct gtctga 16

<210> 5

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

atgctgagct tgagacgt 18

<210> 6

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

tgccaacaga acgacgaa 18

<210> 7

<211> 201

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

cctggccacg cgtcgactag tacggggggg ggggtggcgg ggtgttcttt attcgcgagt 60

gagtcttagc ggggggccgg tgcgctgtcc gaggcgggct gcttgcgcgg cgggttgggg 120

gggagccttt caggatcttc aatcggatct gaaaaaatct caacgatgtt ctctctgaaa 180

ttgttcgtcg ttctgttggc a 201

<210> 8

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

tttgcatctg cacgtctcaa gctca 25

<210> 9

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

gggcccacca aagaaatgca tca 23

<210> 10

<211> 217

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

gggcccacca aagaaatgca tcataaaagt atcaccacct cccacctcgg agaaagagaa 60

aaataacaac aaaggaagta aatctgatta cgattattat taaacaaacc cagaataagc 120

accaattgca gataaattgg ttttaaaacg tttccacggt tgtgatcaat aaacgacgtt 180

ttccagcaaa aaaaaaaaaa aaaaaaaaaa aaaaaaa 217

<210> 11

<211> 489

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

tgttctttat tcgcgagtga gtcttagcgg ggggccggtg cgctgtccga ggcgggctgc 60

ttgcgcggcg ggttgggggg gagcctttca ggatcttcaa tcggatctga aaaaatctca 120

acgatgttct ctctgaaatt gttcgtcgtt ctgttggcag tttgcatctg cacgtctcaa 180

gctcagcatt tcaaagattg ctcagacagc aatccgactc catgcttgtg cgaaaatagt 240

aatctctgtg cttttggtaa cacttgtgat ctgggcccac caaagaaatg catcataaaa 300

gtatcaccac ctcccacctc ggagaaagag aaaaataaca acaaaggaag taaatctgat 360

tacgattatt attaaacaaa cccagaataa gcaccaattg cagataaatt ggttttaaaa 420

cgtttccacg gttgtgatca ataaacgacg ttttccagca aaaaaaaaaa aaaaaaaaaa 480

aaaaaaaaa 489

<210> 12

<211> 27

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

ccggaattca tgttctctct gaaattg 27

<210> 13

<211> 47

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 13

tttgcggccg cttagtggtg gtggtggtgg tgataataat cgtaatc 47

<210> 14

<211> 404

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 14

ataaatacta ctattgccag cattgctgct aaagaagaag gggtatctct cgagaaaaga 60

gaggctgaag cttacgtaga attcatgttc tctctgaaat tgttcgtcgt tctgttggca 120

gtttgcatct gcacgtctca agctcagcat ttcaaagatt gctcagacag caatccgact 180

ccatgcttgt gcgaaaatag taatctctgt gcttttggta acacttgtga tctgggccca 240

ccaaagaaat gcatcataaa agtatcacca cctcccacct cggagaaaga gaaaaataac 300

aacaaaggaa gtaaatctga ttacgattat tatcaccacc accaccacca ctaagcggcc 360

gcgaattaat tcgccttaga catgactgtt cctcagttca agtt 404

Claims

1. a kind of hirudin coding gene, it is characterised in that: the nucleotide sequence of the encoding gene such as SEQ ID NO.11 institute Show.

2. the acquisition methods of hirudin coding gene as described in claim 1, which comprises the following steps:

S1: Hirudo japonica, its salivary organization of picking are taken；

S2: the RNA in salivary organization is extracted；

S3: carrying out the synthesis of the first chain of cDNA according to the RNA of extraction, and carries out PCR amplification accordingly and obtain core sequence, core sequence As shown in SEQ ID NO.3；

S4: 5 ' RACE and 3 ' RACE are carried out to cDNA, and are sequenced respectively, sequencing result such as SEQ ID NO.7 and SEQ ID Shown in NO.10；

S5: by gained sequence assembly in core sequence and S4, hirudin coding gene is obtained.

3. the acquisition methods of hirudin coding gene according to claim 2, which is characterized in that the first chain of cDNA in S3 Synthesis includes the following steps:

(3) mixed liquor after centrifugation is placed in PCR instrument, 42 DEG C of incubation 1h；Then it assigns 5min at 70 DEG C, completes cDNA the The synthesis of one chain.

4. the acquisition methods of hirudin coding gene according to claim 2, which is characterized in that PCR amplification system in S3 Are as follows:

5. the recombinant plasmid containing encoding gene described in claim 1.

6. recombinant plasmid according to claim 5, it is characterised in that: the expression vector of the recombinant plasmid is Pichia pastoris pPIC9K。

7. a kind of host system, it is characterised in that: host system recombinant plasmid transformed eukaryon place as described in claim 5 Chief cell obtains.

8. host system according to claim 7, it is characterised in that: the eucaryon host is Pichia pastoris GS115.

9. host system as claimed in claim 7 is preparing the application in hirudin.