CN110452994A - Primer pair, probe and method for ten kinds of animal source components of synchronous detection - Google Patents
Primer pair, probe and method for ten kinds of animal source components of synchronous detection Download PDFInfo
- Publication number
- CN110452994A CN110452994A CN201910790453.1A CN201910790453A CN110452994A CN 110452994 A CN110452994 A CN 110452994A CN 201910790453 A CN201910790453 A CN 201910790453A CN 110452994 A CN110452994 A CN 110452994A
- Authority
- CN
- China
- Prior art keywords
- seq
- nucleotide sequence
- detected
- primer
- ingredient
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides one group of primer pair for ten kinds of animal source components of synchronous detection, probe and liquid phase genetic chip method, donkey can be detected simultaneously, chicken, ox, deer, dog, fox, horse, mink, ten kinds of animal derived materials of pig and sheep, 10 pairs of animal derived materials specific primers and 10 specific probes have been screened in design altogether, the PCR heavy reaction system of asymmetry ten of optimization, PCR amplification condition and suspended microspheres hybridization check condition, it may be implemented simultaneously to donkey in food and feed, chicken, ox, deer, dog, fox, horse, mink, totally ten kinds of animal derived materials carry out Testing and appraisal for pig and sheep, this method has easy to operate, flux is high, high sensitivity, the advantages that specificity is good and at low cost.
Description
Technical field
The invention belongs to meat products and animalsderived feedstuffs detection field, specifically, a kind of synchronous detection donkey, chicken, ox,
Deer, dog, fox, horse, mink, ten kinds of animal source components of pig and sheep chip method.
Background technique
Animal source component true and false detection and identification is food and feeding quality security-critical content, to maintenance people's health peace
Entirely, safeguard that economic order and social stability, import and export food and feed supervision all have significance.In recent years, domestic ectosarc
Class product adulteration violation criminal offence is exposed repeatly, and such as domestic certain illegal businessman use low value species meat such as duck
The incorporations such as meat, pork even fox meat, mink meat even pretend to be the beef or mutton product of high value, and pigment, essence is excessively added
Equal impurity.In January, 2013, " horseflesh disturbance " event influence European 16 states, force European Union examine again its food tracing system and
Labeling system, and promptly put into effect measure and member state is required to reinforce DNA sampling observation to the beef product of market circulation.Animal source component inspection
Surveying identification is also feed safety important content, is related to transmissible spongiform encephalopathy (TSE), African swine fever, highly pathogenic bird flu
Etc. great control and prevention of disease.It has been prevention and control rabid ox disease, the successive statute of countries in the world man since rabid ox disease occurs for Europe in 1987
It restrains, regulation, the use of animal derived materials in strict control feed；China to from " non-rabid ox disease risk negligible " country and
The feeding animal product in area provides against source containing ruminant (ox, sheep, deer etc.) ingredient.For preventing and treating highly pathogenic avian influenza,
Other great animal epidemics such as African swine fever, aftosa, various countries have also formulated the ban for particular animals derived components in feed.
The Testing and appraisal technology of animal source component is based primarily upon DNA and protein analysis two major classes are other, and there are also a few studies
Using the analytical technology based on fatty acid molecule the Nomenclature Composition and Structure of Complexes difference.Since protein can during food and feed processing
It can be destroyed, therefore the application based on protein analysis technology is more rare.Mainly use DNA analysis technology both at home and abroad at present
Testing and appraisal animal source component.DNA molecular carries animal species specific genetic information, is highly suitable as the detection of species identification
Target spot；DNA thermal stability is good, and the core for retaining small fragment is remained in the hot-working of food and feed preparation, HIGH PRESSURE TREATMENT
Acid molecule is for analyzing.The continuous development of based on PCR technology only needs the DNA fragmentation of trace to can be achieved with the detection of target at present.
So far, the research application applied to animal source component DNA analysis technology carried out both at home and abroad can be summarized as following several
Seed type:
1) detection technique of based on PCR amplification.Including PCR, PCR-RFLP, PCR-RAPD, PCR-AFLP, PCR-SSCP and
Real-time fluorescent PCR technology etc..Conventional round pcr is due to that need to prolong amplified production progress electrophoresis or sequencing analysis, detection time
It is long, cumbersome and easily cause and pollution of nucleic acid and cause false positive reaction, although in the side for establishing many based on PCR in early days
Method, but at present using relatively small.The real-time fluorescent PCR technology technology developed in recent years significantly improves detection speed, detection
Sensitivity and specificity, but its testing cost (including equipment and reagent) is higher, especially multiple PCR method.It is multiple glimmering in real time
Light PCR cannot solve fluorescence signal cross jamming and instrument due to existing equipment platform and alternative fluorescent dye very well
Device differentiates sensitivity differences problem to different fluorophors, often compares monocolor method for mixing positive template, its detection sensitivity
It decreased significantly, signal cross often occur between different sense channels.
2) conventional solid biochip technology.The biochip technology of based on PCR combined DNA hybridization, which has been shown in, is applied to detection
Identify many animals kind ingredient, Europe has developed meat gene microarray analysis kit, can screening 8-14 kind animal species.It is above-mentioned
Research is conventional solid biochip technology, using chip carrier (silicon wafer, optics load sheet glass, cellulose of stock size
Film, nylon membrane etc.) be used as solid-phase matrix carrier, be capable of providing high-throughput detection, but the disadvantage is that need point sample instrument, hybridization instrument,
A variety of special equipments such as scanner, at high cost and cumbersome, interfere factor more, detection stability, repeatability effect
Fruit is undesirable, influences clinical application.
3) loop-mediated isothermal amplification technique.Seen both at home and abroad using LAMP technology detection and identification animal source component, but studied
It reports and few.LAMP technology is a kind of isothermal amplification method, controls equipment such as PCR amplification instrument without alternating temperature, suitable base answers
With.But this method has apparent limitation, is not suitable for carrying out long-chain DNA cloning, is not suitable for establishing multiple detection method, amplification produces
Object cannot be directly used to subsequent analysis, and be also easy to produce false positive reaction.
In addition, the new technology that digital pcr technology, biosensor etc. emerge in large numbers in recent years also starts applied to animal source component
Detection and identification research.But due to equipment valuableness, technical requirements height, technology are also immature etc., these new technologies are also main at present
It is in the laboratory research stage.
