CN110468236A - Using the method for RT-qPCR technology detection calicivirus - Google Patents
Using the method for RT-qPCR technology detection calicivirus Download PDFInfo
- Publication number
- CN110468236A CN110468236A CN201910801455.6A CN201910801455A CN110468236A CN 110468236 A CN110468236 A CN 110468236A CN 201910801455 A CN201910801455 A CN 201910801455A CN 110468236 A CN110468236 A CN 110468236A
- Authority
- CN
- China
- Prior art keywords
- sample
- qpcr
- probe
- calicivirus
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a kind of method using RT-qPCR technology detection calicivirus, comprising steps of 1) extracting sample to be tested total serum IgE；2) reaction system, including one-step method premixed liquid, upstream and downstream primer, probe are prepared；3) gradient dilution standard curve sample；4) negative control of reagent, the negative control of sample to be tested and the sample to be tested loading that joined standard items；5) RT-qPCR reacts；6) interpretation of result.RT-qPCR method provided by the invention detects related cell in the process suitable for biological production or whether stoste is infected by Calicivirus, and this method is simple and efficient, result is stablized, reproducible.Method of the invention can shorten detection time, and have the advantages that operation is relatively easy, detection specificity is reproducible, be suitable for complicated testing requirements during biological production.
Description
Technical field
The present invention relates to field of biological technology detection, use Quantitative RT-PCR (RT- more particularly, to a kind of
QPCR) technology carries out the detection of calicivirus (Calicivirus) to biological products.
Background technique
With the rapid development of biological medicine technology, people increasingly pay attention to the safety of the biological products such as vaccine, reinforce
Its quality is controlled.The quality control of biological products is not only to control the quality of finished product, or produce to entire
The quality of process controls.Therefore, world community regulatory authority require manufacturing enterprise before clinical test goes through and biological medicament and
Before the release of vaccine finished product, the links of production procedure must all prove the consistent of product by complicated safety test
Property, stability and purity.
Calicivirus (Calicivirus) is the small round structured virus that diameter is about 26~35nm, no coating, containing virus
VPg albumen and RNA, genome are single-stranded positive RNA.Known Calicivirus cannot be cultivated in cell or tissue, can be through
Fecal oral route is propagated, and is the important pathogen for causing acute aseptic gastroenteritis.Therefore it provides a kind of suitable detection
The method of Calicivirus becomes very to possess the exclusion mechanism of an efficient cellular matrix, either stock virus infection
It is necessary.
Presently, there are detection Calicivirus method have electron microscopy, enzyme-linked immunization and biotin-avidin immune
Method, but all there is the disadvantages of equipment is expensive, complicated for operation, detection time is long, specific too strong in these methods.
Summary of the invention
Technical problem to be solved by the present invention lies in provide a kind of method for detecting calicivirus, have detection time
Short, easy to operate, detection specificity height, reproducible advantage.
In order to solve the above technical problems, the technical solution adopted by the present invention are as follows:
A method of calicivirus is detected using RT-qPCR technology, comprising steps of
1) sample to be tested total serum IgE is extracted, and the concentration of RNA template is adjusted to 0.1 μ g/ μ L；
2) reaction system, including one-step method premixed liquid, primer and probe are prepared；
The one-step method premixed liquid is Taqman Fast Virus 1-Step Master Mix；
Upstream and downstream primer are as follows: forward primer FP, nucleotide sequence are as follows: GGGACTCAATCCAGTTTCGT (such as SEQ ID
Shown in NO:1) and reverse primer RP, nucleotide sequence are as follows: TTCATGATCAAGGCCAGTGT (as shown in SEQ ID NO:2)；
The probe is Probe:CTCATTTGCCTGGCGGACCA (as shown in SEQ ID NO:3)；
3) gradient dilution standard curve sample；
4) negative control of reagent, the negative control of sample to be tested and the sample to be tested loading that joined standard items；
5) RT-qPCR reacts；
6) interpretation of result.
Specifically, in the step 1), using QiagenThe operating procedure of Plus Mini Kit kit is taken out
Mention RNA.
Specifically, in the step 2), the final concentration of 900nM of primer.
Specifically, in the step 2), the final concentration of 200nM of probe.
Specifically, in the step 3), the concentration of each dilute sample in standard curve are as follows: 105Copie/5 μ l,
104Copie/5 μ l, 103Copie/5 μ l, 102Copie/5 μ l, 10copie/5 μ l.
Specifically, molecular biosciences rank water is as reagent negative control in the step 4), it is known that zooblast RNA
It is compareed as negative RNA.
Specifically, RT-qPCR reaction uses 7500 real-time PCR system of ABI in the step 5).
Specifically, in the step 5), RT-qPCR reaction system includes:
Taqman Fast Virus 1-Step Master Mix, 6.25 μ L；
Forward primer FP (as shown in SEQ ID NO:1), 0.225 μ L；
Reverse primer RP (as shown in SEQ ID NO:2), 0.225 μ L；
Probe (as shown in SEQ ID NO:3), 0.05 μ L；
Water, 8.25 μ L；
Template, 10 μ L；
Total volume, 25 μ L.
Specifically, RT-qPCR reaction condition is 48 DEG C, 30 minutes in the step 5)；95 DEG C, 10 minutes；95 DEG C, 15
Second, 60 DEG C, 1 minute, 40 circulations.
Specifically, in " analysis setting " frame of SDS software, selecting " automatic Ct " and " automatic base in the step 6)
Line " is clicked " analysis ", generates standard curve, and obtain the linear R of test2Value, calculates the standard curve of PCR reaction efficiency
Slope；By the linear regression analysis to standard curve, calculates and be higher than background, positive signal RNA copy number.
The present invention uses RT-polymerase chain reaction (Reverse Transcriptase Quantitative
Polymerase Chain Reaction, RT-qPCR), RT-PCR is logical with external standard method (fluorogenic hybridization probe guarantees specificity)
It crosses monitoring PCR process (monitoring amplification efficiency) and achievees the purpose that accurate quantification initial profiling number, while effectively being arranged with control design
Except false negative result (amplification efficiency zero).Calicivirus method (electron microscopy, enzyme-linked immunization and life are detected with others
Object element-Avidin immunization) compare, detection time not only can be shortened using RT-qPCR method, but also have operation relatively simple
The advantages that single, detection specificity is reproducible is suitable for complicated testing requirements during biological production.
When detecting related cell or whether stoste is polluted by exogenous Calicivirus, due to not training suitably
Cell system is supported, cultivation is infeasible；Usual exogenous Calicivirus virus titer is very low, and common molecular hybridization technique is difficult
To detect Calicivirus RNA；In addition, the Electronic Speculum observational technique of Calicivirus virus depends on specific equipment and warp
Technical staff abundant is tested, the interpretation of experimental result is easy to produce deviation.RT-qPCR method provided by the invention is simple and efficient,
As a result stable, it is reproducible, suitable for whether detecting related cell or stoste during biological production by Calicivirus dirt
Dye/infection.
Calicivirus detects using Quantitative RT-PCR (RT-qPCR) technology of TaqMan probe in our company
It (Calicivirus) is the perfect detection architecture of a maturation.The advantages of RT-qPCR method of the application, also resides in:
1.Taqman is better than the specificity of SYBR Green, has specific probe, fruiting characteristic is strong；2. one-step method RT-qPCR is used,
RNA reverse transcription and PCR reaction are completed in same pipe under full closeding state, avoid pollution to environment and thus caused
False positive.
Specific embodiment
Clear, complete description will be carried out to technical solution of the present invention below, it is clear that described embodiment is this hair
Bright a part of the embodiment, instead of all the embodiments.Based on the embodiments of the present invention, those of ordinary skill in the art exist
Every other embodiment obtained under the premise of creative work is not made, shall fall within the protection scope of the present invention.
The present invention can be used for each of biological production process using RT-qPCR technology detection calicivirus (Calicivirus)
The test in a stage, supplementary material, stoste and clinical testing product batch including animal origin.Especially include in raw material test
Master cell bank (Master cell bank, MCB), final production cell (End of Production, EPC) etc..
Embodiment 1
The present embodiment specifically includes following step using the method for RT-qPCR technology detection calicivirus (Calicivirus)
It is rapid:
1. extracting sample to be tested total serum IgE
Biological products produce calibrating zooblast, cell total amount 1x107, using QiagenPlus Mini
The operating procedure extract RNA of Kit kit, and the concentration of RNA template is adjusted to 0.1 μ g/ μ L.
2. preparing reaction system, including one-step method premixed liquid, upstream and downstream primer, probe；
RT-PCR reaction system is 25 microlitres, the final concentration of 900nM of primer, the final concentration of 200nM of probe；
3. gradient dilution standard curve sample；
The preparation of each dilute sample is as follows in standard curve
4. the negative control of the negative control of reagent, sample to be tested and the sample to be tested loading that joined standard items；
Molecular biosciences rank water is as reagent negative control, it is known that zooblast RNA as feminine gender RNA control.
In 96 orifice plates containing 15 μ l reaction solutions, molecular biosciences rank water is added in corresponding " negative control " hole.It is last to ensure
Volume it is consistent, can be supplied with molecular biosciences rank water, until the reaction system final volume in all holes be 25 μ l.
5.RT-qPCR reaction (uses 7500 real-time PCR system of ABI)；
Sample-adding plate is placed on tray rack by booting.
Be arranged program parameter, thermal cycle conditions are set as: RT-PCR reaction condition are as follows: 48 DEG C 30 minutes；95 DEG C 10 minutes；
95 DEG C 15 seconds, 60 DEG C 1 minute, 40 circulation.
Click starts, and runs program.
6. interpretation of result
In " analysis setting " frame of SDS software, selects " automatic Ct " and " automatic baseline ", click " analysis ".Pass through mark
Quasi- strain column, software can generate standard curve, and obtain the linear R of test2Value；Also the standard of PCR reaction efficiency can be calculated
The slope of curve.By the linear regression analysis to standard curve, software, which will calculate, is higher than background, positive signal RNA copy
Number.Report appropriate is selected to be arranged, and printed report.
Our company is used for the RT-qPCR technology of Calicivirus detection, using the real-time of highly sensitive stable detection RNA
Quantitative RT-PCR detecting kit, the reagent constituents are seldom, and all reactions combine in a pipe, and it is wrong utmostly to reduce sample process
Accidentally, shorten the setting time, it can sensitive steadily cloning RNA target spot；The reference fluorescent ROX contained in kit buffer, in conjunction with
Specificity T aqMan probe realizes the standardization of quantitative fluorescence signal, reaction can quickly and easily be arranged, examined in 2 hours
Survey result.These technical characterstics save the time, improve the operational paradigm in laboratory；Method high sensitivity simultaneously, economy, property
Valence is than high.
In conclusion the various embodiments described above are only presently preferred embodiments of the present invention, it is not of the invention to limit
Protection scope, all within the spirits and principles of the present invention, any modification, equivalent substitution, improvement and etc. done should be all included in
In protection scope of the present invention.
Sequence table
<110>Co., Ltd is examined in the bright detection of Suzhou medicine
<120>using the method for RT-qPCR technology detection calicivirus
<130> CPC-NP-18-101286
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>primer
<400> 1
gggactcaat ccagtttcgt 20
<210> 2
<211> 20
<212> DNA
<213>primer
<400> 2
ttcatgatca aggccagtgt 20
<210> 3
<211> 20
<212> DNA
<213>probe
<400> 3
ctcatttgcc tggcggacca 20
Claims (10)
1. a kind of method using RT-qPCR technology detection calicivirus, which is characterized in that comprising steps of
1) sample to be tested total serum IgE is extracted, and the concentration of RNA template is adjusted to 0.1 μ g/ μ L；
2) reaction system, including one-step method premixed liquid, primer and probe are prepared；
The one-step method premixed liquid is Taqman Fast Virus 1-Step Master Mix；
Upstream and downstream primer are as follows: forward primer FP, nucleotide sequence are as follows: GGGACTCAATCCAGTTTCGT and reverse primer RP, core
Nucleotide sequence are as follows: TTCATGATCAAGGCCAGTGT；
The probe is Probe:CTCATTTGCCTGGCGGACCA；
3) gradient dilution standard curve sample；
4) negative control of reagent, the negative control of sample to be tested and the sample to be tested loading that joined standard items；
5) RT-qPCR reacts；
6) interpretation of result.
2. the method as described in claim 1, which is characterized in that in the step 1), using QiagenPlus
The operating procedure extract RNA of Mini Kit kit.
3. the method as described in claim 1, which is characterized in that in the step 2), the final concentration of 900nM of primer.
4. the method as described in claim 1, which is characterized in that in the step 2), the final concentration of 200nM of probe.
5. the method as described in claim 1, which is characterized in that in the step 3), each dilute sample in standard curve
Concentration are as follows: 105Copie/5 μ l, 104Copie/5 μ l, 103Copie/5 μ l, 102Copie/5 μ l, 10copie/5 μ l.
6. the method as described in claim 1, which is characterized in that in the step 4), molecular biosciences rank water is as reagent yin
Property control, it is known that zooblast RNA as feminine gender RNA control.
7. the method as described in claim 1, which is characterized in that in the step 5), RT-qPCR reaction is real using ABI 7500
When PCR system.
8. the method as described in claim 1, which is characterized in that in the step 5), RT-qPCR reaction system includes:
Taqman Fast Virus 1-Step Master Mix, 6.25 μ L；
Forward primer FP, 0.225 μ L；
Reverse primer RP, 0.225 μ L；
Probe, 0.05 μ L；
Water, 8.25 μ L；
Template, 10 μ L；
Total volume, 25 μ L.
9. the method as described in claim 1, which is characterized in that in the step 5), RT-qPCR reaction condition be 48 DEG C, 30
Minute；95 DEG C, 10 minutes；95 DEG C, 15 seconds, 60 DEG C, 1 minute, 40 circulations.
10. the method as described in claim 1, which is characterized in that in the step 6), in " analysis setting " frame of SDS software
In, it selects " automatic Ct " and " automatic baseline ", clicks " analysis ", generate standard curve, and obtain the linear R of test2Value calculates
The slope of standard curve of PCR reaction efficiency out；By the linear regression analysis to standard curve, calculate higher than background, positive
The RNA copy number of signal.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910801455.6A CN110468236A (en) | 2019-08-28 | 2019-08-28 | Using the method for RT-qPCR technology detection calicivirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910801455.6A CN110468236A (en) | 2019-08-28 | 2019-08-28 | Using the method for RT-qPCR technology detection calicivirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110468236A true CN110468236A (en) | 2019-11-19 |
Family
ID=68512506
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910801455.6A Pending CN110468236A (en) | 2019-08-28 | 2019-08-28 | Using the method for RT-qPCR technology detection calicivirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110468236A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103031386A (en) * | 2012-12-10 | 2013-04-10 | 浙江大学 | Triple fluorescent quantitative RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) kit for detecting human calicivirus |
| US20140315750A1 (en) * | 2011-11-15 | 2014-10-23 | The United States Of America, As Represented By The Secretary, Department Of Health | Selective detection of norovirus |
| CN109207641A (en) * | 2018-11-02 | 2019-01-15 | 浙江省疾病预防控制中心 | A kind of multiple RT-PCR detection kit and application |
-
2019
- 2019-08-28 CN CN201910801455.6A patent/CN110468236A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140315750A1 (en) * | 2011-11-15 | 2014-10-23 | The United States Of America, As Represented By The Secretary, Department Of Health | Selective detection of norovirus |
| CN103031386A (en) * | 2012-12-10 | 2013-04-10 | 浙江大学 | Triple fluorescent quantitative RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) kit for detecting human calicivirus |
| CN109207641A (en) * | 2018-11-02 | 2019-01-15 | 浙江省疾病预防控制中心 | A kind of multiple RT-PCR detection kit and application |
Non-Patent Citations (1)
| Title |
|---|
| MARINA L. MELI等: "Molecular detection of feline calicivirus in clinical samples: A study comparing its detection by RT-qPCR directly from swabs and after virus isolation", 《JOURNAL OF VIROLOGICAL METHODS》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111197112B (en) | Primer, probe and kit for detecting novel coronavirus | |
| CN111206120A (en) | Primer probe group for detecting novel coronavirus SARS-CoV-2 and detection method | |
| US20240002960A1 (en) | Method and kit for multiple detection of respiratory virus nucleic acids | |
| CN110184390A (en) | For identifying the double FQ-PCR detection kit of African swine fever and wild strains of classical swine fever virus | |
| CN110453011A (en) | A kind of method and application based on CRISPR/Cas12a fast accurate detection African swine fever virus | |
| WO2010102460A1 (en) | A method and kit for quantitative and qualitative detection of genetic material of pathogenic microorganisms | |
| CN107460235A (en) | A kind of mankind's ApoE genetic polymorphism detection kits based on ARMS PCR melting curve methods | |
| CN109593890A (en) | Detect the nucleic acid compositions of diarrhea virus, the application method of kit and kit | |
| CN104894118A (en) | Primer, probe and kit for detecting bovine viral diarrhea virus | |
| CN102586473B (en) | Hepatitis B virus genotyping PCR (polymerase chain reaction) test kit | |
| CN101158634A (en) | Hepatitis B virus (HBV) fluorescent quantificationally PCR detecting kit | |
| WO2022068079A1 (en) | Method for detecting hepatitis b virus t216c mutation based on micro-droplet digital pcr technology | |
| CN111621602B (en) | Porcine circovirus type 3 rapid detection fluorescent quantitative PCR kit and application thereof | |
| CN113718021A (en) | Primer, probe and kit for quantitatively detecting BCR-ABL1 fusion gene | |
| CN114015815B (en) | Microdroplet digital PCR kit for swine atypical pestivirus and detection method thereof | |
| CN105112558B (en) | The triple real time fluorescent quantitative RT PCR detection kits of the type of foot and mouth disease virus O, A and Asia I | |
| CN108531647A (en) | A kind of zika virus one-step method fluorescence rt-PCR detection methods and kit | |
| CN112813195B (en) | Novel quantitative detection kit for coronavirus nucleic acid based on micro-droplet digital analysis | |
| CN109762932A (en) | Identify the detection primer and probe, kit and application of HP-PRRSV and NADC30-like strain | |
| CN110468236A (en) | Using the method for RT-qPCR technology detection calicivirus | |
| CN101565741A (en) | Kit for detecting DNA remains of Vero cells by real-time fluorescent quantitative polymerase chain reaction (PCR) | |
| CN113801963B (en) | Primer probe combination, kit and method for detecting coronavirus | |
| CN114507752B (en) | Kit for detecting Hancheng hantaan virus and detection method thereof | |
| CN110029171B (en) | A kind of kit using stem ring primer detection PIK3CA gene mutation site | |
| CN111500768B (en) | Primer probe for identifying novel coronavirus and application of primer probe in dual-digital PCR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191119 |
|
| RJ01 | Rejection of invention patent application after publication |