CN110373451A - A kind of unicellular gene expression analysis method using the unicellular rna expression of flow cytomery - Google Patents
A kind of unicellular gene expression analysis method using the unicellular rna expression of flow cytomery Download PDFInfo
- Publication number
- CN110373451A CN110373451A CN201910670421.8A CN201910670421A CN110373451A CN 110373451 A CN110373451 A CN 110373451A CN 201910670421 A CN201910670421 A CN 201910670421A CN 110373451 A CN110373451 A CN 110373451A
- Authority
- CN
- China
- Prior art keywords
- cell
- rna
- unicellular
- probe
- rolling circle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of unicellular gene expression analysis methods using the unicellular rna expression of flow cytomery, so that padlock probe or dual link probe is entered in the cell of suspension the target sequence for identifying and hybridizing on its target RNA, rolling circle amplification product will be obtained by rolling circle amplification after probe connection cyclization by ligase；The probe of non-hybridized connection can not be cyclic, therefore does not have amplified production；Rolling circle amplification product hybridizes with the detection probe of fluorescent marker, and extra detection probe is removed by centrifuge washing；The sample prepared can carry out fluorescence signal measurement by flow cytometer, determine expression of the target RNA in unicellular according to measurement fluorescence signal intensity.High integration of the present invention nucleic acid, rolling circle amplification and flow cytometry, realization test and analyze unicellular rna expression on flow cytometer.
Description
Technical field
The invention belongs to rna expression detection technique fields, and in particular to a kind of to utilize the unicellular RNA of flow cytomery
The unicellular gene expression analysis method of expression.
Background technique
Flow Cytometry is a kind of Single cell quantitative analysis and sorting technology carried out using flow cytometer.Conventional
Flow cytometry is mainly used to carry out quantitative analysis to the protein molecular expression on unicellular, and cardinal principle is anti-based on antigen
The specific binding of body detects cell protein expression levels by measuring the fluorescence signal of labelled antibody.By will spectrally
On distinguishing different fluorochrome label to special antibody, different target proteins can be detected simultaneously.Root
According to immunologic method, direct method can be used or indirect method is detected: the former be different proteins correspondence it is special
Different fluorescent dyes is marked on antibody, the latter is then that mark fluorescent contaminates on the antibody of the anti-specific antibody in different plant species source
Material.In general, directly label can be realized more multiple detection.Currently, flow cytometry is from monochromatic or double-colored inspection
The ten colors even more polychrome surveyed till now detects.Different target proteins is analyzed by polychrome detection, it can
Realization more accurately identifies different cell subsets, sorts and functional evaluation etc..Flow cytometry can not only be right
Protein molecule on cell membrane is detected, and can also be detected to intracellular protein.To the albumen on cell membrane
Matter molecule is tested and analyzed to be analyzed as cell membrane immunophenotypic characteristics, is frequently utilized for cell type identification and sorting.However,
And not all cell characteristic albumen is all expressed on cell membrane, therefore being detected for intracellular protein occurs in the later period
Flow cytometry, and become an other important evidence for cell typing and screening.
By above-mentioned it is found that traditional flow cytometry is based primarily upon protein detection and is analyzed cell, sorts.
With deepening continuously for genomics research, those of ordinary skill in the art have known that most sequence is not in genome
Coding protein product, and some gene expression product is the non-coding RNA with biological function.Therefore necessary
The expression product RNA of gene is analyzed.In recent years, with the development of technology, had already appeared using flow cytometer come
Detect the technology of RNA.For example, Thermo Fisher company PrimeFlow outstandingTMIt is a kind of based on bDNA patented technology
Flow cytometer RNA detection technique.Its principle is visited using a pair of " Z " type gene specific oligonucleotides target close to each other
Needle group combination target RNA sequence, later signal pre-amplification probe and multiple amplifying probe molecules successively in conjunction with target RNA, into
Row amplification of signal finally combines the label probe of upper fluorescent dye, can detecte up to 4 kinds of RNA targets by flow cytometer
Mark.FISH-Flow technology is then a kind of flow cytometer RNA detection skill based on single molecular fluorescence in situ hybridization (smFISH)
Art, the principle of the technology are in combination with the target specific probe of about 50 fluorescent markers in target RNA, when these probes are poly-
When collection is on the same target RNA molecule, the effect of signal amplification can be generated, remaining probe not being combined passes through
Centrifuge washing removal is integrated to the fluorescence signal in RNA molecule finally by flow cytomery and realizes to target RNA expression
Detection.
Summary of the invention
The purpose of the present invention is to provide a kind of unicellular gene tables using the unicellular rna expression of flow cytomery
Up to analysis method.
Technical scheme is as follows:
A kind of unicellular gene expression analysis method using the unicellular rna expression of flow cytomery, including it is as follows
Step:
(1) padlock probe or dual link probe are designed according to the target sequence on target RNA and its corresponding rolling circle amplification draws
Object and detection probe, which is marked with can be by the group of flow cytomery；
(2) single cell suspension is made in cell to be measured after cultivation, fixative is added in the single cell suspension, is made to be measured
RNA molecule in cell is fixed；
(3) above-mentioned padlock probe or dual link probe is made to enter step the to be measured intracellular of (2) resulting material, and with to
The target sequence surveyed on intracellular above-mentioned target RNA identifies and hybridizes, and to identify and hybridize with target sequence by DNA ligase
Above-mentioned padlock probe or dual link probe connection cyclization after, in the cell by above-mentioned rolling circle amplification primer progress rolling ring expansion
Increase, obtains rolling circle amplification product；
In this step, it is connection template with RNA, padlock probe is connected by annular DNA point by DNA ligase
Son, and then two sections of probes are joined together to form a longer single stranded DNA to dual link probe, then pass through a cyclic template
The single stranded DNA is connected to become a circular DNA molecule under the action of DNA ligase；If containing target RNA in cell,
Then there is rolling circle amplification product；Conversely, then without rolling circle amplification product；
(4) in the cell, above-mentioned detection probe is hybridized with above-mentioned rolling circle amplification product, extra detection probe is by washing
Removal is washed, sample to be tested is obtained；
(5) above-mentioned sample to be tested is sent into flow cytometer and carries out signal measuring, mesh is determined according to the signal strength of measurement
RNA is marked in intracellular expression to be measured.
In a preferred embodiment of the invention, the target RNA includes the RNA and exogenous base of cell itself
Because of the RNA of portion's expression in the cell.
It is further preferred that the RNA of allogenic gene portion's expression in the cell includes viral RNA and plastid rna.
In a preferred embodiment of the invention, the cell to be measured includes the cell manually cultivated, blood cell
With the cell dissociateed in tissue.
In a preferred embodiment of the invention, described can be fluorophor by the group of flow cytomery.
In a preferred embodiment of the invention, the DNA ligase is Splint R ligase.
The beneficial effects of the present invention are: high integration of the present invention nucleic acid, rolling circle amplification and flow cytometry,
Realization tests and analyzes unicellular rna expression on flow cytometer.
Detailed description of the invention
Fig. 1 is the experimental principle figure of the embodiment of the present invention 1.
Fig. 2 is the experimental result picture of the embodiment of the present invention 1.
Specific embodiment
Technical solution of the present invention is further explained and described below by way of specific embodiment.
Embodiment 1 detects the variation that the induction of K562 cell is CD44mRNA expression before and after macronucleus (MK) cell
The concrete principle of the present embodiment is as shown in Figure 1, specifically comprise the following steps:
(1) K562 cell (contains 10%FBS and dual anti-(100U/mL penicillin G sodium salt, 0.1mg/mL sulfuric acid in RPMI1640
Streptomysin) culture；The cell completed is cultivated, is placed in 1.5mLEP pipe, 1000rpm is centrifuged, supernatant is abandoned, with 500 μ L DEPC-
Cell is resuspended in PBS, obtains K562 cell suspension.
(2) K562 cell is induced to differentiate into megacaryocyte: the suction of above-mentioned K562 cell suspension is placed in 5mL centrifuge tube,
1000rpm, 4min, abandon supernatant, be added DEPC-PBS 1mL blow it is even cleaning one time, be centrifuged 1000rpm, 4min, abandon supernatant, then plus
Enter 1mL culture medium and cell precipitation is resuspended, cell suspension is moved into T25 Tissue Culture Flask, then adds the training of 3-4mL cell into bottle
Base is supported, even cell suspension is blown with liquid-transfering gun, is placed in 37 DEG C of constant temperature cell incubator cultures；It carries out changing liquid processing every about 36h: with shifting
Liquid rifle blows and beats cell suspension repeatedly, and cell suspension is sucked out and is placed in 5mL centrifuge tube, and 1000rpm, 4min abandon supernatant, and DEPC- is added
PBS 1mL is cleaned one time, is centrifuged 1000rpm, 4min, abandons supernatant, adds 1mL cell culture medium and cell precipitation is resuspended, will be thin
Born of the same parents' suspension moves into T25 Tissue Culture Flask, then 3-4mL MK cell culture medium is added into bottle, and it is outstanding to blow even cell with liquid-transfering gun
Liquid is placed in 37 DEG C of constant temperature cell incubator cultures；The cell that culture is completed is taken out after 72h, is placed in 1.5mL EP pipe, is centrifuged
1000rpm abandons supernatant, and cell is resuspended with 500 μ L DEPC-PBS, obtains megacaryocyte suspension.
(3) the fixed permeabilization stage intracellular
1) cell is fixed: above-mentioned megacaryocyte suspension being centrifuged 800g/min, 5min, abandons supernatant, 500 μ L 4% are added
PFA is placed at the uniform velocity rotation blending instrument, room temperature, 20min；
2) cell permeabilization: the resulting material of step 1) is centrifuged 800g/min, 5min, supernatant is abandoned, 300 μ L DEPC- is added
PBST cleans cell precipitation, is repeated 3 times；500 μ L 0.1M HCl are added and are placed at the uniform velocity rotation blending instrument, room temperature, 20min.
(4) probe hybridization and signal amplification
1) the resulting material of step (3) is centrifuged 800g/min, 5min, abandons supernatant, 300 μ L DEPC-PBST cleaning is added
Cell precipitation is repeated 3 times；
2) it is subsequently added into containing 0.1 μM of padlock probe, 1 × Splint R buffer, 1.25U/ μ L Splint R connection
Enzyme, RiboLock RNase Inhibitor 1.25U/ μ L, 0.2 BSA μ g/ μ L, Glycerol 50% (step reaction body
System totally 100 μ L) it is mixed well with cell precipitation, it is placed in and at the uniform velocity rotates blending instrument, 37 DEG C of incubation 4h；(padlock probe sequence: ACT
GTTGATCACTAGCATGATTACTGACTCGCGCTTGGTATAATCGCTTACGATCTTCT TTACACAGCTCCATTGCC,
SEQ ID NO.01)
3) 200 μ L DEPC-PBST are first added, then are centrifuged 800g/min, 5min, abandon supernatant；300 μ L DEPC- are added
PBST cleans cell precipitation, is repeated 2 times；
4) 100 μ L are added and contain 0.5 μM of RCA primer, 2 × SSC, mixed liquor and the cell precipitation of 10%formamide is filled
Divide and mix, is placed at the uniform velocity rotation blending instrument, room temperature and hatches 1h；(RCA primer: AGCGATTATACCAAGCGCGA, SEQ ID
NO.02)
5) 200 μ L DEPC-PBST are first added, then are centrifuged 800g/min, 5min, abandon supernatant；300 μ L DEPC- are added
PBST cleans cell precipitation, is repeated 2 times；
6) it is final concentration of that 100 μ L are addedBuffer, 5% glycerol, 1mMdNTP, 0.2 μ g/ μ LBSA,
Rolling circle amplification reaction solution and the cell precipitation of Polymerase mixes well, and is placed at the uniform velocity rotation blending instrument, 37 DEG C, incubates overnight
Change；
7) 200 μ L DEPC-PBST are first added, then are centrifuged 800g/min, 5min, abandon supernatant；300 μ L DEPC- are added
PBST cleans cell precipitation, is repeated 2 times；
8) 2 × SSC of the final concentration of 0.1 μM of detection probe (mark fluorescent group) of 100 μ L is added, 10%formamide's
Reaction mixture is mixed well with cell precipitation, is placed at the uniform velocity rotation blending instrument, room temperature and is hatched 2h；(detection probe:
TCGCGCTTGGTATAATCGCT, SEQ ID NO.03)
9) 200 μ L DEPC-PBST are first added, then are centrifuged 800g/min, 5min, abandon supernatant；300 μ L DEPC- are added
PBST cleans cell precipitation, is repeated 2 times；
10) with the 300 above-mentioned cell precipitations of μ L DEPC-PBS gravity treatment, slight piping and druming is single cell suspension, uses cell filtering net
(40 μm) are filtered 1 time, and biggish particle or cell mass in suspension are removed.
(5) material prepared by above-mentioned steps (4) is placed on flow cytometer and is detected, it as a result as shown in Fig. 2, can be clear
Expression of the CD44 in K562 and MK cell detects in Chu.
The foregoing is only a preferred embodiment of the present invention, the range that the present invention that therefore, it cannot be limited according to is implemented, i.e.,
Equivalent changes and modifications made in accordance with the scope of the invention and the contents of the specification should still be within the scope of the present invention.
Sequence table
<110>Huaqiao University
<120>a kind of unicellular gene expression analysis method using the unicellular rna expression of flow cytomery
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 77
<212> DNA
<213> Artifical Sequence
<400> 1
actgttgatc actagcatga ttactgactc gcgcttggta taatcgctta cgatcttctt 60
tacacagctc cattgcc 77
<210> 2
<211> 20
<212> DNA
<213> Artifical Sequence
<400> 2
agcgattata ccaagcgcga 20
<210> 3
<211> 20
<212> DNA
<213> Artifical Sequence
<400> 3
tcgcgcttgg tataatcgct 20
Claims (5)
1. a kind of unicellular gene expression analysis method using the unicellular rna expression of flow cytomery, it is characterised in that:
Include the following steps:
(1) according on target RNA target sequence design padlock probe or dual link probe and its corresponding rolling circle amplification primer and
Detection probe, which is marked with can be by the group of flow cytomery；
(2) single cell suspension is made in cell to be measured after cultivation, fixative is added in the single cell suspension, makes cell to be measured
In RNA molecule fixed；
(3) above-mentioned padlock probe or dual link probe is made to enter step the to be measured intracellular of (2) resulting material, and with it is to be measured thin
Target sequence on above-mentioned target RNA intracellular identifies and hybridizes, and to identify with target sequence and hybridize upper by DNA ligase
After stating padlock probe or dual link probe connection cyclization, rolling circle amplification is carried out by above-mentioned rolling circle amplification primer in the cell, is obtained
To rolling circle amplification product；
(4) in the cell, above-mentioned detection probe is hybridized with above-mentioned rolling circle amplification product, extra detection probe is gone by washing
It removes, obtains sample to be tested；
(5) above-mentioned sample to be tested is sent into flow cytometer and carries out signal measuring, target RNA is determined according to the signal strength of measurement
In intracellular expression to be measured.
2. unicellular gene expression analysis method as described in claim 1, it is characterised in that: the target RNA includes cell
The RNA of the RNA and allogenic gene of itself portion's expression in the cell.
3. unicellular gene expression analysis method as claimed in claim 2, it is characterised in that: the allogenic gene is in cell
The RNA of internal representations includes viral RNA and plastid rna.
4. unicellular gene expression analysis method as described in claim 1, it is characterised in that: the cell to be measured includes artificial
The cell come is dissociateed in the cell of culture, blood cell and tissue.
5. unicellular gene expression analysis method as described in claim 1, it is characterised in that: described to be examined by flow cytometer
The group of survey is fluorophor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910670421.8A CN110373451A (en) | 2019-07-23 | 2019-07-23 | A kind of unicellular gene expression analysis method using the unicellular rna expression of flow cytomery |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910670421.8A CN110373451A (en) | 2019-07-23 | 2019-07-23 | A kind of unicellular gene expression analysis method using the unicellular rna expression of flow cytomery |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110373451A true CN110373451A (en) | 2019-10-25 |
Family
ID=68255439
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910670421.8A Pending CN110373451A (en) | 2019-07-23 | 2019-07-23 | A kind of unicellular gene expression analysis method using the unicellular rna expression of flow cytomery |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110373451A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022237335A1 (en) * | 2021-05-13 | 2022-11-17 | 厦门先能生物科技有限公司 | Method for testing presence or level of one or more target nucleic acids in sample |
| EP4116434A1 (en) * | 2021-07-07 | 2023-01-11 | Universidad Autónoma de Madrid | In vitro method for quantifying the cellular content of specific rnas |
| WO2024107887A1 (en) * | 2022-11-16 | 2024-05-23 | 10X Genomics, Inc. | Methods and compositions for assessing performance of in situ assays |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160289750A1 (en) * | 2013-11-14 | 2016-10-06 | Olink Ab | Localised rca-based amplification method using a padlock-probe |
| CN106929593A (en) * | 2017-04-27 | 2017-07-07 | 华侨大学 | A kind of in-situ nucleic acid detection method |
| CN109797201A (en) * | 2019-03-12 | 2019-05-24 | 华侨大学 | A kind of original position multiple nucleic acid detection method |
-
2019
- 2019-07-23 CN CN201910670421.8A patent/CN110373451A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160289750A1 (en) * | 2013-11-14 | 2016-10-06 | Olink Ab | Localised rca-based amplification method using a padlock-probe |
| CN106929593A (en) * | 2017-04-27 | 2017-07-07 | 华侨大学 | A kind of in-situ nucleic acid detection method |
| CN109797201A (en) * | 2019-03-12 | 2019-05-24 | 华侨大学 | A kind of original position multiple nucleic acid detection method |
Non-Patent Citations (3)
| Title |
|---|
| ANDREAS P FREI等: "Highly multiplexed simultaneous detection of RNAs and proteins in single cells", 《NATURE METHODS》 * |
| REN, XJ 等: "SpliceRCA: in Situ Single-Cell Analysis of mRNA Splicing Variants", 《ACS CENTRAL SCIENCE》 * |
| 杜洪震等: "应用锁式探针滚环扩增检测小鼠畸胎瘤分化过程中单细胞基因表达水平", 《基础医学与临床》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022237335A1 (en) * | 2021-05-13 | 2022-11-17 | 厦门先能生物科技有限公司 | Method for testing presence or level of one or more target nucleic acids in sample |
| EP4116434A1 (en) * | 2021-07-07 | 2023-01-11 | Universidad Autónoma de Madrid | In vitro method for quantifying the cellular content of specific rnas |
| WO2023280944A1 (en) * | 2021-07-07 | 2023-01-12 | Universidad Autónoma de Madrid | In vitro method for quantifying the cellular content of specific rnas |
| WO2024107887A1 (en) * | 2022-11-16 | 2024-05-23 | 10X Genomics, Inc. | Methods and compositions for assessing performance of in situ assays |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110373451A (en) | A kind of unicellular gene expression analysis method using the unicellular rna expression of flow cytomery | |
| CN104046700B (en) | The detection kit of a kind of Rapid identification donkey hide, horse skin and mule skin | |
| CN105441595B (en) | It is a kind of for detecting the digital pcr absolute quantitation parting detecting reagent of HBV-B/C | |
| CN108034658A (en) | A kind of aptamer for detecting people's uveal melanoma cells | |
| CN101665821A (en) | Oligonucleotide aptamer group for specifically identifying staphylococcus aureus and use thereof | |
| CN107574226A (en) | A kind of genetic test probe and gene tester | |
| CN106282416B (en) | A kind of the multi-fluorescence immunoassay primer, kit and method of 5 kinds of fowl immunosupress cause of diseases of quick differentiation | |
| CN107828914A (en) | Infectious subcutaneous and haematopoietic necrosis virus（IHHNV）RAA constant temperature fluorescence detection method and reagent | |
| CN108977582B (en) | A kind of real-time fluorescence quantitative RT-PCR detection method of avian infectious bronchitis virus | |
| CN101730847A (en) | compositions and methods of detection | |
| CN109486921A (en) | A method of increasing multiple PCR primer compatibility | |
| CN108588277A (en) | A kind of canine distemper virus visualization nucleic acid detection method | |
| CN110283935A (en) | A kind of African swine fever virus LAMP detection kit and its application | |
| CN110283936A (en) | A kind of African swine fever virus LAMP-HNB Visual retrieval kit | |
| CN107447031A (en) | The mutant nucleic acid Russian Market of ring mediated isothermal amplification is carried out in a kind of emulsion | |
| CN109593883A (en) | Kit of the pig circular ring virus multiple real time fluorescence PCR detection primer to, probe and preparation | |
| CN106868207A (en) | The RT LAMP detection primers group and kit of K subgroup avian leucosis virus | |
| CN103898240A (en) | Primers, probes and method for detecting dengue virus and types of dengue virus | |
| CN105297141A (en) | Micro-array chip detection method for 10 on-melon diseases and used chip probe | |
| CN109055614A (en) | Primed probe group and kit based on RAA Fluorometric assay hepatitis type B virus | |
| CN108486221A (en) | The method for detecting telomere length | |
| CN109680101B (en) | Rapid detection method for distinguishing strong and weak viruses of H7N9 subtype avian influenza virus | |
| CN109097488A (en) | For synchronizing nucleic acid, method and the kit of five kinds of dog diarrhea virus of detection and identification | |
| CN109735658A (en) | A kind of fluorescence quantitative RT-PCR detecting method of newcastle disease virus | |
| CN106319091B (en) | The multi-fluorescence immunoassay method and kit of a kind of quick differentiation canine distemper virus, canine parvovirus and rabies viruses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20220913 Address after: 361000 unit 318, floor 3, innovation building, 1300 Jimei Avenue, Jimei District, Xiamen City, Fujian Province Applicant after: Xiamen Xianneng Biotechnology Co.,Ltd. Address before: 362000 North China Road, Dongcheng, Fengze District, Quanzhou City, Fujian Province, 269 Applicant before: HUAQIAO University |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191025 |