Summary of the invention
To solve the above-mentioned problems, the purpose of the present invention is to provide one group for ten kinds of animal derived materials of synchronous detection
Primer pair, this ten kinds of animal derived materials refer to donkey, chicken, ox, deer, dog, fox, horse, mink, pig and sheep.
Second object of the present invention be to provide one group for synchronization detect the probes of ten kinds of animal derived materials.
Third object of the present invention is that providing one synchronizes the method for detecting ten kinds of animal derived materials, and this method is adopted
With xMAP liquid-phase chip technology principle, 96 samples can be disposably detected, have quick, flux height, specificity good and sensitive
Spend the advantages that high.
To achieve the goals above, the present invention provides one group of primer pair for ten kinds of animal source components of synchronous detection, by
Following sequence compositions:
The special primer pair of donkey ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.1:
GCTCAACGTCACACATA；The nucleotide sequence of downstream primer is as shown in SEQ ID No.2:
GGTTAACAATAGTCTAAATAGA；
The primer pair of chicken ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.3:
CTAACAGGAATCGTCCTTGC；The nucleotide sequence of downstream primer is as shown in SEQ ID No.4:
GTGAATCCTGCTAGGATGGC；
The primer pair of Niu Chengfen is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.5:
GCTACATTCTCTACACCAAGA；The nucleotide sequence of downstream primer is as shown in SEQ ID No.6:
TAGTGCGTTTAAATAGGG；
The primer pair of deer ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.7:
CCAGTTGAATACCCCTTTA；The nucleotide sequence of downstream primer is as shown in SEQ ID No.8: TTAGGAGGTTGTTTTCG；
The primer pair of dog ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.9:
AACTTCGGATCCTTAC；The nucleotide sequence of downstream primer is as shown in SEQ ID No.10: CATTTGCGTGCATATAG；
The primer pair of fox ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.11:
GTGCATTACTGCTATG；The nucleotide sequence of downstream primer is as shown in SEQ ID No.12: ACGTGCAGTCATGTATG；
The primer pair of horse ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.13:
CACACCCAGAAGTAAAGAC；The nucleotide sequence of downstream primer is as shown in SEQ ID No.14:
GGGAAACATGATGATCAGA；
The primer pair of mink ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.15:
AACCAAGAACATACTCAC；The nucleotide sequence of downstream primer is as shown in SEQ ID No.16: CTTATCTCCTCTTGCCTT；
The primer pair of pig ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.17:
AGCCTAACTTACACTAA, the nucleotide sequence of downstream primer is as shown in SEQ ID No.18: GTGGTAGATTGGCGTAA；
The primer pair of sheep ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.19:
ATTTCCTYATCATTCTAGTCAT；The nucleotide sequence of downstream primer is as shown in SEQ ID No.20:
AAGACCAGTRTATTGATTGT；
5 ' end label biotins of all downstream primers, Y, C/T degeneracy；R, A/G degeneracy.
The present invention also provides the probes that one group is used to detect ten kinds of animal source components, are made of following sequence:
The specific probe of donkey ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.21:
CCAATAATAGACTCAGACTAACT；
The specific probe of chicken ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.22:
GTAGTCGCCCACTTCCACTA；
The specific probe of Niu Chengfen is detected, nucleotide sequence is respectively as shown in SEQ ID No.23:
AGCACGAAAGTTATTATGAAA；
The specific probe of deer ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.24:
ATACCGATCACCAGCACAA；
The specific probe of dog ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.25:
CACTATACATCGGACACAGC；
The specific probe of fox ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.26: GACATRCTA+
TGTTTA+ATCTTACA；
The specific probe of horse ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.27:
ATAACAAAACACTCTGCCCC；
The specific probe of mink ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.28:
CTCAAGCAACTCATCCAAA；
The specific probe of pig ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.29:
AAACACTTACTTAAATACGTGCTAC；
The specific probe of sheep ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.30:
ACCTCCTAAAATGAAGACA；
5 ' end C12 of all probes mark amino, R, A/G degeneracy；+ T ,+A are LNA base.
The present invention also provides a kind of for the synchronous method for detecting ten kinds of animal source components of detection, comprising the following steps:
(1) nucleic acid extraction of sample；
(2) asymmetric multiplexed PCR amplification is carried out to sample nucleic using above-mentioned primer pair；
(3) above-mentioned probe is coupled to respectively on the polystyrene latex microballoon with COOH；
(4) asymmetry of polystyrene latex microballoon after probe conjugate that step (3) obtains obtained with step (2) is more
The product of weight PCR amplification carries out hybridization reaction；
(5) after completing hybridization reaction, 1 × TMAC solution, 13000rpm centrifugation 4 are added in each hybridization reaction product tube
Minute, careful inhale abandons supernatant, collects microballoon precipitating, and then similarity condition repeated washing microballoon precipitates 1-2 times；
(6) SAPE is diluted to 3.3 μ g/mL with 1 × TMAC solution, TMAC-SAPE report liquid is made；
(7) TMAC-SAPE that 75 μ L are added in every pipe microballoon precipitating reports liquid, and oscillation mixes, and sets constant temperature blending instrument, 58 DEG C of temperature
6min is educated, hunting speed is set during incubation as 300rpm；
(8) MFI value is detected with liquid-phase chip instrument, according to the background values of detection, determines testing result；
Wherein, the setting of the background values: synchronous parallel sets 3 blank controls and carries out above-mentioned steps (2) and step (3)
Reaction, wherein the blank control be with water replace sample to be tested template, remaining agent formulations and reaction condition are constant；It calculates
The average value of the MFI value of 3 blank controls, as background values；Result judgement: when the MFI value of test sample is greater than 5 times of background values
When, it is judged to the positive, is otherwise judged to feminine gender.
Wherein, step (2) the asymmetric multi-PRC reaction amplification system are as follows: such as SEQ containing sequence in 40 μ L reaction systems
ID No.1、SEQ ID No.2、SEQ ID No.3、SEQ ID No.4、SEQ ID No.5、SEQ ID No.6、SEQ ID
No.7、SEQ ID No.8、SEQ ID No.9、SEQ ID No.10、SEQ ID No.11、SEQ ID No.12、SEQ ID
No.13、SEQ ID No.14、SEQ ID No.15、SEQ ID No.16、SEQ ID No.17、SEQ ID No.18、SEQ ID
Sequence shown in No.19 and SEQ ID No.20, primer final concentration are respectively 0.024 μm of ol/L, 0.08 μm of ol/L, 0.02 μm of ol/
L、0.07μmol/L、0.08μmol/L、0.4μmol/L、0.04μmol/L、0.1μmol/L、0.08μmol/L、0.24μmol/L、
0.07μmol/L、0.14μmol/L、0.008μmol/L、0.03μmol/L、0.024μmol/L、0.08μmol/L、0.02μmol/
L, 0.08 μm of ol/L, 0.08 μm of ol/L and 0.4 μm of ol/L；Mg2+The final concentration of 200 μm of ol/ of final concentration of 3.0mmol/L, dNTP
L, 10 × PCR buffer 5 μ L, Taq polymerase dosage 1-2unit, 5 μ L of template；Pcr amplification reaction condition is such as are as follows: 95 DEG C of pre- changes
Property 5 minutes；First stage circular response: 95 DEG C are denaturalized 5 seconds, and 53 DEG C are annealed 10 seconds, and 72 DEG C extend 12 seconds, carry out 32 altogether and follow
Ring；Last 72 DEG C extend 2 minutes.
Wherein, step (3) described hybridization reaction includes the following steps: that microballoon is diluted to microballoon work with 1.5 × TMAC by a.
Make liquid, dispenses 33 μ L/ pipe of microballoon working solution into PCR pipe, microballoon number contains every kind probe conjugate microballoon 400 or more up to every pipe；
B. 5 μ L-10 μ L PCR products are added in each PCR pipe pipe, add 1 × TE (PH8.0) to total volume be 50 μ L, vortex oscillation at full speed
Concussion 30 seconds；C. PCR pipe is put into PCR instrument, hybridization reaction, hybridization reaction condition is carried out in PCR instrument are as follows: 95 DEG C are denaturalized 5 points
Clock, 58 DEG C hybridization reaction 20 minutes, 4 DEG C stop.
The beneficial effects of the present invention are:
The present invention provides one group for synchronous detection donkey, chicken, ox, deer, dog, fox, horse, ten kinds of mink, pig and sheep animals
Primer pair, probe and the detection method of derived components can be used in detecting ten kinds of animal source components simultaneously, distinguish to reach identification
The purpose of other species.The present invention compared to single species detection method or several species multiple detection method, once managing
The PCR amplification of 10 kinds of animal source components can be completed, cost at least reduces 30%-90%, while when significantly reducing detection
Between, save human resources and reagent cost.
Specific embodiment
Liquid-phase chip technology is that one kind that Luminex company, the mid-term the 1990s U.S. develops has multi objective same
The Novel biological chip technology of step analysis (flexible Multi-Analyte Profiling, xMAP) function, it is also referred to as micro-
It is only 5.6 μ that ball Suspension array technique, which is using using diameter with the main distinction of the conventional solid chip technology in terms of material,
The polystyrene latex microballoon of M is as matrix, so that reaction system is changed by traditional liquid-solid reaction close to biology department
The liquid-phase reaction system for internal environment of uniting, significantly improves reaction efficiency.XMAP liquid-phase chip technology being capable of high-throughput detection core
The large biological molecules such as acid, albumen, detection speed, specificity and the equal beyond tradition chip technology of sensibility have efficiently, fastly
Speed, stablize, be accurate, can synchronize, is reproducible, strong antijamming capability the advantages that.XMAP liquid phase genetic chip detects whole process
Multiple nucleic acid amplification, multiple microballoon suspension hybridization, fluorescence developing reaction and the several steps of signal detection, can continuous automatic inspection 96
A sample passes through the automatic detection more Multi-example of connecting programming, and the upper machine testing time of each sample is according to the quantity for detecting target
(substance or multiple) only need more than ten seconds to a few minutes, easy grasp easy to operate.XMAP liquid-phase chip technology can be detected from synchronous
High-throughput quickly detection is embodied in terms of target quantity and automatic detection sample size two, is a kind of high suitable clinic of cost performance
The technology of application.
According to the requirement that inspection and quarantine works, we select donkey, chicken, ox, deer, dog, fox, horse, mink, pig and 10 kinds of sheep
Animal source component synchronizes detection.
The present invention is significantly mentioned for common animals species detection and identification demand in the animal-derived foods such as meat products and feed
The efficiency of high detection identification simultaneously reduces cost, is that food and feeding quality check on, hit manufacturing and marketing the fake behavior and inlet and outlet prison
Pipe work provides important technology support, to promote supervision efficiency, more preferable protection consumers' rights and interests and healthy and safe, and promotes to eat
Product, agricultural product produce and process and the sound development of feed industry.The present invention establishes one kind and is based on by many experiments, verifying
The ten heavy-fluid phase genes of Luminex xMAP (Multi-Analyte Profile) polystyrene microsphere Suspension array technique principle
Chip method realizes synchronous detection donkey, chicken, ox, deer, dog, fox, horse, ten kinds of mink, pig and sheep animal source components.
In order to realize while be detected to ten kinds of animal source components, it is necessary to assure draw used by ten kinds of animal source components
The PCR amplification specificity of object pair is good, nothing but specific PCR amplified production, while the hybrid specificities of probe and amplified production are strong,
Cross reaction is not present in different probes and PCR product between each other, otherwise, is easy to appear false positive results.We are designing
The mitochondria related gene sequence of hundreds of animal source components is downloaded when primer and probe from NCBI first, then by a large amount of
Bioinformatic analysis compare, finally have chosen the specific target gene of ten kinds of animal derived materials, then on this basis
The design of primer and probe is carried out.The design of primer and probe has followed stringent specificity and conservative, and primer can only expand
Increase the nucleic acid of corresponding species, probe can only hybridize with the PCR product of corresponding species, and the specificity of probe and primer passes through
Base sequence and its solution temperature strict control.Simultaneously in order to avoid ten weight PCR generations to be formed due to being mutually paired between primer
Primer dimer, we will also carry out sequence alignment in design primer, avoid forming primer dimer during PCR, and be
The specificity of the certain primer and probes of raising, we also introduce degeneracy base and lock nucleic acid modified base in the sequence.For
The method that the present invention describes is established, we filter out most special primer and probe firstly the need of a large amount of positive sample, so
The optimization for carrying out non-ten heavy asymmetric pcr reaction conditions on this basis again afterwards, finally filters out optimal through a large number of experiments
Primer, concentration and probe concentration and PCR reaction system and hybridization system.
The present invention provide it is a kind of for detect realize synchronous detection donkey, chicken, ox, deer, dog, fox, horse, mink, pig and
The nucleic acid chip method of ten kinds of animal source components of sheep detection, this method comprises: the nucleic acid extraction in (1) sample；(2) not right
Claim ten heavy PCR amplifications；(3) ten heavy xMAP microballoon suspension genetic chip (liquid phase genetic chip) detections.
This method have quickly, high-throughput, specific good, high sensitivity and the advantages such as at low cost.
In order to preferably explain the present invention, in order to understand, below by specific embodiment, present invention work is retouched in detail
It states.
The design and preparation of 1 primer of embodiment and probe
Mitochondrial genomes sequence is conservative in kind more control sequences, is highly suitable for the identification of animal source component, because
This firstly the need of filter out detection donkey, chicken, ox, deer, dog, fox, horse, mink, ten kinds of animal source components of pig and sheep special mesh
Mark gene.Download 100 left sides of mitochondrial genomes sequence of ten kinds of animal source components respectively from GenBank database first
Then the right side carries out Multiple Sequence Alignment analysis using bioinformatics software respectively, choose the good conserved region sequence of specificity, then will
This sequence carries out the comparison between kind, has finally filtered out the target gene for the detection of ten kinds of animal derived materials respectively.Wherein
Dog, deer and sheep choose cytochrome b as target gene；Pig and fox choose D-Loop as target gene；Chicken and mink choose 12s
RRNA is as target gene；Donkey, horse and ox choose 16S rRNA, ATP synzyme F0 subunit and 28s rRNA as target gene respectively.
PCR design is carried out using Array Designer 4.0 and DNAMAN 7 auxiliary, and the principle of design primer mainly has
The end primer 3' and its purpose species target gene for ensuring every kind of animal derived materials can exactly match, and the sequence with other species
At least there is 2 or more mismatches, and primer sequence is short as far as possible, so that PCR is in rigorously control annealing temperature
Under conditions of, can only specificity amplification the purpose species gene order.In addition, ten kinds of animal derived materials PCR specificity
The annealing temperature of primer is almost the same, therefore can use identical PCR amplification condition.And the design of hybridization probe is also to protect first
It demonstrate,proves it to exactly match with such animal derived materials sequence, and has at least 2 in the intermediate of probe with other animal derived materials
A above mismatch, to ensure that the specificity of hybridization probe, and when designing ten kinds of animal derived materials it is special miscellaneous
It hands over the annealing temperature of probe almost the same, can thus use same hybridization check condition.Incorporation lock core in probe sequence
The annealing temperature and specificity of probe can be improved in acid, we introduce lock nucleic acid modification during designing fox probe.
According to above-mentioned design principle, donkey, chicken, ox, deer, dog, fox, horse, mink, pig and ten kinds of sheep are separately designed out by sequence analysis
The special primer sequence of animal source component and hybridization probe sequence, using NCBI Blast on-line analysis software (http: //
Www.ncbi.nlm.nih.gov/blast) probe to quasi- selection and primer combination carry out sequence homology and suitability analysis
Assessment, and by many experiments test, it finally screens and determines donkey, chicken, ox, deer, dog, fox, horse, mink, pig and ten kinds of sheep
The primer and hybridization probe of animal source component, wherein the hybridization probe of fox introduces two lock nucleic acids, all animal derived materials
PCR primer and hybridization probe sequence as shown in tables 1 and 2, in primer all downstream primers 5 ' end label biotins, probe
5 ' end C12 mark amino, wherein+the T in fox hybridization probe and+A indicate lock nucleic acid.
1 PCR primer of table composition and concentration
Note: Y, C/T degeneracy；R, A/G degeneracy；The end of downstream primer 5 ' uses biotin labeling.
2 hybridization probe sequence of table
| Species name | Primer | Primer sequence |
| Donkey | SEQ ID No.21 | CCAATAATAGACTCAGACTAACT |
| Chicken | SEQ ID No.22 | GTAGTCGCCCACTTCCACTA |
| Ox | SEQ ID No.23 | AGCACGAAAGTTATTATGAAA |
| Deer | SEQ ID No.24 | ATACCGATCACCAGCACAA |
| Dog | SEQ ID No.25 | CACTATACATCGGACACAGC |
| Fox | SEQ ID No.26 | GACATRCTA+TGTTTA+ATCTTACA |
| Horse | SEQ ID No.27 | ATAACAAAACACTCTGCCCC |
| Mink | SEQ ID No.28 | CTCAAGCAACTCATCCAAA |
| Pig | SEQ ID No.29 | AAACACTTACTTAAATACGTGCTAC |
| Sheep | SEQ ID No.30 | ACCTCCTAAAATGAAGACA |
Note: R, A/G degeneracy；+ T ,+A are LNA base, 5 ' end label amino.
The foundation and optimization of 2 liquid-phase chip detection method of embodiment
It is provided by the invention including donkey, chicken, ox, deer, dog, fox, horse, mink, ten kinds of animal source components of pig and sheep liquid
Phase chip detecting method mainly includes nucleic acid extraction, the amplification of multiplex PCR asymmetry and three steps of microballoon hybridization check.Its center
Acid, which extracts, can use commercialized nucleic acid extraction kit, such as the nucleic acid extraction kit of QIAGEN company.Therefore asymmetric
The foundation and optimization of multiplexed PCR amplification and microballoon hybridizing method are crucial.
1, asymmetric multiplexed PCR amplification, the mainly sequence of optimizational primer and dosage, PCR reaction system and amplification item
Part.Pass through optimization, Taq and the Mg of sequence screening, primer concentration to primer2+The optimization of concentration and annealing temperature and time
Screening, we establish optimal the PCR heavy reaction system of asymmetry ten and PCR amplification condition, the PCR reaction system after optimization with
PCR amplification condition difference is as shown in Table 3 and Table 4.
PCR reaction system after the optimization of table 3
PCR amplification condition after the optimization of table 4
2, microballoon hybridizes, be substantially carried out hybridization temperature and time, wash conditions and SAPE report liquid working concentration and when
Between optimal parameter grope.The technical experience of people and a large amount of Comparability test according to the present invention, establish optimal hybridization reaction
Condition, progress specific as follows:
1) oligonucleotide probe with amino is coupled to the polystyrene latex microballoon with COOH.
As shown in Table 2 ten kinds of oligonucleotide probes are coupled to respectively on different coding microballoon, sequence is respectively such as SEQ
ID No.21、SEQ ID No.22、SEQ ID No.23、SEQ ID No.24、SEQ ID No.25、SEQ ID No.26、SEQ
ID No.27, SEQ ID No.28, shown in SEQ ID No.29 and SEQ ID No.30,5 ' end label amino, wherein fox is miscellaneous
+ T and+A in probe is handed over to indicate lock nucleic acid.
The step for by Luminex company provide standardization program carry out probe conjugate, the microballoon for being coupled probe can be 4
It DEG C saves 1 year or more, can take out at any time and carry out subsequent microballoon hybridization check.
2) ten heavy microballoon suspension hybridization checks are carried out to above-mentioned ten weights asymmetric PCR amplified production.
Main process includes: to prepare ten kinds of coupling microballoon mixed liquors, the above-mentioned pcr amplification product of 5-10 μ L is added, in PCR
Hybridization reaction is carried out by the microballoon hybridization reaction condition of following optimization on instrument；After reaction, TMAC-SAPE is added and reports liquid,
It incubates.
The microballoon hybridization reaction condition of optimization is as follows:
A. with 1.5 × tetramethyl-ammonium chloride (Tetramethylammonium chloride, TMAC) buffer that microballoon is dilute
It is interpreted into microballoon working solution, 33 μ L/ pipe of microballoon working solution is dispensed into PCR pipe, has been coupled different general probes comprising above-mentioned 10 kinds
Microballoon, microballoon number up to every pipe contain every kind probe conjugate microballoon 400 or more；
B. 10 μ L PCR products are added in every pipe, add 1 × TE (PH8.0) to total volume be 50 μ L, vortex oscillation at full speed shake
It swings 30 seconds, carries out hybridization reaction by following condition；
C. PCR pipe is put into PCR instrument, hybridization reaction, hybridization reaction condition is carried out in PCR instrument are as follows: 95 DEG C are denaturalized 5 points
Clock, 58 DEG C hybridization reaction 20 minutes, 4 DEG C stop；
D. hybridization reaction terminates, and takes out reaction tube, and every pipe is added 100 μ L 1 × TMAC solution and then sets centrifuge,
13000rpm is centrifuged 4 minutes, and careful inhale abandons supernatant, collects microballoon precipitating；
F. microballoon being washed 1-2 times with 1 × TMAC, 100 μ 1 × TMAC of L being added every time, oscillation mixes, 13000rpm centrifugation 4
Minute, careful inhale abandons supernatant；Simultaneously with 1 × TMAC by streptavidin phycoerythrin (Streptavidin-phycoerythrin,
SAPE 3.3 μ g/mL) are diluted to, TMAC-SAPE is prepared and reports liquid；
G. in every pipe microballoon precipitating, the TMAC-SAPE that 75 μ L are added reports liquid, and oscillation mixes；
H. constant temperature blending instrument is set, 58 DEG C of incubation 6min set hunting speed as 300rpm during incubation；
I. machine testing on: the microballoon reaction solution of above-mentioned hybridization reaction is taken into, with LuminexTM 200system liquid phase core
Piece instrument or other equivalent of the apparatus measure MFI value.
G. the judgement of testing result
The measurement of g-1 background values: detecting every time while setting 3 blank control samples, synchronous to blank control sample to carry out
Asymmetric ten weight PCR amplifications and ten weight microballoons suspend and hybridize, and in blank sample reaction system, replace core with amplified reaction water
Acid template, remaining agent formulations are consistent with reaction condition with test sample；The MFI value average value of 3 blank control samples is calculated,
As background values；
G-2 result judgement: the MFI value for setting test sample is greater than 5 times of background values as decision threshold；Test sample testing result
Reach decision threshold and be judged to the positive, is otherwise judged to feminine gender.
The sensitivity and specificity of 30 heavy-fluid phase method for gene chip of embodiment are tested
1, sensitivity test
Using the ten heavy-fluid phase method for gene chip established in the embodiment of the present invention 2 to donkey, chicken, ox, deer, dog, fox,
Horse, mink, ten kinds of animal derived materials samples of pig and sheep genomic nucleic acids carried out sensitivity technique respectively, testing result is detailed
It see the table below 5.
5 sensitivity test result of table
Remarks: 1, chicken is the mixed in equal amounts of Cold boiled chicken, Gallus domesticlus brisson and turkey genomic DNA；2, ox is yak, buffalo and ox base
Because of the mixed in equal amounts of group DNA；3, sheep is the mixed in equal amounts of sheep and goat genomic DNA.
As can be seen from Table 5, ten heavy-fluid phase method for gene chip provided by the present application all has this ten kinds of animals bright
The aobvious MFI value greater than threshold value illustrates that the ten heavy-fluid phase method for gene chip has sufficiently high sensitivity for above-mentioned animal.
2, specific test
Using the ten heavy-fluid phase method for gene chip established in the embodiment of the present invention 2 to the raw meat of donkey, 15 kinds of positive species
Sample (ox, buffalo, yak, goat, sheep, horse, deer, donkey, dog, pig, fox, mink, Cold boiled chicken, Gallus domesticlus brisson, turkey) and 3 kinds
The standard substance of positive species has carried out specific detection respectively, and detailed testing result is detailed in the following table 6.
6 specific test result of table
Remarks: 1, shellfish sample mixing is scallop, clam and the meat tissue as pulling out freshwater mussel；2, plant protein powder is soybean, wheat and
Pea protein
As can be seen from Table 6, the ten heavy-fluid phase method for gene chip is for the MFI value of animals showing positive all considerably beyond threshold
Value, and other animals are then lower than threshold value, illustrate the detection specificity for this ten kinds of animals of detection method provided by the invention
It is high.
Detection of the embodiment 4 to clinical sample
Using the ten heavy-fluid phase method for gene chip established in the embodiment of the present invention 2 to 55 parts of Feed Samples to commercialization
It is detected with 69 parts of meat products, shares 38 parts of sample detection results as the result is shown and label ingredient is inconsistent: 55 parts of feed samples
Have 19 parts of samples not exactly the same with the ingredient that is marked in product, have in 69 parts of meat products 19 parts of samples with the ingredient that is marked not
It is identical.To above-mentioned 38 parts of samples, we are further detected with following current standard detection method: where cattle and sheep at
Divide and is verified with regular-PCR method in existing national standard GB/T20190-2006；The existing professional standard SN/ of chicken derived component
Regular-PCR method is verified in T2978-2011；Fluorescence of the pig derived component in existing professional standard SN/T2051-2008
PCR method is verified.Testing result is shown in Table 7.
7 clinical sample of table detection and with the inconsistent situation of label ingredient
As shown in table 7, in above-mentioned 38 parts of samples, using standard method to the testing result and the method for the present invention of 37 parts of samples
Testing result it is consistent, only 1 part of sample fails to detect chicken ingredient using standard method, this may be because of the method for the present invention pair
The detection limit of chicken ingredient is higher than the sensitivity of standard method (for 0.1%).Situation is compared according to the detection method to clinical sample,
Absolutely prove that the method for the present invention is genuine and believable, sensitivity is higher.
Regular-PCR method in current standard, which usually requires 3-4h, to obtain a result, and fluorescent PCR method, which usually requires 2h, to be obtained
As a result.But when existing simultaneously two kinds or more of animal derived materials in sample, every part of sample then needs to carry out at least 2 times
Or more reaction, therefore at least need 4-6h that can just obtain a result, and the 10 heavy xMAP methods that this research institute establishes, utilize one
A reaction can 10 kinds of animal derived materials information in Testing and appraisal sample simultaneously, and can be completed in 3h.
Show ten heavy-fluid phase provided by the invention using testing result of the method for the present invention to above-mentioned 124 parts of clinical samples
Method for gene chip can efficiently and accurately detection food and feed in various animal derived materials, can precisely identify adulterated in product
Fraud animal source component can be applied to food and check on feeding quality supervision.
It is essentially all substance PCR and duplex PCR relative to common national standard or other multiple PCR methods, and in reality
Such as detection feed and food adulteration in, need to detect many animals derived component, adulterated to determine whether, adulterated which kind of is dynamic
Material resource ingredient, and substance PCR and duplex PCR when detecting many animals derived component or require a great deal of time and want
It needs to purchase a large amount of PCR equipment, and hits manufacturing and marketing the fake now and Management task is heavy, need cost more
Low, faster, precision higher carries out the detection of animal derived materials to speed, this provides higher requirement for supervision department.
The present invention provides primer system, probe and the detection method of ten kinds of animal source components of synchronous detection, can detect simultaneously
Ten kinds of donkey, chicken, ox, deer, dog, fox, horse, mink, pig and sheep animal components, can disposably detect 96 samples, have fast
The advantages that speed, flux are high, specificity is good and high sensitivity.
SEQUENCE LISTING
<110>national health health committee Institute Of Science And Technology
Guangzhou customs technique center
<120>primer pair, probe and the method for ten kinds of animal source components of synchronous detection
<160> 30
<170> PatentIn version 3.3
<210> 1
<211> 17
<212> DNA
<213>artificial sequence
<400> 1
gctcaacgtc acacata 17
<210> 2
<211> 22
<212> DNA
<213>artificial sequence
<400> 2
ggttaacaat agtctaaata ga 22
<210> 3
<211> 20
<212> DNA
<213>artificial sequence
<400> 3
ctaacaggaa tcgtccttgc 20
<210> 4
<211> 20
<212> DNA
<213>artificial sequence
<400> 4
gtgaatcctg ctaggatggc 20
<210> 5
<211> 21
<212> DNA
<213>artificial sequence
<400> 5
gctacattct ctacaccaag a 21
<210> 6
<211> 18
<212> DNA
<213>artificial sequence
<400> 6
tagtgcgttt aaataggg 18
<210> 7
<211> 19
<212> DNA
<213>artificial sequence
<400> 7
ccagttgaat accccttta 19
<210> 8
<211> 17
<212> DNA
<213>artificial sequence
<400> 8
ttaggaggtt gttttcg 17
<210> 9
<211> 16
<212> DNA
<213>artificial sequence
<400> 9
aacttcggat ccttac 16
<210> 10
<211> 17
<212> DNA
<213>artificial sequence
<400> 10
catttgcgtg catatag 17
<210> 11
<211> 16
<212> DNA
<213>artificial sequence
<400> 11
gtgcattact gctatg 16
<210> 12
<211> 17
<212> DNA
<213>artificial sequence
<400> 12
acgtgcagtc atgtatg 17
<210> 13
<211> 19
<212> DNA
<213>artificial sequence
<400> 13
cacacccaga agtaaagac 19
<210> 14
<211> 19
<212> DNA
<213>artificial sequence
<400> 14
gggaaacatg atgatcaga 19
<210> 15
<211> 18
<212> DNA
<213>artificial sequence
<400> 15
aaccaagaac atactcac 18
<210> 16
<211> 18
<212> DNA
<213>artificial sequence
<400> 16
cttatctcct cttgcctt 18
<210> 17
<211> 17
<212> DNA
<213>artificial sequence
<400> 17
agcctaactt acactaa 17
<210> 18
<211> 17
<212> DNA
<213>artificial sequence
<400> 18
gtggtagatt ggcgtaa 17
<210> 19
<211> 22
<212> DNA
<213>artificial sequence
<400> 19
atttcctyat cattctagtc at 22
<210> 20
<211> 20
<212> DNA
<213>artificial sequence
<400> 20
aagaccagtr tattgattgt 20
<210> 21
<211> 23
<212> DNA
<213>artificial sequence
<400> 21
ccaataatag actcagacta act 23
<210> 22
<211> 20
<212> DNA
<213>artificial sequence
<400> 22
gtagtcgccc acttccacta 20
<210> 23
<211> 21
<212> DNA
<213>artificial sequence
<400> 23
agcacgaaag ttattatgaa a 21
<210> 24
<211> 19
<212> DNA
<213>artificial sequence
<400> 24
ataccgatca ccagcacaa 19
<210> 25
<211> 20
<212> DNA
<213>artificial sequence
<400> 25
cactatacat cggacacagc 20
<210> 26
<211> 23
<212> DNA
<213>artificial sequence
<400> 26
gacatrcta+t gttta+atctt aca 23
<210> 27
<211> 20
<212> DNA
<213>artificial sequence
<400> 27
ataacaaaac actctgcccc 20
<210> 28
<211> 19
<212> DNA
<213>artificial sequence
<400> 28
ctcaagcaac tcatccaaa 19
<210> 29
<211> 25
<212> DNA
<213>artificial sequence
<400> 29
aaacacttac ttaaatacgt gctac 25
<210> 30
<211> 19
<212> DNA
<213>artificial sequence
<400> 30
acctcctaaa atgaagaca 19
Claims (5)
1. one group of primer pair for ten kinds of animal source components of synchronous detection, which is characterized in that be made of following sequences:
The special primer pair of donkey ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.1, the core of downstream primer
Nucleotide sequence is as shown in SEQ ID No.2；
The primer pair of chicken ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.3, the nucleotide of downstream primer
Sequence is as shown in SEQ ID No.4；
The primer pair of Niu Chengfen is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.5, the nucleotide of downstream primer
Sequence is as shown in SEQ ID No.6；
The primer pair of deer ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.7, the nucleotide of downstream primer
Sequence is as shown in SEQ ID No.8；
The primer pair of dog ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.9, the nucleotide of downstream primer
Sequence is as shown in SEQ ID No.10；
The primer pair of fox ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.11, the core of downstream primer
Nucleotide sequence is as shown in SEQ ID No.12；
The primer pair of horse ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.13, the nucleosides of downstream primer
Acid sequence is as shown in SEQ ID No.14；
The primer pair of mink ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.15, the core of downstream primer
Nucleotide sequence is as shown in SEQ ID No.16；
The primer pair of pig ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.17, the nucleosides of downstream primer
Acid sequence is as shown in SEQ ID No.18；
The primer pair of sheep ingredient is detected, the nucleotide sequence of upstream primer is as shown in SEQ ID No.19, the nucleosides of downstream primer
Acid sequence is as shown in SEQ ID No.20；
5 ' end label biotins of all downstream primers.
2. one group of probe for ten kinds of animal source components of synchronous detection, which is characterized in that be made of following sequence:
The specific probe of donkey ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.21；
The specific probe of chicken ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.22；
The specific probe of Niu Chengfen is detected, nucleotide sequence is respectively as shown in SEQ ID No.23；
The specific probe of deer ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.24；
The specific probe of dog ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.25；
The specific probe of fox ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.26；
The specific probe of horse ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.27；
The specific probe of mink ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.28；
The specific probe of pig ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.29；
The specific probe of sheep ingredient is detected, nucleotide sequence is respectively as shown in SEQ ID No.30；
5 ' end C12 of all probes mark amino.
3. a kind of method for ten kinds of animal source components of synchronous detection, which comprises the following steps:
(1) nucleic acid extraction of sample；
(2) asymmetric multiplexed PCR amplification is carried out to sample nucleic using primer pair as described in claim 1；
(3) probe as claimed in claim 2 is coupled to respectively on the polystyrene latex microballoon with COOH；
(4) asymmetry of polystyrene latex microballoon after probe conjugate that step (3) obtains obtained with step (2) is multiple
The product of PCR amplification carries out hybridization reaction；
(5) after completing hybridization reaction, 1 × TMAC solution is added in each hybridization reaction product tube, 13000rpm is centrifuged 4 points
Clock, careful inhale abandon supernatant, collect microballoon precipitating, and then similarity condition repeated washing microballoon precipitates 1-2 times；
(6) SAPE is diluted to 3.3 μ g/mL with 1 × TMAC solution, TMAC-SAPE report liquid is made；
(7) TMAC-SAPE that 75 μ L are added in every pipe microballoon precipitating reports liquid, and oscillation mixes, and sets constant temperature blending instrument, 58 DEG C of incubations
6min sets hunting speed as 300rpm during incubation；
(8) MFI value is detected with liquid-phase chip instrument, according to the background values of detection, determines testing result；
Wherein, the setting of the background values: synchronous parallel sets 3 blank controls and carries out the anti-of above-mentioned steps (2) and step (3)
It answers, wherein the blank control is to replace sample to be tested template with water, remaining agent formulations and reaction condition are constant；Calculate 3
The average value of the MFI value of blank control, as background values；Result judgement: when the MFI value of test sample is greater than 5 times of background values,
It is judged to the positive, is otherwise judged to feminine gender.
4. the method as claimed in claim 3 for ten kinds of animal source components of synchronous detection detection, which is characterized in that step
(2) the asymmetric multi-PRC reaction amplification system are as follows: such as SEQ ID No.1, SEQ ID containing sequence in 40 μ L reaction systems
No.2、SEQ ID No.3、SEQ ID No.4、SEQ ID No.5、SEQ ID No.6、SEQ ID No.7、SEQ ID No.8、
SEQ ID No.9、SEQ ID No.10、SEQ ID No.11、SEQ ID No.12、SEQ ID No.13、SEQ ID No.14、
SEQ ID No.15, SEQ ID No.16, SEQ ID No.17, SEQ ID No.18, SEQ ID No.19 and SEQ ID
Sequence shown in No.20, primer final concentration be respectively 0.024 μm of ol/L, 0.08 μm of ol/L, 0.02 μm of ol/L, 0.07 μm of ol/L,
0.08μmol/L、0.4μmol/L、0.04μmol/L、0.1μmol/L、0.08μmol/L、0.24μmol/L、0.07μmol/L、
0.14μmol/L、0.008μmol/L、0.03μmol/L、0.024μmol/L、0.08μmol/L、0.02μmol/L、0.08μmol/
L, 0.08 μm of ol/L and 0.4 μm of ol/L；Mg2+Final concentration of 3.0mmol/L, dNTP final concentration of 200 μm of ol/L, 10 × PCR are slow
Fliud flushing 5 μ L, Taq polymerase dosage 1-2unit, 5 μ L of template；Pcr amplification reaction condition is such as are as follows: 95 DEG C initial denaturation 5 minutes；First
Step cycle reaction: 95 DEG C are denaturalized 5 seconds, and 53 DEG C are annealed 10 seconds, and 72 DEG C extend 12 seconds, carry out 32 circulations altogether；Last 72 DEG C are prolonged
It stretches 2 minutes.
5. the method as claimed in claim 3 for ten kinds of animal source components of synchronous detection detection, which is characterized in that step
(3) hybridization reaction includes the following steps: that microballoon is diluted to microballoon working solution, packing microballoon work with 1.5 × TMAC by a.
For 33 μ L/ pipe of liquid into PCR pipe, microballoon number contains every kind probe conjugate microballoon 400 or more up to every pipe；B. each PCR pipe Guan Zhongjia
Enter 5 μ L-10 μ L PCR products, add 1 × TE (PH8.0) to total volume be 50 μ L, vortex oscillation at full speed concussion 30 seconds；C. by PCR
Pipe is put into PCR instrument, and hybridization reaction, hybridization reaction condition are carried out in PCR instrument are as follows: 95 DEG C are denaturalized 5 minutes, 58 DEG C of hybridization reactions 20
Minute, 4 DEG C of stops.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910790453.1A CN110452994B (en) | 2019-08-26 | 2019-08-26 | Primer pair, probe and method for synchronously detecting ten animal source components |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910790453.1A CN110452994B (en) | 2019-08-26 | 2019-08-26 | Primer pair, probe and method for synchronously detecting ten animal source components |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110452994A true CN110452994A (en) | 2019-11-15 |
| CN110452994B CN110452994B (en) | 2022-06-07 |
Family
ID=68489103
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910790453.1A Active CN110452994B (en) | 2019-08-26 | 2019-08-26 | Primer pair, probe and method for synchronously detecting ten animal source components |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110452994B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006024751A2 (en) * | 2004-07-30 | 2006-03-09 | Universite Claude Bernard Lyon I | Method for the simultaneous detection and identification of different animal or plant species in a sample of organic material |
| CN107400729A (en) * | 2017-09-25 | 2017-11-28 | 山东省食品药品检验研究院 | A kind of kit and detection method for detecting many animals derived component |
| CN108330168A (en) * | 2017-09-22 | 2018-07-27 | 中国肉类食品综合研究中心 | A kind of synchronous primer combination and its application for detecting 14 kinds of animal derived materials in meat or meat products |
| CN109609662A (en) * | 2018-12-30 | 2019-04-12 | 广东出入境检验检疫局检验检疫技术中心 | Synchronous Testing and appraisal birds, fish, ruminant three categories ingredient multiple liquid phase genetic chip nucleic acid and method and kit |
-
2019
- 2019-08-26 CN CN201910790453.1A patent/CN110452994B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006024751A2 (en) * | 2004-07-30 | 2006-03-09 | Universite Claude Bernard Lyon I | Method for the simultaneous detection and identification of different animal or plant species in a sample of organic material |
| CN108330168A (en) * | 2017-09-22 | 2018-07-27 | 中国肉类食品综合研究中心 | A kind of synchronous primer combination and its application for detecting 14 kinds of animal derived materials in meat or meat products |
| CN107400729A (en) * | 2017-09-25 | 2017-11-28 | 山东省食品药品检验研究院 | A kind of kit and detection method for detecting many animals derived component |
| CN109609662A (en) * | 2018-12-30 | 2019-04-12 | 广东出入境检验检疫局检验检疫技术中心 | Synchronous Testing and appraisal birds, fish, ruminant three categories ingredient multiple liquid phase genetic chip nucleic acid and method and kit |
Non-Patent Citations (1)
| Title |
|---|
| MINGZHU MEI等: "Establishment and application of a 10-plex liquid bead array for the simultaneous rapid detection of animal species", 《J SCI FOOD AGRIC》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110452994B (en) | 2022-06-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103757134B (en) | The fluorescence quantitative PCR detection reagent of African swine fever virus, test kit and detection method thereof | |
| CN106244698B (en) | A kind of animal derived materials detection kit | |
| Wang et al. | Rapid visual detection of eight meat species using optical thin-film biosensor chips | |
| CN105755149A (en) | PCR special primer pair for identifying pig-cattle-sheep derived ingredients in livestock and poultry meat based on mitochondrion COI gene, PCR identification method and reagent kit | |
| CN101445831B (en) | FSHR gene mutation detection liquid phase chip and detection method thereof | |
| CN101659996A (en) | Fluorescence PCR detection reagent capable of discriminating source components of ruminant animal, preparation method and application thereof | |
| CN103911447B (en) | Detect plasmodial primer, probe and method | |
| CN106191316B (en) | Multiplex PCR detects seven kinds of diarrhea virus primer sets and kit and its detection method | |
| CN105177150B (en) | A kind of the multiple PCR primer system and detection method of quick detection pig sheep ox animal derived materials | |
| CN105734160A (en) | Primer system for PCR identification on pig, bovine and sheep derived components of livestock and PCR identification method and kit | |
| JP2018531044A (en) | Method for assessing normality of immune repertoire and use thereof | |
| CN1995386A (en) | BCR-ABL gene fluorescence quantitative RT-PCR primer and probe and reagent kit | |
| CN110004250A (en) | A kind of African swine fever virus LAMP visual detection kit | |
| CN106434996A (en) | Kit and method for detecting Acinetobacter baumannii DNA | |
| CN105969859A (en) | Mammary-cancer-susceptible-gene detection chip and preparation method thereof | |
| CN110283936A (en) | A kind of African swine fever virus LAMP-HNB Visual retrieval kit | |
| CN101955994B (en) | Joint detection method and diagnostic kit of NPM1 (Nucleophosmin 1) gene mutation | |
| CN106811514B (en) | Specific real-time fluorescence detection method for biological components in Amydae and kit thereof | |
| CN110373451A (en) | A kind of unicellular gene expression analysis method using the unicellular rna expression of flow cytomery | |
| KR101610134B1 (en) | High sensitive kit for detecting avian influenza viruses, probes and genetic chip therefor, and method for detecting avian influenza viruses using the same | |
| CN105483222A (en) | Duck-derived material droplet type digital PCR (Polymerase Chain Reaction) absolute quantitative detection kit | |
| CN110452994A (en) | Primer pair, probe and method for ten kinds of animal source components of synchronous detection | |
| CN104789692B (en) | A kind of primer sets and kit for differentiating cattle and sheep pig derived component | |
| CN103571945A (en) | Method, primer, probe and kit for screening and identifying BCR-ABL unusual fusion types | |
| CN103911462A (en) | Identification and detection method for yellow fever, Japanese encephalitis, chikungunya fever and west Nile fever, primers and probes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |