CN110455790B - Acetamiprid detection device and detection method - Google Patents
Acetamiprid detection device and detection method Download PDFInfo
- Publication number
- CN110455790B CN110455790B CN201910763789.9A CN201910763789A CN110455790B CN 110455790 B CN110455790 B CN 110455790B CN 201910763789 A CN201910763789 A CN 201910763789A CN 110455790 B CN110455790 B CN 110455790B
- Authority
- CN
- China
- Prior art keywords
- acetamiprid
- solution
- cavity
- reaction
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/17—Systems in which incident light is modified in accordance with the properties of the material investigated
- G01N21/25—Colour; Spectral properties, i.e. comparison of effect of material on the light at two or more different wavelengths or wavelength bands
- G01N21/31—Investigating relative effect of material at wavelengths characteristic of specific elements or molecules, e.g. atomic absorption spectrometry
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
- G01N21/77—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
- G01N21/78—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator producing a change of colour
Abstract
The invention discloses an acetamiprid detection device and a detection method, and belongs to the field of pesticide residue detection. The acetamiprid detection device comprises an injector, wherein the injector comprises an injection cavity, a piston and an injection port, the piston comprises a piston head and a push rod, the piston is sleeved in the injection cavity, the injection port is positioned at one end of the injection cavity, the injection port is communicated with the inside of the injection cavity, the injection cavity comprises a reaction cavity and an air cavity, the volume of the reaction cavity is the same as that of the air cavity, and the reaction cavity is arranged close to the injection port; the piston head is arranged in the air cavity, and the reaction cavity comprises a capture probe; also comprises a magnet sleeved outside the reaction cavity. The method is applied to the aspect of pesticide residue detection, solves the problems that the existing acetamiprid detection method is not realized in a device mode and is not suitable for field detection, and has the characteristics of suitability for field detection, reusability of a detection probe and low cost.
Description
Technical Field
The invention belongs to the field of pesticide residue detection, and particularly relates to an acetamiprid detection device and a detection method.
Background
Acetamiprid (N- (N-cyano-ethylimino) -N-methyl-2-chloropyridine-5-methylamine) is a novel broad-spectrum nicotine pesticide with a certain acaricidal activity. The acetamiprid has the characteristics of high efficiency, low toxicity, excellent ovicidal activity, no cross resistance with conventional pesticides and the like, and is applied to the control of pests such as aphids, plant hoppers, thrips and the like of rice, vegetables, fruits and vegetables and tea. However, in actual production, residual acetamiprid pollution is caused due to improper medication, which is harmful to human health and industrial development. Therefore, it is important to enhance the detection of acetamiprid. At present, in the aspect of acetamiprid detection, a colorimetric method using gold nanoparticles modified by a nucleic acid aptamer as a probe has the advantages of high sensitivity, quick response and high specificity of the nucleic acid aptamer of nanotechnology, visible results, no need of large-scale analytical instruments, short test period and the like, and is increasingly applied to acetamiprid detection in recent years.
Chinese patent CN 107389576 a discloses a rapid colorimetric detection method for acetamiprid based on nano-enzyme catalysis, which uses aptamer as recognition factor and employs peroxidase mimic enzyme activity of nano-gold particles to construct colorimetric detection, and the specific method is as follows: slowIn the washing liquid, the aptamer is adsorbed on the surface of the nanogold to inhibit the peroxidase activity of the aptamer in hydrogen peroxide (H)2O2) In the presence of the catalyst, the substrate 2,2' -biazonitrogen-bis-3-ethylbenzthiazoline-6-sulfonic Acid (ABTS) cannot be catalytically oxidized, and the system is red; when the acetamiprid exists in the system, the nucleic acid aptamer tends to be combined with the acetamiprid and leaves the surface of the nanogold, the peroxidase activity of the nanogold is recovered, ABTS is catalyzed, and the system is changed from red to green or grey-green. The method is simple to operate and intuitive in result.
However, in the detection of acetamiprid by the above patent, various tools such as pipettes, test tubes, and applied magnetic fields are needed, which is limited to laboratory use, and the above patent fails to effectively separate the nano-gold from the detection system after the aptamer and the target are identified, so that the color reaction occurs in the sample matrix. According to the detection strategy, the detection signal is difficult to avoid the influence of the pigment component in the sample matrix, so that the repeatability and reliability of the detection result are limited.
Disclosure of Invention
Aiming at the defects in the prior art, the main problem to be solved by the invention is to overcome the defects that the existing acetamiprid detection method is not realized in a device mode and is not suitable for field detection, and provide the acetamiprid detection device and the acetamiprid detection method which are suitable for field detection, can repeatedly use a detection probe and have low cost.
In order to solve the technical problem, the technical scheme adopted by the invention is as follows:
the invention provides an acetamiprid detection device, which comprises an injector, wherein the injector comprises an injection cavity, a piston and an injection port, the piston comprises a piston head and a push rod, the piston is sleeved in the injection cavity, the injection port is positioned at one end of the injection cavity, the injection port is communicated with the inside of the injection cavity, the injection cavity comprises a reaction cavity and an air cavity, the volume of the reaction cavity is the same as that of the air cavity, and the reaction cavity is arranged close to the injection port; the piston head is arranged in the air cavity, and the reaction cavity comprises a capture probe; the device also comprises a magnet sleeved outside the reaction cavity.
Preferably, the detection device is assembled by the following method:
formation of air space: taking the injector, and pulling the piston to a position where the piston head is positioned in the air cavity and is connected with the reaction cavity;
loading of capture probe: placing the injection port of the injector in a capture probe suspension, pulling the piston to one end of the air cavity far away from the reaction cavity to fill the capture probe suspension in the reaction cavity, and plugging the injection port by using a plug; keeping the injector in an upright state, sleeving the magnet outside the reaction cavity, pulling off the plug, slowly pushing the piston to a position where the piston head is positioned in the air cavity and is connected with the reaction cavity, and at the moment, completely discharging the solution in the reaction cavity out of the injector, completing the loading of the capture probe, and obtaining the acetamiprid detection device.
Preferably, the capture probe is a double-stranded nucleic acid-gold nanoparticle-magnetic agarose microsphere, and the capture probe comprises a whole body consisting of the double-stranded nucleic acid, the gold nanoparticle and the magnetic agarose microsphere.
Preferably, the double-stranded nucleic acid comprises an aptamer of acetamiprid and a thiolated complementary strand of the aptamer of acetamiprid.
Preferably, the double-stranded nucleic acid-gold nanoparticle-magnetic agarose microsphere is prepared by the following method:
adding the concentrated solution of the gold nanoparticles into magnetic agarose microspheres, uniformly mixing, reacting for 0.5-2h, and performing solid-liquid separation to obtain gold nanoparticles-magnetic agarose microspheres;
adding a phosphate buffer solution into the gold nanoparticle-magnetic agarose microspheres, then adding the aptamer thiolated complementary strand of acetamiprid, uniformly mixing, reacting for 12-20h, and performing solid-liquid separation to obtain the aptamer complementary strand-gold nanoparticle-magnetic agarose microspheres;
adding phosphate buffer solution into the aptamer complementary strand-nano gold particle-magnetic agarose microspheres, then adding the aptamer of acetamiprid, mixing uniformly, reacting for 1-2h, and performing solid-liquid separation to obtain the double-stranded nucleic acid-nano gold particle-magnetic agarose microspheres.
Preferably, in the step of preparing the gold nanoparticle-magnetic agarose microspheres, the concentration of the gold nanoparticles is 2.5-4.5nmol/L, and the concentration of the magnetic agarose microspheres is 0.2 mg/mL;
in the step of preparing the aptamer complementary strand-gold nanoparticle-magnetic agarose microsphere, the concentration of the aptamer thiolated complementary strand of acetamiprid is not less than 2OD, and the concentration of the gold nanoparticle-magnetic agarose microsphere is 0.2 mg/mL;
in the preparation step of the double-stranded nucleic acid-gold nanoparticle-magnetic agarose microsphere, the concentration of the aptamer of the acetamiprid is not less than 2OD, and the concentration of the aptamer complementary strand-gold nanoparticle-magnetic agarose microsphere is 0.2 mg/mL.
Preferably, the gold nanoparticle concentrated solution is prepared by the following method:
respectively preparing trisodium citrate solution with the concentration of 0.33-0.35mmol/L and chloroauric acid solution with the concentration of 9-11 mmol/L;
adding the chloroauric acid solution into distilled water, stirring and heating to boil; then adding the trisodium citrate solution, heating to react until the color of the solution becomes wine red, stopping heating, and stirring to room temperature to obtain a nano gold particle colloidal solution;
and (3) centrifuging the nano gold particle colloidal solution to obtain a precipitate, and adding distilled water into the precipitate to obtain a nano gold particle concentrated solution.
Preferably, the molar ratio of the chloroauric acid to the trisodium citrate is 32:1-42: 1.
The invention also provides a detection method for detecting acetamiprid by the acetamiprid detection device in any technical scheme, which comprises the following steps:
identification and capture of analytes in a sample: placing the injection port of the acetamiprid detection device in sample liquid, pulling the piston to one end of the air cavity far away from the reaction cavity to fill the reaction cavity with the sample liquid, plugging the injection port with a plug, and taking down the magnet to allow the capture probe and the sample liquid to perform mixing reaction for 0.5-1.5 h; sleeving the magnet outside the reaction cavity, pulling out the plug, and slowly pushing the piston to a position where the piston head is positioned in the air cavity and is connected with the reaction cavity, wherein at the moment, the solution in the reaction cavity is completely discharged out of the injector, so that the identification and capture of the analyte in the sample are completed;
and (3) displaying a detection result: TMB solution and H are sequentially extracted by adopting the acetamiprid detection device for recognizing and capturing the analytes in the sample2O2Solution, acetic acid-sodium acetate buffer solution and distilled water, so that the TMB solution and H are mixed2O2And the reaction cavity is filled with the solution, the acetic acid-sodium acetate buffer solution and the distilled water, the piston is slowly pushed to the joint of the piston head and the reaction cavity in the air cavity after full mixing and reaction, and the reaction liquid is collected into the colorimetric tube to finish the display of the detection result.
Preferably, the display of the detection result comprises qualitative detection and quantitative detection, wherein the qualitative detection comprises the manufacture of a standard colorimetric card, and the comparison of the color of the reaction solution by using the standard colorimetric card is used for confirming the existence of the acetamiprid; the quantitative detection comprises the steps of preparing a standard curve, measuring the absorption spectrum of the reaction solution in a 350-750nm waveband by adopting an ultraviolet-visible spectrophotometer, and obtaining the residual concentration of the acetamiprid by utilizing the standard curve.
Compared with the prior art, the invention has the beneficial effects that:
1. the invention provides an acetamiprid detection device, which realizes the device detection of acetamiprid and is suitable for field detection;
2. the invention provides an acetamiprid detection device, wherein a capture probe in the detection device has the characteristic of being reusable;
3. the invention provides an acetamiprid detection device, which can obtain a high-sensitivity detection effect only by simulating the enzyme activity of peroxidase of gold nanoparticles in a capture probe without depending on other tracers, wherein the detection limit is as low as 2 nM;
4. the invention provides a method for detecting acetamiprid, which has the characteristics of simple operation and accurate detection result.
Drawings
Fig. 1 is a schematic structural diagram of an acetamiprid detection apparatus according to an embodiment of the present invention;
FIG. 2 is a diagram showing the detection results of absorption spectra obtained after detecting water and 2nM acetamiprid by using an acetamiprid detection apparatus according to an embodiment of the present invention;
FIG. 3 shows the reuse of the acetamiprid detection apparatus according to the embodiment of the present invention;
in the above figures: 1. an injection cavity; 11. a reaction chamber; 12. an air chamber; 2. a piston; 21. a piston head; 22. a push rod; 3. an injection port; 4. a capture probe; 5. and a magnet.
Detailed Description
The invention is described in detail below by way of exemplary embodiments. It should be understood, however, that elements, structures and features of one embodiment may be beneficially incorporated in other embodiments without further recitation.
In the description of the present invention, it is to be understood that the terms "upper", "lower", "bottom", "inner", and the like, as used herein, refer to an orientation or positional relationship based on that shown in fig. 1, which is for convenience and simplicity of description, and does not indicate or imply that the referenced device or element must have a particular orientation, be constructed and operated in a particular orientation, and thus, should not be construed as limiting the present invention.
In the description of the present invention, it is to be noted that, unless otherwise explicitly specified or limited, the terms "connected" and "connected" are to be interpreted broadly, e.g., as being fixed or detachable or integrally connected; they may be connected directly or indirectly through intervening media, or they may be interconnected between two elements. The specific meanings of the above terms in the present invention can be understood in specific cases to those skilled in the art.
As shown in fig. 1, the invention provides an acetamiprid detection device, which comprises an injector, wherein the injector comprises an injection cavity 1, a piston 2 and an injection port 3, the piston 2 comprises a piston head 21 and a push rod 22, the piston 2 is sleeved in the injection cavity 1, the injection port 3 is positioned at one end of the injection cavity 1, the injection port 3 is communicated with the inside of the injection cavity 1, the injection cavity 1 comprises a reaction cavity 11 and an air cavity 12, the volume of the reaction cavity 11 is the same as that of the air cavity 12, and the reaction cavity 11 is arranged close to the injection port 3; the piston head 21 is arranged in the air chamber 12, and the capture probe 4 is arranged in the reaction chamber 11; also comprises a magnet 5 sleeved outside the reaction cavity 11. The acetamiprid detection device realizes the device detection of the acetamiprid and is suitable for field detection. The magnet 5 is sleeved outside the reaction cavity 11, and the capture probe 4 is limited in the reaction cavity 11 by utilizing the mutual attraction between the capture probe 4 and the magnet 5, so that the capture probe 4 is prevented from being directly contacted with the piston head 21, and the capture probe 4 can be ensured to be perfectly retained in the reaction cavity 11.
In a preferred embodiment, the detection device is assembled by the following method:
formation of air space: taking the injector, and pulling the piston 2 to the position where the piston head 21 is positioned in the air cavity 12 and is connected with the reaction cavity 11;
loading of capture probe 4: placing the injection port 3 of the injector in the suspension of the capture probe 4, pulling the piston 2 to one end of the air cavity 12 far away from the reaction cavity 11 to ensure that the reaction cavity 11 is filled with the suspension of the capture probe 4, and plugging the injection port 3 by a plug; keeping the injector in an upright state, sleeving the magnet 5 outside the reaction cavity 11, pulling off the plug, and slowly pushing the piston 2 to a position where the piston head 21 is positioned in the air cavity 12 and is connected with the reaction cavity 11, wherein at the moment, the solution in the reaction cavity 11 is completely discharged out of the injector, so that the loading of the capture probe 4 is completed, and the acetamiprid detection device is obtained. In this example, a capture probe 4 suspension was formulated as follows: and adding phosphate buffer solution (pH 7.2-7.4) into the capture probe 4, and uniformly mixing to obtain a capture probe 4 suspension. The phosphate buffer solution serves to provide a chemically stable mediator environment for the capture probes. During the assembly of the device, the capture probe 4 suspension is subjected to the control of the push-pull movement of the piston 2 by means of the air space, avoiding direct contact with the piston 2, leaving the capture probe 4 intact inside the reaction chamber 11 of the syringe.
In a preferred embodiment, the capture probe 4 is a double-stranded nucleic acid-gold nanoparticle-magnetic agarose microsphere, and the capture probe 4 comprises a whole body composed of the double-stranded nucleic acid, the gold nanoparticle and the magnetic agarose microsphere. The capture probe 4 adopts the nucleic acid aptamer immobilization method which comprises the following steps: firstly, modifying the thiolated complementary strand of the aptamer of the acetamiprid to the surface of the gold nanoparticle through gold-sulfur bonds, and then hybridizing the aptamer of the acetamiprid with the complementary strand of the aptamer of the acetamiprid in a nucleic acid hybridization manner to form double-stranded nucleic acid, thereby completing the immobilization of the aptamer on the surface of the gold nanoparticle. The immobilization mode not only maintains the binding freedom of the aptamer, but also can realize the reutilization of the probe by simply adding the free aptamer after completing the detection once because the aptamer is dissociated from the surface of the nanogold after being bound with the target object. After the test, the capture probe 4 still can maintain 95% of detection effect after being repeated five times. In addition, the signal acquisition strategy provided by the capture probe 4 does not need to depend on other tracers, and the detection effect with high sensitivity can be obtained only by simulating the enzyme activity of the peroxidase of the nanogold particles in the capture probe 4, wherein the detection limit is as low as 2 nM.
In a preferred embodiment, the double-stranded nucleic acid comprises an aptamer of acetamiprid and a thiolated complementary strand of the aptamer of acetamiprid. Wherein, the sequence of the aptamer of the acetamiprid is as follows: 5 'CTGACACCATATTATGAAGA 3', the sequence of the thiolated complementary strand of the aptamer of acetamiprid is: 5 'SH-TTTTTTTTTTTTTTTTCTTCATAATATGGTGTCAG 3'. The capture probe 4 adopted in the embodiment does not need any redundant signal label or tracer, and the capture probe 4 has certain peroxidase activity and can catalyze TMB-H2O2In this case, blue oxidized TMB was produced. Specifically, in the presence of acetamiprid, the binding capacity of the aptamer to the target is stronger than that of the aptamer to the thiolated complementary strand of the aptamer,thus, acetamiprid can convert double-stranded nucleic acid in the capture probe 4 to single-stranded nucleic acid. Compared with the relatively rigid double-helix conformation of the double-stranded nucleic acid, the single-stranded nucleic acid in the irregular coil state is more easily bonded on the surface of the nano-gold particle, so that the TMB molecule is influenced to reach the surface of the nano-gold particle, and finally, the peroxidase activity of the capture probe 4 is weakened, and the generation of oxidized TMB is reduced. Thus, qualitative and quantitative detection of the acetamiprid can be realized by observing color change or the change of the characteristic absorption peak intensity at 650nm with naked eyes.
In a preferred embodiment, the double-stranded nucleic acid-gold nanoparticle-magnetic agarose microsphere is prepared by the following method:
s1: adding the concentrated solution of gold nanoparticles into magnetic agarose microspheres, mixing uniformly, reacting for 0.5-2h, and performing solid-liquid separation to obtain gold nanoparticles-magnetic agarose microspheres;
s2: adding a phosphate buffer solution into the gold nanoparticle-magnetic agarose microspheres, then adding the aptamer thiolated complementary strand of acetamiprid, uniformly mixing, reacting for 12-20h, and performing solid-liquid separation to obtain the aptamer complementary strand-gold nanoparticle-magnetic agarose microspheres;
s3: adding phosphate buffer solution into the aptamer complementary strand-nano gold particle-magnetic agarose microspheres, then adding the aptamer of acetamiprid, mixing uniformly, reacting for 1-2h, and performing solid-liquid separation to obtain the double-stranded nucleic acid-nano gold particle-magnetic agarose microspheres.
In the above examples, in step S1, the magnetic agarose microspheres loaded with gold nanoparticles were obtained by separation using a magnetic separator, and the magnetic agarose microspheres loaded with gold nanoparticles were washed with a phosphate buffer solution (pH 7.2 to 7.4). Repeating the washing for three times to remove the redundant nano gold particles; the reason for adopting the phosphate buffer solution for cleaning treatment is that the reaction between the final capture probe and the acetamiprid needs to be carried out in the phosphate buffer solution, and the buffer solution can provide a chemically stable medium environment for the identification reaction; and S2, separating by using a magnetic separator to obtain the gold nanoparticle-magnetic agarose microspheres assembled with the aptamer complementary chains, and washing the gold nanoparticle-loaded magnetic agarose microspheres by using a phosphate buffer solution (pH 7.2-7.4). Repeating the washing three times to remove excess aptamer complementary strand; the reason for adopting the phosphate buffer solution for cleaning treatment is that the reaction between the final capture probe and the acetamiprid needs to be carried out in the phosphate buffer solution, and the buffer solution can provide a chemically stable medium environment for the identification reaction; and S3, separating by using a magnetic separator to obtain the aptamer complementary strand-nanogold particle-magnetic agarose microsphere assembled with the aptamer, and washing the aptamer complementary strand-nanogold particle-magnetic agarose microsphere assembled with the aptamer by using a phosphate buffer solution (pH 7.2-7.4). Washing was repeated three times to remove excess aptamer; the reason for the washing process with phosphate buffer is that the final capture probe reaction with acetamiprid is carried out in phosphate buffer, which provides a chemically stable medium environment for the identification reaction.
In a preferred embodiment, in the preparation step of the gold nanoparticle-magnetic agarose microspheres, the concentration of the gold nanoparticles is 2.5-4.5nmol/L, and the concentration of the magnetic agarose microspheres is 0.2 mg/mL;
in the preparation step of the aptamer complementary strand-gold nanoparticle-magnetic agarose microsphere, the concentration of the aptamer thiolated complementary strand of acetamiprid is not less than 2OD, and the concentration of the gold nanoparticle-magnetic agarose microsphere is 0.2 mg/mL;
in the preparation step of the double-stranded nucleic acid-gold nanoparticle-magnetic agarose microsphere, the concentration of the aptamer of the acetamiprid is not less than 2OD, and the concentration of the aptamer complementary strand-gold nanoparticle-magnetic agarose microsphere is 0.2 mg/mL. Wherein OD means: optical density, generally applied to the detection of nucleic acid concentration by ultraviolet spectrophotometer. For single stranded DNA, 1OD equals 40. mu.g/mL. In addition, the concentrations of the magnetic agarose microspheres, the gold nanoparticles-magnetic agarose microspheres and the aptamer complementary strand-gold nanoparticles-magnetic agarose microspheres are all 0.2mg/mL, because the gold nanoparticles and the aptamer are sequentially loaded on the magnetic agarose microspheres, the loading capacity is small, and therefore, the influence on the concentration is also small.
In a preferred embodiment, the gold nanoparticle concentrate is prepared by the following method:
s1: respectively preparing trisodium citrate solution with the concentration of 0.33-0.35mmol/L and chloroauric acid solution with the concentration of 9-11 mmol/L;
s2: adding the chloroauric acid solution into distilled water, stirring and heating to boil; then adding trisodium citrate solution, heating to react until the solution becomes wine red, stopping heating, and stirring to room temperature to obtain nano gold particle colloidal solution;
s3: and (3) centrifuging the nano gold particle colloidal solution to obtain a precipitate, and adding distilled water into the precipitate to obtain a nano gold particle concentrated solution.
In this example, the concentrations of the trisodium citrate solution and the chloroauric acid solution are specifically limited in the step S1, because the concentrations of the sodium citrate and the chloroauric acid have a great influence on the size and the morphology of the formed gold nanoparticles, and the gold nanoparticles prepared according to the concentration defined in this example are about 30nm and have a spherical shape. Wherein, the concentration of the trisodium citrate solution can also be 0.34mmol/L, and the concentration of the chloroauric acid solution can also be 10 mmol/L; when the solution color changes to wine red, the trivalent gold particles change to nano-gold particles because the nano-gold particles have a strong absorption peak at 524 nm.
In a preferred embodiment, the molar ratio of chloroauric acid to trisodium citrate is from 32:1 to 42: 1.
The invention also provides a detection method for detecting acetamiprid by the acetamiprid detection device of any one of the embodiments, which comprises the following steps:
s1: identification and capture of analytes in a sample: placing an injection port 3 of the acetamiprid detection device in sample liquid, pulling a piston 2 to one end of an air cavity 12 far away from a reaction cavity 11 to enable the reaction cavity 11 to be filled with the sample liquid, plugging the injection port 3 with a plug, taking down a magnet 5, and enabling a capture probe 4 to be mixed with the sample liquid for reaction for 0.5-1.5 hours; sleeving the magnet 5 outside the reaction cavity 11, pulling out the plug, and slowly pushing the piston 2 to a position where the piston head 21 is positioned in the air cavity 12 and is connected with the reaction cavity 11, wherein at the moment, the solution in the reaction cavity 11 is completely discharged out of the injector, so that the identification and capture of the analyte in the sample are completed; in the step, firstly, the sample liquid is sucked into the reaction cavity 11, the sample liquid and the capture probe 4 in the reaction cavity 11 are fully mixed and reacted, concretely, the injector can be placed on a vertical rotation mixing machine for mixing in the process, the analyte in the sample is captured by the capture probe 4 in the mixing reaction process, then the magnet 5 is sleeved outside the reaction cavity 11, at the moment, the capture probe 4 is limited in the reaction cavity 11 due to the mutual attraction effect between the capture probe 4 and the magnet 5, and meanwhile, the sample liquid is controlled by the push-pull motion of the piston 2 at intervals of air, so that the direct contact between the capture probe 4 and the piston 2 is avoided, and the capture probe 4 is well kept in the reaction cavity 11 of the injector.
S2: and (3) displaying a detection result: TMB solution and H are sequentially extracted by adopting the acetamiprid detection device for recognizing and capturing the analytes in the sample2O2Solution, acetic acid-sodium acetate buffer solution and distilled water, dissolving TMB solution and H2O2The reaction cavity 11 is filled with the solution, the acetic acid-sodium acetate buffer solution and the distilled water, after the complete mixing reaction, the piston 2 is slowly pushed to the position where the piston head 21 is positioned in the air cavity 12 and is connected with the reaction cavity 11, and meanwhile, the reaction liquid is collected into the colorimetric tube, and the display of the detection result is completed. In the step, the preparation method of the TMB solution comprises the following steps: firstly, 0.1-0.2g of TMB is weighed and dissolved in 3mL of dimethyl sulfoxide, and then 50mL of distilled water is added; then, sequentially adding 0.15-0.25g of disodium ethylene diamine tetraacetate, 0.9-1.0g of citric acid and 50mL of glycerol; finally, distilled water was added to make the volume of the whole solution 500mL, to prepare a TMB solution. H2O2The preparation method of the solution comprises the following steps: 1mL of H with the commercial mass fraction of 30 percent is weighed out2O2Diluting with distilled water to obtain total solution with volume of 10mL, and making into H2O2And (3) solution. The preparation method of the acetic acid-sodium acetate buffer solution comprises the following steps: firstly measuring 1.145mL of glacial acetic acid, adding distilled water to a constant volume of 100mL to obtain an acetic acid solutionAnd (4) liquid. 0.7703-0.8703g of sodium acetate is weighed, dissolved by adding distilled water and added to 50mL of water to obtain sodium acetate solution. And uniformly mixing the acetic acid solution and the sodium acetate solution according to the ratio of 3:7(V/V) to obtain the acetic acid-sodium acetate buffer solution. In the reaction chamber 11, TMB solution and H2O2The volume ratio of the solution, the acetic acid-sodium acetate buffer solution and the distilled water is 4:5:2: 9. The detection principle is as follows: the capture probe 4 has a certain peroxidase activity and can catalyze TMB-H2O2In this case, blue oxidized TMB was produced.
In a preferred embodiment, the displaying of the detection result comprises qualitative detection and quantitative detection, the qualitative detection comprises manufacturing of a standard colorimetric card, and comparing the color of the reaction solution by using the standard colorimetric card to confirm the existence of the acetamiprid; the quantitative detection comprises the preparation of a standard curve, the measurement of the absorption spectrum of the reaction solution in the 350-750nm wave band by adopting an ultraviolet-visible spectrophotometer, and the acquisition of the residual concentration of the acetamiprid by utilizing the standard curve.
In the process, the preparation method of the standard colorimetric card comprises the following steps: 1mL of acetamiprid standards with different concentrations (0nM, 2nM, 5nM, 10nM, 15nM, 20nM, 30nM, 40nM, 60nM, 80nM, 100nM) were prepared, respectively. After 1mL of acetamiprid standard solutions with different concentrations are respectively sucked into the reaction chamber 11 by an acetamiprid detection device, the injection port 3 of the syringe is immediately blocked by a plug. The magnet 5 is taken down, and the injector is placed on a vertical rotary blending machine for mixing reaction for 30 min. After the reaction is finished, the magnet 5 is sleeved outside the reaction cavity 11 of the injector, and the injector is ensured to be in a vertical state. And pulling out the plug, slowly pushing the piston 2, and completely pushing the sample liquid in the reaction cavity 11 out of the injector to separate the capture probe 4 from the standard liquid so as to finish the identification and capture of the acetamiprid.
Then, 200. mu.L of TMB solution and 250. mu. L H were sequentially pipetted2O2Solution, 100. mu.L of acetic acid-sodium acetate buffer and 450. mu.L of distilled water. The magnet 5 is taken down, and the injector is placed on a vertical rotary blending machine for mixing reaction for 30 min. After the reaction is finished, the magnet 5 is sleeved outside the syringe reaction cavity 11, and the syringe is ensured to be in a vertical state. The plug is pulled off, the piston 2 is slowly pushed, and the reaction liquid in the reaction cavity 11 is completely pushed out of the injectorAnd collecting the sample in a colorimetric tube to finish the display of the detection result. It can be observed that the blue color of the solution gradually becomes lighter as the concentration of acetamiprid increases.
Finally, the color of the colorimetric tube solutions were collected by a digital camera (Nikon D7000), and printed on A4 paper (Daolin 100g) by a printer (Hewlett packard 377dw) to form a standard colorimetric card.
Qualitative judgment and semi-quantitative analysis: and observing the color of the reaction liquid in the colorimetric tube, comparing the color with a standard colorimetric card, qualitatively judging whether the acetamiprid exists in the sample, and semi-quantitatively analyzing the residual level of the acetamiprid.
The quantitative detection method comprises the following steps:
and (3) preparing a standard curve: 1mL of acetamiprid standards with different concentrations (0nM, 2nM, 5nM, 10nM, 15nM, 20nM, 30nM, 40nM, 60nM, 80nM, 100nM) were prepared, respectively. Colorimetric tubes with acetamiprid of different concentrations are placed in a conventional ultraviolet-visible spectrophotometer, and absorption spectra of the 350-750nm waveband are measured. Then, absorbance A at an absorption peak at 650nm was measured650Plotted on the ordinate versus the acetamiprid concentration on the abscissa. By linear fitting, a standard curve was obtained.
Quantitative analysis: the colorimetric tube filled with the reaction liquid is placed in an ultraviolet-visible spectrophotometer, and the absorption spectrum of the 350-750nm waveband is measured. A is to be650And (4) bringing the numerical value into a standard curve to obtain the residual concentration of the acetamiprid in the sample.
In order to more clearly and specifically describe the acetamiprid detection apparatus and the acetamiprid detection method provided in the embodiments of the present invention, the following description will be given with reference to specific embodiments.
Example 1
(1) Preparation of Capture probes
Step 1: pretreatment of magnetic agarose microspheres
Magnetic agarose microspheres (BeaverBeads)TMMagrose-OH) from beaver, Suzhou, in 50% (V/V) ethanol solution. Before use, the magnetic agarose microsphere suspension is mixed with water according to the proportion of 1:50 (V/V); treating with vortex mixer for 15s, and separating with magnetic agarose microsphere in magnetic separatorSeparating the solution; the solution was discarded and one pretreatment was completed. After repeating the treatment three times, the obtained magnetic agarose microspheres were used in the following steps.
Step 2: preparation of concentrated solution of nano gold particles
Firstly, preparing trisodium citrate solution
0.019g of trisodium citrate is weighed and dissolved in 200mL of distilled water to obtain a 0.33mmol/L trisodium citrate solution.
② preparing chloroauric acid solution
0.325g of chloroauric acid was weighed and dissolved in 100mL of distilled water to obtain a 9mmol/L chloroauric acid solution.
Preparation of nano gold particle colloidal solution
Absorbing 5mL of the chloroauric acid solution obtained in the step 2-II, adding 195mL of distilled water, stirring and heating to boil, adding 4mL of the trisodium citrate solution obtained in the step 2-I, heating for about 6min until the color becomes wine red, stopping heating, and stirring to room temperature to obtain the nano gold particle colloidal solution.
Preparation of concentrated solution of nano gold particles
Centrifuging the nano gold particle colloidal solution obtained in the step 2-third step at 8000r/min for 10min, removing the supernatant, and adding 10mL of distilled water to obtain the nano gold particle concentrated solution.
And step 3: preparation of nano gold particle-magnetic agarose microsphere
And (3) adding the 10mL of the gold nanoparticle concentrated solution obtained in the step (2) into the magnetic agarose microspheres obtained in the step (1), mixing and reacting for 0.5h on a vertical rotary mixer, separating the magnetic agarose microspheres by using a magnetic separator, and discarding the solution. Then, 10mL of phosphate buffer solution (pH 7.2-7.4) was added, treated with a vortex mixer for 15 seconds, and then placed in a magnetic separator to separate magnetic agarose microspheres, and the solution was discarded to complete the primary solution exchange. And repeating the solution replacement for three times to obtain the gold nanoparticle-magnetic agarose microspheres.
And 4, step 4: preparation of Capture probes
(ii) Assembly of aptamer complementary Strand
10mL of phosphate buffer solution (pH 7.2-7.4) is measured, and the nano gold particle-magnetic agarose microspheres obtained in the step 3 are added. Then adding 2OD thiolated aptamer complementary strand, mixing and reacting for 16h on a vertical rotary mixer, putting the mixture into a magnetic separator to separate magnetic agarose microspheres, and discarding the solution. Then, 10mL of phosphate buffer solution (pH 7.2-7.4) was added, treated with vortex mixer for 15s, and then placed into magnetic separator to separate magnetic agarose microspheres, and the solution was discarded to complete one-time washing. And (4) after repeating the washing for three times, finishing the assembly of the aptamer complementary strand to obtain the aptamer complementary strand-gold nanoparticle-magnetic agarose microspheres.
Association of aptamers
Measuring 10mL of phosphate buffer solution (pH 7.2-7.4), and adding the aptamer complementary strand-nanogold particle-magnetic agarose microsphere obtained in the step 4-I. Then adding 2OD aptamer, mixing and reacting for 2h on a vertical rotary mixer, putting the mixture into a magnetic separator to separate magnetic agarose microspheres, and discarding the solution. Then, 10mL of phosphate buffer solution (pH 7.2-7.4) was added, treated with vortex mixer for 15s, and then placed into magnetic separator to separate magnetic agarose microspheres, and the solution was discarded to complete one-time washing. And (3) after repeating the three times of cleaning, completing the assembly of the aptamer to obtain the double-stranded nucleic acid-nano gold particles-magnetic agarose microspheres, namely the capture probe 4.
(2) Assembly of acetamiprid detection device (air-spaced injector)
Step 1: preparation of a Capture Probe suspension
10mL of phosphate buffer (pH 7.2-7.4) was measured and added to the capture probe 4, and after 15s treatment with a vortex mixer, a capture probe suspension was formed.
Step 2: formation of air gaps
A needle-free common syringe with the volume of 2mL is taken, the syringe cylinder is manually divided into two chambers with the volumes of 1mL, one chamber close to an outlet is named as a reaction chamber 11, and the other chamber is named as an air chamber 12. Pulling the piston 2 first sucks 1mL of air into the reaction chamber 11, forming an air space.
And step 3: loading of capture probes
Based on step 2, the piston 2 is pulled to suck 1mL of capture probe suspension into the reaction chamber 11. At this time, the air space moves from the reaction chamber 11 to the air chamber 12. Immediately thereafter, the injection port 3 of the syringe was closed with a stopper to prevent leakage. Then, a magnet 5 having an inner diameter of 1.3cm and a length of 1.5cm was fitted over the syringe reaction chamber 11 while ensuring that the syringe was in an upright state. And pulling off the plug, slowly pushing the piston 2, and completely pushing the solution in the reaction cavity 11 out of the injector to separate the capture probe 4 from the solution, thereby completing the loading of the capture probe 4 and obtaining the air space injector. At this time, the air space moves from the air chamber 12 back to the reaction chamber 11. It should be noted here that the capture probe suspension is controlled by the push-pull movement of the piston 2 via the air compartment, avoiding direct contact with the piston 2, leaving the capture probe 4 intact in the reaction chamber 11 of the syringe.
(3) Acetamiprid detection method
Step 1: identification and capture of analytes in a sample
After 1mL of sample solution was aspirated into the reaction chamber 11 using an acetamiprid detection apparatus (air-spaced syringe), the syringe injection port 3 was immediately plugged with a plug. The magnet 5 is taken down, and the injector is placed on a vertical rotary blending machine for mixing reaction for 30 min. After the reaction is finished, the magnet 5 is sleeved outside the syringe reaction cavity 11, and the syringe is ensured to be in a vertical state. And pulling off the plug, slowly pushing the piston 2, and completely pushing the sample liquid in the reaction cavity 11 out of the injector to separate the capture probe 4 from the sample liquid so as to finish the identification and capture of the analyte in the sample.
Step 2: display of detection result
Preparation of TMB solution
0.1 mL of TMB was first weighed and dissolved in 3mL of dimethyl sulfoxide, and 50mL of distilled water was added. Then, 0.15g of disodium ethylenediaminetetraacetate, 0.9g of citric acid, and 50mL of glycerin were added in this order. Finally, distilled water was added to make the volume of the whole solution 500mL, to prepare a TMB solution.
②H2O2Preparation of the solution
1mL of H with the commercial mass fraction of 30 percent is weighed out2O2Diluting with distilled water to obtain total solution with volume of 10mL, and making into H2O2And (3) solution.
Preparation of acetic acid-sodium acetate buffer solution
Firstly, measuring 1.145mL of glacial acetic acid, and adding distilled water to a constant volume of 100mL to obtain an acetic acid solution. 0.7703g of sodium acetate is weighed, dissolved by adding distilled water and is metered to 50mL to obtain a sodium acetate solution. And uniformly mixing the acetic acid solution and the sodium acetate solution according to the ratio of 3:7(V/V) to obtain the acetic acid-sodium acetate buffer solution.
Fourthly, displaying the detection result
Sequentially sucking 200 μ L of TMB solution obtained in step 2-first and 250 μ L of H obtained in step 2-second with an air space syringe for recognizing and capturing the analyte in the sample in step 12O2Solution, 100 mu L of step 2- ③ to obtain acetic acid-sodium acetate buffer solution and 450 mu L of distilled water. The magnet 5 is taken down, and the injector is placed on a vertical rotary blending machine for mixing reaction for 30 min. After the reaction is finished, the magnet 5 is sleeved outside the syringe reaction cavity 11, and the syringe is ensured to be in a vertical state. The plug is pulled out, the piston 2 is slowly pushed, the reaction liquid in the reaction cavity 11 is completely pushed out of the injector and collected into the colorimetric tube, and the detection result is displayed.
And step 3: qualitative judgment and semi-quantitative analysis of detection results
Making standard colour comparison card
1mL of acetamiprid standards with different concentrations (0nM, 2nM, 5nM, 10nM, 15nM, 20nM, 30nM, 40nM, 60nM, 80nM, 100nM) were prepared, respectively. And (3) respectively sucking 1mL of acetamiprid standard solution with different concentrations into the reaction cavity 11 by using the air space syringe obtained in the step (2), and immediately blocking the injection port 3 of the syringe by using a plug. The magnet 5 is taken down, and the injector is placed on a vertical rotary blending machine for mixing reaction for 30 min. After the reaction is finished, the magnet 5 is sleeved outside the syringe reaction cavity 11, and the syringe is ensured to be in a vertical state. And pulling out the plug, slowly pushing the piston 2, and completely pushing the sample liquid in the reaction cavity 11 out of the injector to separate the capture probe 4 from the standard liquid so as to finish the identification and capture of the acetamiprid.
Then, sequentially sucking 200. mu.L of the extract obtained in step 2-ITMB solution, 250 mu L H obtained in step 2-II2O2Solution, 100 mu L of step 2- ③ to obtain acetic acid-sodium acetate buffer solution and 450 mu L of distilled water. The magnet 5 is taken down, and the injector is placed on a vertical rotary blending machine for mixing reaction for 30 min. After the reaction is finished, the magnet 5 is sleeved outside the syringe reaction cavity 11, and the syringe is ensured to be in a vertical state. The plug is pulled out, the piston 2 is slowly pushed, the reaction liquid in the reaction cavity 11 is completely pushed out of the injector and collected into the colorimetric tube, and the detection result is displayed. It can be observed that the blue color of the solution gradually becomes lighter as the concentration of acetamiprid increases.
Finally, the color of the colorimetric tube solutions were collected by a digital camera (Nikon D7000), and printed on A4 paper (Daolin 100g) by a printer (Hewlett packard 377dw) to form a standard colorimetric card.
② qualitative judgment and semi-quantitative analysis
And (4) observing the color of the solution in the colorimetric tube obtained in the steps 2- ((r)), comparing the color with a standard colorimetric card, qualitatively judging whether the acetamiprid exists in the sample, and semi-quantitatively analyzing the residual level of the acetamiprid.
And 4, step 4: quantitative analysis of detection results
Making standard curve
And (3) placing the colorimetric tubes corresponding to the acetamiprid with different concentrations obtained in the step (3-r) in a conventional ultraviolet-visible spectrophotometer, and measuring the absorption spectrum of the 350-750nm waveband. Then, absorbance A at an absorption peak at 650nm was measured650Plotted on the ordinate versus the acetamiprid concentration on the abscissa. By linear fitting, a standard curve was obtained.
② quantitative analysis
And (3) placing the colorimetric tube obtained in the step (2-the fourth) in an ultraviolet-visible spectrophotometer, and measuring the absorption spectrum of the 350-750nm waveband. A is to be650And (4) bringing the numerical value into a standard curve to obtain the residual concentration of the acetamiprid in the sample.
(4) Analysis of detection results
Detection effect of air-spaced injector on 2nM acetamiprid
After 1mL of water and 2nM of acetamiprid solution were respectively aspirated into reaction chamber 11 with an air-spaced syringe, syringe injection port 3 was immediately plugged with a stopper. The magnet 5 is taken down, and the injector is placed on a vertical rotary blending machine for mixing reaction for 30 min. After the reaction is finished, the magnet 5 is sleeved outside the syringe reaction cavity 11, and the syringe is ensured to be in a vertical state. The plug is pulled off, the piston 2 is pushed slowly, and the sample liquid in the reaction cavity 11 is pushed out of the injector completely, so that the capture probe 4 is separated from the sample liquid.
Then, 200. mu.L of TMB solution and 250. mu. L H were sequentially pipetted2O2Solution, 100. mu.L of acetic acid-sodium acetate buffer and 450. mu.L of distilled water. The magnet 5 is taken down, and the injector is placed on a vertical rotary blending machine for mixing reaction for 30 min. After the reaction is finished, the magnet 5 is sleeved outside the syringe reaction cavity 11, and the syringe is ensured to be in a vertical state. The plug is pulled out, the piston 2 is pushed slowly, the reaction liquid in the reaction cavity 11 is pushed out of the injector completely, and the reaction liquid is collected in the colorimetric tube.
The absorption spectrum in the 350-750nm band was measured with a UV-Vis spectrophotometer. As shown in FIG. 2, if the sample is water, the peroxidase activity of the capture probe 4 is not affected, and a strong absorption peak appears at 650nm in the absorption spectrum, corresponding to a dark blue color of the solution. If the sample contains 2nM acetamiprid, the absorption spectrum still shows an absorption peak at 650nM, but the intensity is reduced, and the corresponding solution shows a reduced blue color. This indicates that the presence of acetamiprid reduces the peroxidase activity of capture probe 4.
(5) Reuse of air-spaced syringes
From a detection principle, the air-space syringe only loses part of the aptamer after one use. Therefore, repeated use can be achieved by merely performing complementary assembly of the aptamer. The specific method comprises the following steps:
cleaning
After 1mL of phosphate buffer (pH 7.4) was aspirated into the reaction chamber 11, the syringe injection port 3 was immediately blocked with a stopper. The magnet 5 is removed and the syringe is turned upside down several times to bring the capture probe 4 into full contact with the buffer. Then, the magnet 5 is fitted outside the syringe reaction chamber 11 while ensuring that the syringe is in an upright state. And pulling out the plug, slowly pushing the piston 2, and completely pushing the buffer solution in the reaction cavity 11 out of the injector to separate the capture probe 4 from the buffer solution, thereby completing one-time cleaning. Repeating the steps for three times.
(ii) complementary Assembly of aptamers
After 1mL of a phosphate buffer solution (pH 7.4) containing a 0.2OD aptamer was aspirated into the reaction chamber 11 with a purged air-space syringe, the syringe injection port 3 was immediately blocked with a stopper. The magnet 5 is taken down, and the injector is placed on a vertical rotary blending machine for mixing reaction for 2 hours. After the reaction is finished, the magnet 5 is sleeved outside the syringe reaction cavity 11, and the syringe is ensured to be in a vertical state. The plug is pulled off, the piston 2 is pushed slowly, the buffer solution in the reaction cavity 11 is pushed out of the injector completely, and the capture probe 4 is separated from the reaction solution. Then, the air-space syringe was washed with a phosphate buffer solution (pH 7.4) to remove excess aptamer, thereby completing the complementary assembly of the aptamer.
Detecting
Finally, acetamiprid detection was performed with a post-assembly air-spaced syringe according to the detection method provided in the present invention.
According to the method, 30nM acetamiprid is used as a detection object, and after five repeated detections by using an air interval syringe, the detection results are compared. As shown in fig. 3, the response obtained by the first detection is set as 100%, and after repeated use for five times, a response signal of 95% can still be obtained.
Claims (9)
1. An acetamiprid detection device, which comprises an injector, wherein the injector comprises an injection cavity (1), a piston (2) and an injection port (3), the piston (2) comprises a piston head (21) and a push rod (22), the piston (2) is sleeved on the injection cavity (1), the injection port (3) is located at one end of the injection cavity (1), and the injection port (3) is communicated with the inside of the injection cavity (1), and the acetamiprid detection device is characterized in that: the injection cavity (1) comprises a reaction cavity (11) and an air cavity (12), the volume of the reaction cavity (11) is the same as that of the air cavity (12), and the reaction cavity (11) is arranged close to the injection port (3); the piston head (21) is arranged in the air cavity (12), and the reaction cavity (11) comprises a capture probe (4); the device also comprises a magnet (5) sleeved outside the reaction cavity (11);
the capture probe (4) is double-stranded nucleic acid-gold nanoparticle-magnetic agarose microsphere, and the capture probe (4) comprises a whole body consisting of the double-stranded nucleic acid, the gold nanoparticle and the magnetic agarose microsphere.
2. The acetamiprid detection apparatus of claim 1, wherein the detection apparatus is assembled by:
formation of air space: taking the injector, and pulling the piston (2) to a position where the piston head (21) is positioned in the air cavity (12) and is connected with the reaction cavity (11);
loading of the capture probes (4): placing the injection port (3) of the syringe in a capture probe suspension, pulling the piston (2) to one end of the air cavity (12) far away from the reaction cavity (11), so that the reaction cavity (11) is filled with the capture probe suspension, and plugging the injection port (3) by a plug; keeping the injector in an upright state, sleeving the magnet (5) outside the reaction cavity (11), pulling off the plug, slowly pushing the piston (2) to a position where the piston head (21) is positioned in the air cavity (12) and is connected with the reaction cavity (11), and completely discharging the solution in the reaction cavity (11) out of the injector to complete the loading of the capture probe (4) so as to obtain the acetamiprid detection device.
3. The acetamiprid detection apparatus of claim 1, wherein the double-stranded nucleic acid comprises an aptamer of acetamiprid and a thiolated complementary strand of the aptamer of acetamiprid.
4. The acetamiprid detection apparatus according to claim 1, wherein the double-stranded nucleic acid-gold nanoparticle-magnetic agarose microspheres are prepared by the following method:
adding the concentrated solution of the gold nanoparticles into magnetic agarose microspheres, uniformly mixing, reacting for 0.5-2h, and performing solid-liquid separation to obtain gold nanoparticles-magnetic agarose microspheres;
adding a phosphate buffer solution into the gold nanoparticle-magnetic agarose microspheres, then adding the aptamer thiolated complementary strand of acetamiprid, uniformly mixing, reacting for 12-20h, and performing solid-liquid separation to obtain the aptamer complementary strand-gold nanoparticle-magnetic agarose microspheres;
adding phosphate buffer solution into the aptamer complementary strand-nano gold particle-magnetic agarose microspheres, then adding the aptamer of acetamiprid, mixing uniformly, reacting for 1-2h, and performing solid-liquid separation to obtain the double-stranded nucleic acid-nano gold particle-magnetic agarose microspheres.
5. The acetamiprid detection apparatus according to claim 4, wherein in the preparation step of the gold nanoparticle-magnetic agarose microspheres, the concentration of the gold nanoparticles is 2.5-4.5nmol/L, and the concentration of the magnetic agarose microspheres is 0.2 mg/mL;
in the step of preparing the aptamer complementary strand-gold nanoparticle-magnetic agarose microsphere, the concentration of the aptamer thiolated complementary strand of acetamiprid is not less than 2OD, and the concentration of the gold nanoparticle-magnetic agarose microsphere is 0.2 mg/mL;
in the preparation step of the double-stranded nucleic acid-gold nanoparticle-magnetic agarose microsphere, the concentration of the aptamer of the acetamiprid is not less than 2OD, and the concentration of the aptamer complementary strand-gold nanoparticle-magnetic agarose microsphere is 0.2 mg/mL.
6. The acetamiprid detection apparatus according to claim 4, wherein the gold nanoparticle concentrated solution is prepared by the following method:
respectively preparing trisodium citrate solution with the concentration of 0.33-0.35mmol/L and chloroauric acid solution with the concentration of 9-11 mmol/L;
adding the chloroauric acid solution into distilled water, stirring and heating to boil; then adding the trisodium citrate solution, heating to react until the color of the solution becomes wine red, stopping heating, and stirring to room temperature to obtain a nano gold particle colloidal solution;
and (3) centrifuging the nano gold particle colloidal solution to obtain a precipitate, and adding distilled water into the precipitate to obtain a nano gold particle concentrated solution.
7. The acetamiprid detection apparatus of claim 6, wherein the molar ratio of chloroauric acid to trisodium citrate is 32:1-42: 1.
8. The acetamiprid detection apparatus according to any one of claims 1 to 7, wherein the detection method comprises the following steps:
identification and capture of analytes in a sample: placing the injection port (3) of the acetamiprid detection device in sample liquid, pulling the piston (2) to one end of the air cavity (12) far away from the reaction cavity (11), filling the reaction cavity (11) with the sample liquid, plugging the injection port (3) with a plug, taking down the magnet (5), and allowing the capture probe (4) and the sample liquid to perform mixing reaction for 0.5-1.5 h; sleeving the magnet (5) outside the reaction cavity (11), pulling out the plug, and slowly pushing the piston (2) to a position where the piston head (21) is positioned in the air cavity (12) and is connected with the reaction cavity (11), wherein at the moment, the solution in the reaction cavity (11) is completely discharged out of the syringe, so that the identification and capture of the analyte in the sample are completed;
and (3) displaying a detection result: TMB solution and H are sequentially extracted by adopting the acetamiprid detection device for recognizing and capturing the analytes in the sample2O2Solution, acetic acid-sodium acetate buffer solution and distilled water, so that the TMB solution and H are mixed2O2The reaction cavity (11) is filled with a solution, an acetic acid-sodium acetate buffer solution and distilled water, after full mixing and reaction, the piston (2) is slowly pushed to the position where the piston head (21) is positioned in the air cavity (12) and is connected with the reaction cavity (11), and meanwhile, the reaction liquid is collected into a colorimetric tube, so that the display of the detection result is completed;
the capture probe (4) is double-stranded nucleic acid-gold nanoparticle-magnetic agarose microsphere, and the capture probe (4) comprises a whole body consisting of the double-stranded nucleic acid, the gold nanoparticle and the magnetic agarose microsphere.
9. The method for detecting acetamiprid according to claim 8, wherein the displaying of the detection result comprises qualitative detection and quantitative detection, the qualitative detection comprises preparing a standard color chart, and comparing the color of the reaction solution with the standard color chart to confirm the existence of acetamiprid; the quantitative detection comprises the steps of preparing a standard curve, measuring the absorption spectrum of the reaction solution in a 350-750nm waveband by adopting an ultraviolet-visible spectrophotometer, and obtaining the residual concentration of the acetamiprid by utilizing the standard curve.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910763789.9A CN110455790B (en) | 2019-08-19 | 2019-08-19 | Acetamiprid detection device and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910763789.9A CN110455790B (en) | 2019-08-19 | 2019-08-19 | Acetamiprid detection device and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110455790A CN110455790A (en) | 2019-11-15 |
| CN110455790B true CN110455790B (en) | 2022-05-13 |
Family
ID=68487492
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910763789.9A Active CN110455790B (en) | 2019-08-19 | 2019-08-19 | Acetamiprid detection device and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110455790B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5647994A (en) * | 1993-06-21 | 1997-07-15 | Labsystems Oy | Method and apparatus for separating magnetic particles from a solution |
| WO2004011146A1 (en) * | 2002-07-29 | 2004-02-05 | Campbell Andrew T | A device and method for manipulating magnetic particles |
| CN107389576A (en) * | 2017-08-29 | 2017-11-24 | 贵州大学 | A kind of quick colorimetric detection method of Acetamiprid based on nanometer enzymatic |
-
2019
- 2019-08-19 CN CN201910763789.9A patent/CN110455790B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5647994A (en) * | 1993-06-21 | 1997-07-15 | Labsystems Oy | Method and apparatus for separating magnetic particles from a solution |
| WO2004011146A1 (en) * | 2002-07-29 | 2004-02-05 | Campbell Andrew T | A device and method for manipulating magnetic particles |
| CN107389576A (en) * | 2017-08-29 | 2017-11-24 | 贵州大学 | A kind of quick colorimetric detection method of Acetamiprid based on nanometer enzymatic |
Non-Patent Citations (1)
| Title |
|---|
| 《Development of an upconversion fluorescence DNA probe for the detection of acetamiprid by magnetic nanoparticles separation》;Nana Sun et al;《Food Chemistry》;20180302;摘要及图1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110455790A (en) | 2019-11-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105067577A (en) | Dual emission rate type fluorescent probe for visually detecting carbon dots-Au nanoclusters of mercury ions and preparation method | |
| CN106092983B (en) | A kind of Y of detection organo-chlorine pesticide2O3:Tb3+@SiO2-NH2Fluorescent sensor array preparation method | |
| CN107462705B (en) | A kind of sensitivity is strong, decomposable quantum dot nano talent scout needle and preparation method thereof | |
| CN111044499A (en) | Carbon quantum dot fluorescence test paper sheet for simultaneously detecting four heavy metals in water and application thereof | |
| US20230287261A1 (en) | Fluorescent metal-organic framework superstructure compound, preparation method and application thereof | |
| US9511365B2 (en) | Sensor housing and reagent chemistry | |
| CN104694129A (en) | Fluorescent material capable of detecting ultralow-concentration heavy metal ions and preparation method of fluorescent material | |
| KR101937421B1 (en) | Composition for detecting heavy metal and method of manufacturing thereof | |
| CN108982641A (en) | A kind of preparation method of the electrochemical sensing of trace lead ion detection | |
| CN109115760B (en) | Rapid detection kit and detection method for urine sugar content based on chloroauric acid color reaction | |
| CN110455790B (en) | Acetamiprid detection device and detection method | |
| CN107884375A (en) | A kind of method and kit for detecting ferric ion | |
| Jia et al. | Immunosensor of nitrofuran antibiotics and their metabolites in animal-derived foods: A review | |
| CN110702760B (en) | Nano-gold-DNA (deoxyribonucleic acid) net structure electrochemical biosensor for detecting uranyl ions as well as preparation method and application of nano-gold-DNA net structure electrochemical biosensor | |
| KR101928333B1 (en) | Method for analyzing multiple biomolecule with multiple metal nano tag | |
| Li et al. | Recent advances in rare earth ion‐doped upconversion nanomaterials: From design to their applications in food safety analysis | |
| CN109813705B (en) | Method for detecting mercury ions by using paper chip based on nanogold-graphene quantum dots | |
| CN105259118B (en) | A kind of dual-functional nanometer probe and the preparation method and application thereof based on lanthanide series metal | |
| CN113984726B (en) | Method for detecting mercury ions by amino phenylboronic acid functionalized magnetic beads/glyoxal modified DNA | |
| CN106568773B (en) | Manganese ion colorimetric detection kit and detection method thereof | |
| CN110044862B (en) | Method for detecting acetamiprid based on ferroferric oxide polypyrrole and fluorescent material | |
| CN114371287A (en) | Staphylococcus aureus detection kit based on immunomagnetic separation and click chemical reaction and detection method thereof | |
| CN113777297A (en) | Fluorescence differential rapid detection method based on magnetic nanoparticles | |
| CN113552108A (en) | Method for visually and rapidly detecting organophosphorus pesticide residues by using quantum dot fluorescent probe | |
| WO2012012174A1 (en) | Sensor housing and reagent chemistry |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |