CN110452931A - A kind of method of squalene content in raising yeast - Google Patents

Abstract

The invention discloses a kind of methods of squalene content in raising yeast.The method of squalene content in raising yeast disclosed by the invention, content and/or activity including reducing squalene epoxidase in the microorganism that sets out, obtained microorganism is named as mutant microbial, 1) and/or 2) and/or 3) culture mutant microbial obtains squalene, wherein reducing the set out content of squalene epoxidase and/or activity in microorganism includes: 1) the sterol response element sequence for knocking out and/or being mutated in squalene epoxidase encoding gene promoters；It 2) is rare codon in the microorganism that sets out by least one codon mutation in squalene epoxidase encoding gene；3) amino acid residue being mutated in squalene epoxidase makes the activity decline of squalene epoxidase.It is demonstrated experimentally that the present invention reduces squalene epoxidase activity in yeast cells at two aspects of protein level and enzyme activity level, the accumulation of squalene is improved.

Description

A kind of method of squalene content in raising yeast

Technical field

The present invention relates in field of biotechnology, a method of improving squalene content in yeast.

Background technique

Squalene is the unsaturated triterpene compound being formed by connecting by 6 isoprene, has enhancing immunity of organism energy Power improves the different physiological roles such as sexual function, anti-oxidant, anti-aging, antifatigue, antitumor, in cosmetics, food, health care product There is very extensive application with medicine and other fields.The industrialized production of squalene is mainly mentioned from hydrogenated hydro carbons grease at present It takes.But realizing with ecological environmental protection enhances, and to prevent wild shark resource exhaustion, countries in the world one after another arrange wild shark Enter to protect in animal range, forbid catching and killing, therefore shark is more and more severely limited as the source of squalene.

Squalene is present in multiple-microorganism as a kind of mesostate.Saccharomyces cerevisiae is as simplest eukaryon Microorganism, efficient genetic manipulation and mature industrial fermentation technology become the most important eukaryon of synthesis of biologically active substance Microbial cell factories.Squalene, which is the key that saccharomyces cerevisiae, synthesizes sterol mesostate by mevalonate pathway, it Enter sterol route of synthesis under the catalysis of squalene epoxidase, therefore squalene contains in the Natural wild-type yeast cells Measure it is extremely low, cannot achieve yeast fermentation method production squalene.Since sterol is metabolite necessary to yeast cell growth, Lethal effect will be generated by directly knocking out squalene epoxidase encoding gene.Therefore squalene Cycloxygenase and downstream metabolic are anti- It answers activity to carry out rational regulation, effective product of the squalene in yeast cells is realized under the premise of not influencing yeast cell growth It is tired, it is saccharomycetes to make fermentation method synthesis squalene critical issue urgently to be resolved.

Summary of the invention

The technical problem to be solved by the present invention is to how improve the accumulation of squalene in microorganism.

In order to solve the above technical problems, the method includes reducing present invention firstly provides the preparation method of squalene It sets out the content and/or activity of squalene epoxidase in microorganism, obtained microorganism is named as mutant microbial, is cultivated The mutant microbial obtains squalene.

The microorganism that sets out can express squalene epoxidase.

In the above method, the reduction set out squalene epoxidase in microorganism content and/or activity can 1) and/or 2) and/or 3):

1) the sterol response element sequence for knocking out and/or being mutated in the squalene epoxidase encoding gene promoters；

It 2) is the microorganism that sets out by least one codon mutation in the squalene epoxidase encoding gene Middle rare codon；

3) amino acid residue being mutated in the squalene epoxidase, under the activity for making the squalene epoxidase Drop.

3) by the mutein obtained after the amino acid residue mutation in the squalene epoxidase with described in Squalene epoxidase enzyme activity, compared with the squalene epoxidase enzyme activity in the microorganism that sets out, the mutation egg The enzyme activity of white matter declines.

In the genome of the microorganism that sets out, rung in the squalene epoxidase encoding gene promoters containing sterol Answer element sequences.

In the above method, the sterol response element sequence can be 376-401 of SEQ ID No.4 in sequence table.

It in the above method, 1) can be for by SEQ ID in sequence table in the squalene epoxidase encoding gene promoters The 376-401 deletions of No.4；

2) can be micro- life of setting out by the codon mutation of glycine in the squalene epoxidase encoding gene Rare codon in object；

It 3) can be that the glycine residue in the squalene epoxidase is sported into serine residue.

Contain glycine residue in the squalene epoxidase.

In the above method, the rare codon of the serine can be AGT.

In the above method, the sequence of the squalene epoxidase is SEQ ID No.5 in sequence table, 2) it is by the angle The codon mutation that the 30th glycine of the squalene epoxidase is encoded in squalene epoxidase enzymes encoding gene is institute State the rare codon for the serine described in microorganism that sets out, 3) it is by the 30th in squalene epoxidase glycine Residue mutations are serine residue.

In the above method, the squalene epoxidase encoding gene is 758-2248 of SEQ ID No.4,2) have Body can be that the 845-847 GGT of SEQ ID No.4 in sequence table are sported AGT；It 3) concretely will be in sequence table The 845-847 GGT of SEQ ID No.4 sport AGT.

In the above method, the microorganism that sets out can be a1) or a2):

A1) yeast；

A2) saccharomyces cerevisiae.

The saccharomyces cerevisiae concretely saccharomyces cerevisiae YEH56.

The present invention also provides following X1)-X3) in any product:

X1) DNA fragmentation, be following X11) X12) or X13):

X11) by the sterol response element sequence in the squalene epoxidase encoding gene promoters in the method The DNA fragmentation for knocking out and/or being obtained after being mutated；

It X12 is) institute by least one codon mutation in the squalene epoxidase encoding gene in the method State the DNA fragmentation that the rare codon of codon described in microorganism that sets out obtains；

X13) contain X11) and DNA fragmentation X12)；

X2) the 30th in squalene epoxidase shown in SEQ ID No.5 in sequence table glycine residue is mutated The protein obtained for serine residue；

X3) the mutant microbial.

In the said goods, X11) DNA fragmentation can be for shown in 353-731 of SEQ ID No.1 in sequence table DNA fragmentation；

X12) DNA fragmentation can be DNA fragmentation shown in 732-2222 of SEQ ID No.1 in sequence table；

X13) DNA fragmentation can be DNA fragmentation shown in SEQ ID No.1 in sequence table.

The present invention also provides the products to prepare the application in squalene.

The present invention deletes squalene epoxidase encoding gene promoters in Yeast genome by site-directed point mutation SRE sequence, and using the seamless editing technique of genome mediated based on mazF-zeoR expression cassette by the ERG1's on genome 30th glycine mutation is serine, significantly reduces the squalene epoxidase enzymatic activity of yeast cells, simultaneous mutation Protein content afterwards also declines, to reduce squalene in yeast cells at two aspects of protein level and enzyme activity level Peroxidase activity reduces the metabolic fluxes that squalene is converted to sterol, improves the accumulation of squalene, is saccharomycetes to make fermentation method Production squalene has established bacterial strain basis.

Specific embodiment

The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining The bright present invention, the range being not intended to be limiting of the invention.Experimental method in following embodiments is unless otherwise specified Conventional method.Material as used in the following examples, reagent, instrument etc., are commercially available unless otherwise specified. Quantitative test in following embodiment, is respectively provided with three repeated experiments, and results are averaged.In following embodiments, such as without special Illustrate, the 1st of each nucleotide sequence is the 5 ' terminal nucleotides of corresponding DNA in sequence table, and last bit is the 3 ' of corresponding DNA Terminal nucleotide.

KOD-Plus-Neo archaeal dna polymerase and 10 × KOD buffer are TOYOBO Products, and catalog number is KOD-401。

Antibiotic Zeocin is Invitrogen Products, catalog number R25001.

Squalene standard items are Aladdin Products, catalog number S109119.

Carrier pEASY-blunt simple is Beijing Quanshijin Biotechnology Co., Ltd, catalog number CB111- 01。

S. cervisiae (Saccharomyces cerevisiae) YEH56 is the ergosterol of building this study group early period Superior strain (He XP, Huai WH, Tie CJ, Liu YF, Zhang BR (2000) Breeding of high Ergosterol-producing yeast strains.J Ind Microbiol Biotechnol, 25:39-44).

Plasmid pEBCMMZC be this study group early period building saccharomycete gene seamless knockout plasmid (Song P, Liu S, Guo XN,Bai XJ,He XP,Zhang BR.Scarless gene deletion in methylotrophic Hansenula polymorpha by using mazF as counter-selectable marker.Anal Biochem, 2015,468:66-74)。

The various culture mediums used in embodiment:

YPD solid medium: the culture medium is made of solute and solvent；Solute is yeast powder, peptone, glucose and fine jade Cosmetics, solvent are water；The concentration of solute is as follows: 10g/L yeast powder, 20g/L peptone, 20g/L glucose and 10g/L agar Powder, natural pH.

YPG solid medium: the culture medium is made of solute and solvent；Solute is yeast powder, peptone, galactolipin and fine jade Cosmetics, solvent are water；The concentration of solute is as follows: 10g/L yeast powder, 20g/L peptone, 10g/L agar powder, galactolipin 20g/ L, natural pH.

The fluid nutrient medium of the above culture medium is made by not adding agar powder therein, remaining ingredient and concentration and solid Culture medium is identical.

The acquisition of embodiment 1, squalene epoxidase encoding gene ERG1 mutated gene

One, the clone of each DNA fragmentation of squalene epoxidase gene ERG1

(1) according to the squalene epoxidase encoding gene ERG1 gene order for the saccharomyces cerevisiae reported in GenBank (the reverse complementary sequence of the 846518th -849180 bit sequences, i.e. sequence table in GenBank Access No.BK006941.2 (wherein the 353rd -757 bit sequences are promoter sequence to middle SEQ ID No.4, and the 758th the-the 2248 bit sequence is ERG1's Coded sequence)), design and synthesize following primer:

ERG1-1F:5'-TGACCACTTGATTGGTCTG-3'；

ERG1-1R:5'-CCGATACACTGCTTGCCTTTAGGCCCGCTACGGCAGTATCGC-3'；

ERG1-2F:5'-GCGATACTGCCGTAGCGGGCCTAAAGGCAAGCAGTGTATCGG-3'；

ERG1-2R:5'-AGACCAGTAGCAACACATGGACTGATAACACCAGCACCGATG-3'；

ERG1-3F:5'-CATCGGTGCTGGTGTTATCAGTCCATGTGTTGCTACTGGTCT-3'；

ERG1-3R:5’-CACAAAGACTACTATGGTGT-3’。

(2) genomic DNA for extracting saccharomyces cerevisiae YEH56 is utilized respectively primer pair ERG1-1F/ as template ERG1-1R, ERG1-2F/ERG1-2R and ERG1-3F/ERG1-3R carry out PCR amplification.

PCR reaction system: genomic DNA 50ng, the concentration of each primer in the reaction system are 0.3 μm of ol/L, KOD- 1 μ L, 10 × KOD buffer of Plus-Neo archaeal dna polymerase, 5 μ L, 2mM dNTPs, 5 μ L, 25mM Mg²⁺2 μ L, use deionized water System is mended to 50 μ L, is mixed.

PCR reaction condition: it 98 DEG C/2min, recycles 1 time；98 DEG C/10s, 50 DEG C/30s, 72 DEG C/60s, 30 circulations；72 DEG C/10min, it recycles 1 time.

(3) PCR product is subjected to agarose gel electrophoresis detection, is obtained using primer pair ERG1-1F/ERG1-1R PCR product size is 395bp, is named as ERG1-1；It is using the PCR product size that primer pair ERG1-2F/ERG1-2R is obtained 488bp is named as ERG1-2；It is 1838bp using the PCR product size that primer pair ERG1-3F/ERG1-3R is obtained, is named as ERG1-3.The above-mentioned PCR product of QIAquick Gel Extraction Kit purification and recovery is cleaned using PCR.Sequence is analysis shows each PCR product expanded Nucleotide sequence and expected consistent.The sequence of above-mentioned PCR product respectively as in SEQ ID No.1 5 ' ends play the 1st to the Shown in 395 nucleotide, the 354th to 841 nucleotide and the 800th to 2637 nucleotide.

Two, the acquisition of mutated gene mERG1

PCR product ERG1-1, ERG1-2 and ERG1-3 equimolar that step 1 is obtained mixes, 98 DEG C of initial denaturation 2min, Then 98 DEG C/10s, 55 DEG C/5s, 72 DEG C/90s are recycled 10 times, are cooled to room temperature.End is sequentially added in above-mentioned reaction system Concentration is respectively primer ERG1-1F and primer ERG1-3R, the KOD-Plus-Neo archaeal dna polymerase 1 μ L of 0.3 μm of ol/L, 10 × 5 μ L, 2mM dNTPs of KOD buffer, 5 μ L, 25mM Mg²⁺System is mended to 50 μ L with deionized water, is mixed by 2 μ L.

PCR reaction condition are as follows: 98 DEG C/2min, recycle 1 time；98 DEG C/10s, 50 DEG C/5s, 72 DEG C/90s, 30 circulations；72 DEG C/5min, it recycles 1 time.

After reaction, obtained PCR product is denoted as fusion DNA vaccine product, fusion DNA vaccine product is the DNA piece of 2637bp Section.The DNA fragmentation has lacked the SRE sequence that upstream from start codon -382 arrives -357 26bp compared with wild type ERG1 gene It arranges (TCGTATAGCTCGGCCGAGCTCGTACA), the 30th codon of coded sequence is mutated by the GGT of coding glycine (Gly) For the codon AGT of the relatively low encoding serine of the frequency of use in saccharomyces cerevisiae (Ser), which is named as It rises shown in 1-2637 nucleotide the sequence such as 5 ' end SEQ ID No.1 of mERG1 gene, mERG1 gene.

Wherein, 353-731 of SEQ ID No.1 are promoter sequence, and 732-2222 are coding region sequence, are compiled 30th glycine mutation of ERG1 protein shown in SEQ ID No.5 in sequence table is the protein of serine by code.

Carrier pEASY-blunt simple is connect with mERG1 gene, the correct recombinant plasmid of obtained sequence is ordered Entitled pEASY-mERG1.

Embodiment 2, squalene epoxidase encoding gene are mutated the influence to yeast cells squalene content

One, the rite-directed mutagenesis of saccharomyces cerevisiae genome ERG1

(1) according to saccharomyces cerevisiae GAL1 gene order (GenBank Access No.X76078.1) and plasmid The nucleotide sequence of DNA fragmentation mazF-zeoR in pEBCMMZC, designs and synthesizes following primer:

GALp-F:5 '-TGCTCATTGCTATAT-3 '；

GALp-R:5 '-GGGTACGTATCGGCTTACCATCTCCTTGACGTTAAAGTA-3 '；

FR-F:5 '-TACTTTAACGTCAAGGAGATGGTAAGCCGATACGTACCC-3 '；

FR-R:5 '-ATCGATGCCAGCAACGCG-3 '.

(2) using the genomic DNA of saccharomyces cerevisiae YEH56 as template, PCR expansion is carried out using primer GALp-F and GALp-R Increase.

PCR reaction system are as follows: DNA profiling 50ng, primer GALp-F (concentration in the reaction system is 0.3 μm of ol/L), Primer GALp-R (concentration in the reaction system is 0.3 μm of ol/L), KOD-Plus-Neo archaeal dna polymerase 1 μ L, 10 × KOD 5 μ L, 2mM dNTPs of buffer, 5 μ L, 25mM Mg²⁺System is mended to 50 μ L with deionized water, is mixed by 2 μ L.

Reaction condition: 98 DEG C/30s；98 DEG C/10s, 55 DEG C/30s, 72 DEG C/15s, 30 circulations；72 DEG C/2min, circulation 1 It is secondary.

After reaction, agarose gel electrophoresis detects the DNA fragmentation that PCR product is about 0.5kb, sequence analytical table to PCR GAL1 promoter sequence consistency is 100% in bright and GeneBank, which is named as GAL1p, the sequence of GAL1p As 5 ' ends are risen shown in 1-485 nucleotide in SEQ ID No.2.

(3) using plasmid pEBCMMZC as template, PCR amplification is carried out using primers F R-F and primers F R-R.

PCR reaction system are as follows: (concentration in the reaction system is 0.3 μm of ol/ by plasmid pEBCMMZC 50ng, primers F R-F L), primers F R-R (concentration in the reaction system is 0.3 μm of ol/L), KOD-Plus-Neo archaeal dna polymerase 1 μ L, 10 × KOD 5 μ L, 2mM dNTPs of buffer, 5 μ L, 25mM Mg²⁺System is mended to 50 μ L with deionized water, is mixed by 2 μ L.

Above-mentioned PCR reaction condition is equal are as follows: 98 DEG C/2min, recycles 1 time；98 DEG C/10s, 59 DEG C/5s, 72 DEG C/40s, 30 Circulation；It 72 DEG C/5min, recycles 1 time.

Obtained PCR product is the DNA fragmentation of 2009bp, coded sequence containing mazF, ADH1 terminator sequence and zeoR table Up to box, which is named as mazF-zeoR, 447-2455 nucleosides are played in 5 ' ends in the sequence such as SEQ ID No.2 Shown in acid.

(4) PCR product GAL1p and the mazF-zeoR equimolar of above-mentioned steps is mixed, 98 DEG C of initial denaturation 2min, then 98 DEG C/10s, 55 DEG C/5s, 72 DEG C/90s are recycled 10 times, are cooled to room temperature.Final concentration is sequentially added in above-mentioned reaction system The primer GALp-F and primers F R-R, KOD-Plus-Neo archaeal dna polymerase 1 μ L, 10 × KOD of respectively 0.3 μm ol/L 5 μ L, 2mM dNTPs of buffer, 5 μ L, 25mM Mg²⁺System is mended to 50 μ L with deionized water, is mixed by 2 μ L.

PCR reaction condition are as follows: 98 DEG C/2min, recycle 1 time；98 DEG C/10s, 50 DEG C/5s, 72 DEG C/90s, 30 circulations；72 DEG C/5min, it recycles 1 time.

Obtained fusion DNA vaccine product is the DNA fragmentation of 2455bp, respectively the mazF expression containing GAL1p promoter regulation The DNA fragmentation is named as G-mazF-zeoR, the sequence of G-mazF-zeoR such as SEQ ID No.2 by box and zeoR expression cassette In 5 ' ends rise the 1st to the 2455th nucleotide shown in.

Carrier pEASY-blunt simple is connect with G-mazF-zeoR, by the correct recombinant plasmid of obtained sequence It is named as pEASY-mazF-zeoR.

(5) according to mERG1 nucleotide sequence and G-mazF-zeoR nucleotide sequence, following primer is designed and synthesized.

EG-F1:5’-CGTTCTGCAAGCTCTTCTACCAAACCATCGGCGAATTTGCGTCGCTGCTCATTGCTATAT - 3 ' (forward primers)；

EG-R1:5 '-GATTCCCATTCGCCACGATCATCGATGCCAGCAACGCG-3 ' (reverse primer)；

EG-F2:5 '-CGCGTTGCTGGCATCGATGATCGTGGCGAATGGGAATC-3 ' (forward primer)；

EG-R2:5 '-ACCCAGACTTCTCAATGCTC-3 ' (reverse primer).

(6) respectively using plasmid pEASY-mazF-zeoR and pEASY-mERG1 as template, primer EG-F1 and primer are utilized EG-R1, primer EG-F2 and primer EG-R2 carry out PCR amplification.

PCR reaction system are as follows: plasmid 50ng, forward primer (concentration in the reaction system is 0.3 μm of ol/L) reversely draw Object (concentration in the reaction system is 0.3 μm of ol/L), 1 μ L, 10 × KOD buffer of KOD-Plus-Neo archaeal dna polymerase, 5 μ 5 μ L, 25mM Mg of L, 2mM dNTPs²⁺System is mended to 50 μ L with deionized water, is mixed by 2 μ L.

Above-mentioned PCR reaction condition is equal are as follows: 98 DEG C/2min, recycles 1 time；98 DEG C/10s, 59 DEG C/5s, 72 DEG C/40s, 30 Circulation；It 72 DEG C/5min, recycles 1 time.

It expands to obtain the PCR product of 2520bp from plasmid pEASY-mazF-zeoR using primer EG-F1 and primer EG-R1, The PCR product is named as E5-G-mazF-zeoR, PCR product by the gene 5 ' terminal sequence of mERG1 containing 45bp and G-mazF-zeoR Sequence as in SEQ ID No.3 5 ' ends rise the 1st to the 2520th nucleotide shown in；Utilize primer EG-F2 and primer EG- R2 expands to obtain the PCR product of 688bp, the terminal sequence of gene 5 ' containing mERG1 and partial coding sequence from plasmid pEASY-mERG1, The PCR product is named as mERG1-5,5 ' ends play the 2483rd to the 3170th in the sequence such as SEQ ID No.3 of PCR product Shown in the nucleotide of position.

(7) PCR product E5-G-mazF-zeoR and mERG1-5 equimolar is mixed, 98 DEG C of initial denaturation 2min, then 98 DEG C/10s, 55 DEG C/5s, 72 DEG C/90s, it recycles 10 times, is cooled to room temperature.Final concentration point is sequentially added in above-mentioned reaction system Not Wei 0.3 μm of ol/L 1 μ L, 10 × KOD buffer of primer EG-F1 and primer EG-R2, KOD-Plus-Neo archaeal dna polymerase 5 μ L, 2mM dNTPs, 5 μ L, 25mM Mg²⁺System is mended to 50 μ L with deionized water, is mixed by 2 μ L.

PCR reaction condition are as follows: 98 DEG C/2min, recycle 1 time；98 DEG C/10s, 50 DEG C/5s, 72 DEG C/90s, 30 circulations；72 DEG C/5min, it recycles 1 time.

Obtained fusion DNA vaccine product is the DNA fragmentation of 3170bp, contains E5-G-mazF-zeoR and mERG1-5, by the DNA Segment is named as E5-G-mazF-zeoR-mERG1-5, and 5 ' ends play the 1st in the sequence such as SEQ ID No.3 of the DNA fragmentation To shown in the 3170th nucleotide, wherein the 1st to the 46th nucleotide and the 2520th to the 2565th nucleotide are to repeat Sequence can mediate homologous recombination to knock out selection markers G-mazF-zeoR, realize to the seamless of the site ERG1 in reversed screening Editor.

(8) 10 μ g DNA fragmentation E5-G-mazF-zeoR-mERG1-5 electrotransformation saccharomyces cerevisiae YEH56, bacterium after conversion are taken Liquid is coated on the YPD plate containing 200 μ g/mL zeocin, in 30 DEG C of stationary culture 3-5d.The list that will be grown in screening flat board Bacterium colony is connected in 1mL sterile water, is stored at room temperature 2h, is then put respectively in YPD solid plate and respectively containing 200,400,600 μ g/ On the YPD plate of mL zeocin, 30 DEG C of stationary culture 48h, obtaining can be normal on the YPD plate of 600 μ g/mL zeocin The Strain Designation is YEH56-mERG1-mazF-zeoR by the conversion bacterial strain of growth.

Conversion bacterial strain YEH56-mERG1-mazF-zeoR is connected in 2ml liquid YPD medium, 30 DEG C, 200rpm culture 18h, 5000rpm are centrifuged 5min and collect cell, and sterile water washed once, and 2ml sterile water is added, after being stored at room temperature 2h, takes 100 μ L Bacteria suspension is coated in YPG solid medium tablets, and 30 DEG C of stationary cultures are to growing single colonie.

Random picking single bacterium is fallen in 1mL sterile water, and after being stored at room temperature 2h, dibbling is in YPD and 200 μ g/mL respectively On the YPD solid plate of zeocin, while with saccharomyces cerevisiae YEH56 and aforementioned conversion bacterial strain YEH56-mERG1-mazF-zeoR For control, 30 DEG C of stationary culture 48h.

As a result all bacterial strains energy normal growth, but only aforementioned conversion bacterial strain YEH56-mERG1- on YPD plate MazF-zeoR can be grown on the YPD solid plate containing zeocin, i.e., the single colonie grown on YPG solid plate loses To the resistance of zeocin, after showing that aforementioned conversion bacterial strain YEH56-mERG1-mazF-zeoR is cultivated on YPG culture medium, by Lethal effect is generated to cell in the expression of galactolipin inducing toxic albumen MazF, and is only mediated by the 5 ' ends of ERG1 same The yeast cells that source recombination knocks out G-mazF-zeoR could be grown.

(9) single colonie on random 2 YPG solid plates of picking, extracts genomic DNA, as template, using drawing Object ERG1-1F and EG-R2 carry out PCR amplification, while being control with bacterial strain YEH56 genomic DNA.

PCR reaction system are as follows: (concentration in the reaction system is 0.3 μm of ol/ by genomic DNA 20ng, primer ERG1-1F L), primer EG-R2 (concentration in the reaction system be 0.3 μm of ol/L), KOD-Plus-Neo archaeal dna polymerase 0.5 μ L, 10 × 2 μ L, 2mM dNTPs of KOD buffer, 2 μ L, 25mM Mg²⁺System is mended to 20 μ L with deionized water, is mixed by 0.4 μ L.

PCR reaction condition is equal are as follows: 98 DEG C/2min, recycles 1 time；98 DEG C/10s, 59 DEG C/5s, 72 DEG C/10s, 30 circulations； It 72 DEG C/5min, recycles 1 time.

Using primer ERG1-1F and EG-R2 from YPG solid plate single colonie bacterial strain and YEH56 genome expand The DNA fragmentation of about 1000bp out.Sequence analysis and comparison are carried out to PCR product, the results showed that two lists on YPG solid plate The PCR product in bacterium colony source has completely the same nucleotide sequence, they are compared with the PCR product of bacterial strain YEH56, missing 376th to 401 nucleotide, while there are mononucleotide differences in the 30th, initiation codon downstream codon, by compiling The GGT of code glycine (Gly) sports the codon AGT of encoding serine (Ser), illustrates on YPG solid plate ERG1 on two single colonie genomes sports mERG1, the two single colonies are respectively designated as YEH56-mERG1 (1) With YEH56-mERG1 (2).

YEH56-mERG1 (1) and YEH56-mERG1 (2) all have following characteristics: compared with saccharomyces cerevisiae YEH56, YEH56-mERG1 (1) and YEH56-mERG1 (2) has lacked the 26bp's of ERG1 gene start codon upstream -382 to -357 SRE sequence (TCGTATAGCTCGGCCGAGCTCGTACA), and the codon of code area the 30th is by coding glycine (Gly) GGT sports the codon AGT of the relatively low encoding serine of the frequency of use in saccharomyces cerevisiae (Ser), i.e. YEH56-mERG1 (1) and the ERG1 gene mutation in YEH56-mERG1 (2) genome is for mERG1 gene.

Two, ERG1 is mutated the influence to yeast cells squalene content

(1) squalene standard curve making: squalene standard items are dissolved in chromatography pure acetone, and are configured to concentration The standard solution of respectively 0.03mg/mL, 0.07mg/mL, 0.13mg/mL, 0.27mg/mL, 0.4mg/mL, 0.54mg/mL.Benefit (chromatographic column Plus-C18, flowing are analyzed to standard items with high performance liquid chromatography (HPLC, Agilent 1260infinity) It is mutually 100% acetonitrile, flow velocity 1mL/min, detector UV/VIS 195nm, 40 DEG C of column temperature, 10 μ L of sample volume).Experiment repeats three It is secondary, average value is calculated, the standard curve between peak area and squalene concentration is drawn, it is as follows to obtain function formula:

Squalene concentration (mg/mL)=1.34 × 10^-5× peak area

(2) saccharomyces cerevisiae YEH56, YEH56-mERG1 (1) and YEH56-mERG1 (2) are inoculated in 5mL YPD liquid respectively In body culture medium, 30 DEG C, 200rpm shaken cultivation 18h, 10% inoculum concentration is transferred in 45mL YPD Liquid Culture by volume In base, 30 DEG C shaking table shaken cultivation 24 hours, measure cellular biomass and squalene content respectively.Experiment is set to be repeated three times, is counted Calculate average value.

(3) 40mL bacterium solution is accurately taken, 5000rpm is centrifuged 5 minutes collection somatic cells, after sterile washing is primary, weighing, Calculate wet thallus weight.0.5g wet thallus is accurately weighed, drying to constant weight in 65 DEG C of baking ovens, and weighing calculates the dry and wet of thallus Than cellular biomass is the grams (g/L) of dry mycelium in every liter of fermentation liquid.The results are shown in Table 1, bacterial strain YEH56, YEH56- The cellular biomass of mERG1 (1) and YEH56-mERG1 (2) do not have notable difference, show that mutation pair of the present invention occurs for ERG1 Cell growth has not significant impact.

(4) 0.1g wet thallus is accurately weighed in 7mL centrifuge tube, and 2mL 3M HCl is added and mixes, 95 DEG C of water-bath 5min, Ice bath 10min, 12000rpm are centrifuged 3min, with 1mL acetone is added after sterile wash twice, shake 10min, 12000rpm centrifugation 3min, 0.22 μm of membrane filtration of supernatant, post-filtration samples measure squalene content according to the standard curve determination method. Cell squalene content is the milligram number (mg/g) of squalene contained by every gram of stem cell.As described in Table 1, as a result this hair occurs for ERG1 The bright mutation significantly improves yeast cells squalene content, ferments for 24 hours, mutant strain YEH56-mERG1 (1) and YEH56- MERG1 (2) squalene accumulation is 8.9 times and 8.8 times of control strain YEH56 respectively.Show that mERG1 gene can be improved Squalene accumulation in yeast cells.

Table 1, different yeast strain cell growths and squalene content analysis

Bacterial strain	Cellular biomass (g/L)	Cell squalene content (mg/g)
			YEH56	6.21	1.47
YEH56-mERG1(1)	6.16	13.03
			YEH56-mERG1(2)	6.12	12.89

<110>Institute of Microorganism, Academia Sinica, university, the Chinese Academy of Sciences

<120>a kind of method for improving squalene content in yeast

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 2637

<212> DNA

<213>artificial sequence

<400> 1

tgaccacttg attggtctgg gggtcctaca acttgatttt atcgttgaaa acaagaatat 60

agacagcctt cttgccaact cttatttgca ccagcaaaga ggcggtgcaa tcatcagtaa 120

tacaggactt gtctcgcaag atacgaccaa gccgtactac gttcgggatt taatcttctc 180

gcagtctgca ggcgccttga gatttgcgtt cggcctaaac gtttgctcca caaacgtgaa 240

tggtatgaac atggacatga gcgtggttca gggcactcta cgggatcgtg gcgaatggga 300

atcgttctgc aagctcttct accaaaccat cggcgaattt gcgtcgcttt aatgcgatac 360

tgccgtagcg ggcctaaagg caagcagtgt atcggacaga gctgatataa cacaatacgc 420

tcgtagtcga tgcatgccgt ggctgctctc ggtcgggtat aagtcttaga caatagtctt 480

acctcgcatg tataataaat cttttgtatt taatctatta tatgtttcta tgcttttttt 540

tcctattgtt gtttgctttt ccttttcctt atttctttct agcttctaat tttctttctt 600

tttttttttt ttttcattga aaattatata tatatatata tatcagaaca attgtccagt 660

attgaacaat acaggttatt tcgaacaatt gaaaaaaaaa aatcacagaa aaacatatcg 720

agaaaagggt catgtctgct gttaacgttg cacctgaatt gattaatgcc gacaacacaa 780

ttacctacga tgcgattgtc atcggtgctg gtgttatcag tccatgtgtt gctactggtc 840

tagcaagaaa gggtaagaaa gttcttatcg tagaacgtga ctgggctatg cctgatagaa 900

ttgttggtga attgatgcaa ccaggtggtg ttagagcatt gagaagtctg ggtatgattc 960

aatctatcaa caacatcgaa gcatatcctg ttaccggtta taccgtcttt ttcaacggcg 1020

aacaagttga tattccatac ccttacaagg ccgatatccc taaagttgaa aaattgaagg 1080

acttggtcaa agatggtaat gacaaggtct tggaagacag cactattcac atcaaggatt 1140

acgaagatga tgaaagagaa aggggtgttg cttttgttca tggtagattc ttgaacaact 1200

tgagaaacat tactgctcaa gagccaaatg ttactagagt gcaaggtaac tgtattgaga 1260

tattgaagga tgaaaagaat gaggttgttg gtgccaaggt tgacattgat ggccgtggca 1320

aggtggaatt caaagcccac ttgacattta tctgtgacgg tatcttttca cgtttcagaa 1380

aggaattgca cccagaccat gttccaactg tcggttcttc gtttgtcggt atgtctttgt 1440

tcaatgctaa gaatcctgct cctatgcacg gtcacgttat tcttggtagt gatcatatgc 1500

caatcttggt ttaccaaatc agtccagaag aaacaagaat cctttgtgct tacaactctc 1560

caaaggtccc agctgatatc aagagttgga tgattaagga tgtccaacct ttcattccaa 1620

agagtctacg tccttcattt gatgaagccg tcagccaagg taaatttaga gctatgccaa 1680

actcctactt gccagctaga caaaacgacg tcactggtat gtgtgttatc ggtgacgctc 1740

taaatatgag acatccattg actggtggtg gtatgactgt cggtttgcat gatgttgtct 1800

tgttgattaa gaaaataggt gacctagact tcagcgaccg tgaaaaggtt ttggatgaat 1860

tactagacta ccatttcgaa agaaagagtt acgattccgt tattaacgtt ttgtcagtgg 1920

ctttgtattc tttgttcgct gctgacagcg ataacttgaa ggcattacaa aaaggttgtt 1980

tcaaatattt ccaaagaggt ggcgattgtg tcaacaaacc cgttgaattt ctgtctggtg 2040

tcttgccaaa gcctttgcaa ttgaccaggg ttttcttcgc tgtcgctttt tacaccattt 2100

acttgaacat ggaagaacgt ggtttcttgg gattaccaat ggctttattg gaaggtatta 2160

tgattttgat cacagctatt agagtattca ccccattttt gtttggtgag ttgattggtt 2220

aactacagct tataagggag agaggatagg aaccgtcaaa cattaagctg cacctttttt 2280

ttttattaca gaagtcggct tggaaggctt gtatagtaca ttacgataaa cacatcttat 2340

ttttatttat tacttattta ttttacatat tttcaaaaaa attcacatat catttattat 2400

taaccgaagt gttttatact ttttgttctt tccttaaaaa tgcctccaac agaaaaggaa 2460

aaatggcttg atatgcttca aaatatgcat tgagattcat attcggttat caattaacga 2520

tattacttcc ttaagtgata ttaaatcaag cttgccggat tctgcagtca gaattataca 2580

taatagtatt tgtgctctcg taaatccttt cagaattaca ccatagtagt ctttgtg 2637

<210> 2

<211> 2455

<212> DNA

<213>artificial sequence

<400> 2

tgctcattgc tatattgaag tacggattag aagccgccga gcgggtgaca gccctccgaa 60

ggaagactct cctccgtgcg tcctcgtctt caccggtcgc gttcctgaaa cgcagatgtg 120

cctcgcgccg cactgctccg aacaataaag attctacaat actagctttt atggttatga 180

agaggaaaaa ttggcagtaa cctggcccca caaaccttca aatgaacgaa tcaaattaac 240

aaccatagga tgataatgcg attagttttt tagccttatt tctggggtaa ttaatcagcg 300

aagcgatgat ttttgatcta ttaacagata tataaatgca aaaactgcat aaccacttta 360

actaatactt tcaacatttt cggtttgtat tacttcttat tcaaatgtaa taaaagtatc 420

aacaaaaaat tgttaatata cctctatact ttaacgtcaa ggagatggta agccgatacg 480

tacccgatat gggcgatctg atttgggttg attttgaccc gacaaaaggt agcgagcaag 540

ctggacatcg tccagctgtt gtcctgagtc ctttcatgta caacaacaaa acaggtatgt 600

gtctgtgtgt tccttgtaca acgcaatcaa aaggatatcc gttcgaagtt gttttatccg 660

gtcaggaacg tgatggcgta gcgttagctg atcaggtaaa aagtatcgcc tggcgggcaa 720

gaggagcaac gaagaaagga acagttgccc cagaggaatt acaactcatt aaagccaaaa 780

ttaacgtact gattgggtag tctagaacaa aaactcatct cagaagagga tctgaatagc 840

gccgtcgacc atcatcatca tcatcattga gttttagcct tagacatgac tgttcctcag 900

ttcaagttgg gcacttacga gaagaccggt cttgctagat tctaatcaag aggatgtcag 960

aatgccattt gcctgagaga tgcaggcttc atttttgata cttttttatt tgtaacctat 1020

atagtatagg attttttttg tcattttgtt tcttctcgta cgagcttgct cctgatcagc 1080

ctatctcgca gctgatgaat atcttgtggt aggggtttgg gaaaatcatt cgagtttgat 1140

gtttttcttg gtatttccca ctcctcttca gagtacagaa gattaagtga gaccttcgtt 1200

tgtgcggatc ccccacacac catagcttca aaatgtttct actccttttt tactcttcca 1260

gattttctcg gactccgcgc atcgccgtac cacttcaaaa cacccaagca cagcatacta 1320

aattttccct ctttcttcct ctagggtgtc gttaattacc cgtactaaag gtttggaaaa 1380

gaaaaaagag accgcctcgt ttctttttct tcgtcgaaaa aggcaataaa aatttttatc 1440

acgtttcttt ttcttgaaat tttttttttt agtttttttc tctttcagtg acctccattg 1500

atatttaagt taataaacgg tcttcaattt ctcaagtttc agtttcattt ttcttgttct 1560

attacaactt tttttacttc ttgttcatta gaaagaaagc atagcaatct aatctaaggg 1620

cggtgttgac aattaatcat cggcatagta tatcggcata gtataatacg acaaggtgag 1680

gaactaaacc atggccaagt tgaccagtgc cgttccggtg ctcaccgcgc gcgacgtcgc 1740

cggagcggtc gagttctgga ccgaccggct cgggttctcc cgggacttcg tggaggacga 1800

cttcgccggt gtggtccggg acgacgtgac cctgttcatc agcgcggtcc aggaccaggt 1860

ggtgccggac aacaccctgg cctgggtgtg ggtgcgcggc ctggacgagc tgtacgccga 1920

gtggtcggag gtcgtgtcca cgaacttccg ggacgcctcc gggccggcca tgaccgagat 1980

cggcgagcag ccgtgggggc gggagttcgc cctgcgcgac ccggccggca actgcgtgca 2040

cttcgtggcc gaggagcagg actgacacgt ccgacggcgg cccacgggtc ccaggcctcg 2100

gagatccgtc ccccttttcc tttgtcgata tcatgtaatt agttatgtca cgcttacatt 2160

cacgccctcc ccccacatcc gctctaaccg aaaaggaagg agttagacaa cctgaagtct 2220

aggtccctat ttattttttt atagttatgt tagtattaag aacgttattt atatttcaaa 2280

tttttctttt ttttctgtac agacgcgtgt acgcatgtaa cattatactg aaaaccttgc 2340

ttgagaaggt tttgggacgc tcgaaggctt taatttgcaa gctggagacc aacatgtgag 2400

caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggca tcgat 2455

<210> 3

<211> 3170

<212> DNA

<213>artificial sequence

<400> 3

cgttctgcaa gctcttctac caaaccatcg gcgaatttgc gtcgctgctc attgctatat 60

tgaagtacgg attagaagcc gccgagcggg tgacagccct ccgaaggaag actctcctcc 120

gtgcgtcctc gtcttcaccg gtcgcgttcc tgaaacgcag atgtgcctcg cgccgcactg 180

ctccgaacaa taaagattct acaatactag cttttatggt tatgaagagg aaaaattggc 240

agtaacctgg ccccacaaac cttcaaatga acgaatcaaa ttaacaacca taggatgata 300

atgcgattag ttttttagcc ttatttctgg ggtaattaat cagcgaagcg atgatttttg 360

atctattaac agatatataa atgcaaaaac tgcataacca ctttaactaa tactttcaac 420

attttcggtt tgtattactt cttattcaaa tgtaataaaa gtatcaacaa aaaattgtta 480

atatacctct atactttaac gtcaaggaga tggtaagccg atacgtaccc gatatgggcg 540

atctgatttg ggttgatttt gacccgacaa aaggtagcga gcaagctgga catcgtccag 600

ctgttgtcct gagtcctttc atgtacaaca acaaaacagg tatgtgtctg tgtgttcctt 660

gtacaacgca atcaaaagga tatccgttcg aagttgtttt atccggtcag gaacgtgatg 720

gcgtagcgtt agctgatcag gtaaaaagta tcgcctggcg ggcaagagga gcaacgaaga 780

aaggaacagt tgccccagag gaattacaac tcattaaagc caaaattaac gtactgattg 840

ggtagtctag aacaaaaact catctcagaa gaggatctga atagcgccgt cgaccatcat 900

catcatcatc attgagtttt agccttagac atgactgttc ctcagttcaa gttgggcact 960

tacgagaaga ccggtcttgc tagattctaa tcaagaggat gtcagaatgc catttgcctg 1020

agagatgcag gcttcatttt tgatactttt ttatttgtaa cctatatagt ataggatttt 1080

ttttgtcatt ttgtttcttc tcgtacgagc ttgctcctga tcagcctatc tcgcagctga 1140

tgaatatctt gtggtagggg tttgggaaaa tcattcgagt ttgatgtttt tcttggtatt 1200

tcccactcct cttcagagta cagaagatta agtgagacct tcgtttgtgc ggatccccca 1260

cacaccatag cttcaaaatg tttctactcc ttttttactc ttccagattt tctcggactc 1320

cgcgcatcgc cgtaccactt caaaacaccc aagcacagca tactaaattt tccctctttc 1380

ttcctctagg gtgtcgttaa ttacccgtac taaaggtttg gaaaagaaaa aagagaccgc 1440

ctcgtttctt tttcttcgtc gaaaaaggca ataaaaattt ttatcacgtt tctttttctt 1500

gaaatttttt tttttagttt ttttctcttt cagtgacctc cattgatatt taagttaata 1560

aacggtcttc aatttctcaa gtttcagttt catttttctt gttctattac aacttttttt 1620

acttcttgtt cattagaaag aaagcatagc aatctaatct aagggcggtg ttgacaatta 1680

atcatcggca tagtatatcg gcatagtata atacgacaag gtgaggaact aaaccatggc 1740

caagttgacc agtgccgttc cggtgctcac cgcgcgcgac gtcgccggag cggtcgagtt 1800

ctggaccgac cggctcgggt tctcccggga cttcgtggag gacgacttcg ccggtgtggt 1860

ccgggacgac gtgaccctgt tcatcagcgc ggtccaggac caggtggtgc cggacaacac 1920

cctggcctgg gtgtgggtgc gcggcctgga cgagctgtac gccgagtggt cggaggtcgt 1980

gtccacgaac ttccgggacg cctccgggcc ggccatgacc gagatcggcg agcagccgtg 2040

ggggcgggag ttcgccctgc gcgacccggc cggcaactgc gtgcacttcg tggccgagga 2100

gcaggactga cacgtccgac ggcggcccac gggtcccagg cctcggagat ccgtccccct 2160

tttcctttgt cgatatcatg taattagtta tgtcacgctt acattcacgc cctcccccca 2220

catccgctct aaccgaaaag gaaggagtta gacaacctga agtctaggtc cctatttatt 2280

tttttatagt tatgttagta ttaagaacgt tatttatatt tcaaattttt cttttttttc 2340

tgtacagacg cgtgtacgca tgtaacatta tactgaaaac cttgcttgag aaggttttgg 2400

gacgctcgaa ggctttaatt tgcaagctgg agaccaacat gtgagcaaaa ggccagcaaa 2460

aggccaggaa ccgtaaaaag gccgcgttgc tggcatcgat gatcgtggcg aatgggaatc 2520

gttctgcaag ctcttctacc aaaccatcgg cgaatttgcg tcgctttaat gcgatactgc 2580

cgtagcgggc ctaaaggcaa gcagtgtatc ggacagagct gatataacac aatacgctcg 2640

tagtcgatgc atgccgtggc tgctctcggt cgggtataag tcttagacaa tagtcttacc 2700

tcgcatgtat aataaatctt ttgtatttaa tctattatat gtttctatgc ttttttttcc 2760

tattgttgtt tgcttttcct tttccttatt tctttctagc ttctaatttt ctttcttttt 2820

tttttttttt tcattgaaaa ttatatatat atatatatat cagaacaatt gtccagtatt 2880

gaacaataca ggttatttcg aacaattgaa aaaaaaaaat cacagaaaaa catatcgaga 2940

aaagggtcat gtctgctgtt aacgttgcac ctgaattgat taatgccgac aacacaatta 3000

cctacgatgc gattgtcatc ggtgctggtg ttatcagtcc atgtgttgct actggtctag 3060

caagaaaggg taagaaagtt cttatcgtag aacgtgactg ggctatgcct gatagaattg 3120

ttggtgaatt gatgcaacca ggtggtgtta gagcattgag aagtctgggt 3170

<210> 4

<211> 2663

<212> DNA

<213>yeast

<400> 4

tgaccacttg attggtctgg gggtcctaca acttgatttt atcgttgaaa acaagaatat 60

agacagcctt cttgccaact cttatttgca ccagcaaaga ggcggtgcaa tcatcagtaa 120

tacaggactt gtctcgcaag atacgaccaa gccgtactac gttcgggatt taatcttctc 180

gcagtctgca ggcgccttga gatttgcgtt cggcctaaac gtttgctcca caaacgtgaa 240

tggtatgaac atggacatga gcgtggttca gggcactcta cgggatcgtg gcgaatggga 300

atcgttctgc aagctcttct accaaaccat cggcgaattt gcgtcgcttt aatgcgatac 360

tgccgtagcg ggccttcgta tagctcggcc gagctcgtac aaaaggcaag cagtgtatcg 420

gacagagctg atataacaca atacgctcgt agtcgatgca tgccgtggct gctctcggtc 480

gggtataagt cttagacaat agtcttacct cgcatgtata ataaatcttt tgtatttaat 540

ctattatatg tttctatgct tttttttcct attgttgttt gcttttcctt ttccttattt 600

ctttctagct tctaattttc tttctttttt tttttttttt cattgaaaat tatatatata 660

tatatatatc agaacaattg tccagtattg aacaatacag gttatttcga acaattgaaa 720

aaaaaaaatc acagaaaaac atatcgagaa aagggtcatg tctgctgtta acgttgcacc 780

tgaattgatt aatgccgaca acacaattac ctacgatgcg attgtcatcg gtgctggtgt 840

tatcggtcca tgtgttgcta ctggtctagc aagaaagggt aagaaagttc ttatcgtaga 900

acgtgactgg gctatgcctg atagaattgt tggtgaattg atgcaaccag gtggtgttag 960

agcattgaga agtctgggta tgattcaatc tatcaacaac atcgaagcat atcctgttac 1020

cggttatacc gtctttttca acggcgaaca agttgatatt ccataccctt acaaggccga 1080

tatccctaaa gttgaaaaat tgaaggactt ggtcaaagat ggtaatgaca aggtcttgga 1140

agacagcact attcacatca aggattacga agatgatgaa agagaaaggg gtgttgcttt 1200

tgttcatggt agattcttga acaacttgag aaacattact gctcaagagc caaatgttac 1260

tagagtgcaa ggtaactgta ttgagatatt gaaggatgaa aagaatgagg ttgttggtgc 1320

caaggttgac attgatggcc gtggcaaggt ggaattcaaa gcccacttga catttatctg 1380

tgacggtatc ttttcacgtt tcagaaagga attgcaccca gaccatgttc caactgtcgg 1440

ttcttcgttt gtcggtatgt ctttgttcaa tgctaagaat cctgctccta tgcacggtca 1500

cgttattctt ggtagtgatc atatgccaat cttggtttac caaatcagtc cagaagaaac 1560

aagaatcctt tgtgcttaca actctccaaa ggtcccagct gatatcaaga gttggatgat 1620

taaggatgtc caacctttca ttccaaagag tctacgtcct tcatttgatg aagccgtcag 1680

ccaaggtaaa tttagagcta tgccaaactc ctacttgcca gctagacaaa acgacgtcac 1740

tggtatgtgt gttatcggtg acgctctaaa tatgagacat ccattgactg gtggtggtat 1800

gactgtcggt ttgcatgatg ttgtcttgtt gattaagaaa ataggtgacc tagacttcag 1860

cgaccgtgaa aaggttttgg atgaattact agactaccat ttcgaaagaa agagttacga 1920

ttccgttatt aacgttttgt cagtggcttt gtattctttg ttcgctgctg acagcgataa 1980

cttgaaggca ttacaaaaag gttgtttcaa atatttccaa agaggtggcg attgtgtcaa 2040

caaacccgtt gaatttctgt ctggtgtctt gccaaagcct ttgcaattga ccagggtttt 2100

cttcgctgtc gctttttaca ccatttactt gaacatggaa gaacgtggtt tcttgggatt 2160

accaatggct ttattggaag gtattatgat tttgatcaca gctattagag tattcacccc 2220

atttttgttt ggtgagttga ttggttaact acagcttata agggagagag gataggaacc 2280

gtcaaacatt aagctgcacc tttttttttt attacagaag tcggcttgga aggcttgtat 2340

agtacattac gataaacaca tcttattttt atttattact tatttatttt acatattttc 2400

aaaaaaattc acatatcatt tattattaac cgaagtgttt tatacttttt gttctttcct 2460

taaaaatgcc tccaacagaa aaggaaaaat ggcttgatat gcttcaaaat atgcattgag 2520

attcatattc ggttatcaat taacgatatt acttccttaa gtgatattaa atcaagcttg 2580

ccggattctg cagtcagaat tatacataat agtatttgtg ctctcgtaaa tcctttcaga 2640

attacaccat agtagtcttt gtg 2663

<210> 5

<211> 496

<212> PRT

<213>yeast

<400> 5

Met Ser Ala Val Asn Val Ala Pro Glu Leu Ile Asn Ala Asp Asn Thr

1 5 10 15

Ile Thr Tyr Asp Ala Ile Val Ile Gly Ala Gly Val Ile Gly Pro Cys

20 25 30

Val Ala Thr Gly Leu Ala Arg Lys Gly Lys Lys Val Leu Ile Val Glu

35 40 45

Arg Asp Trp Ala Met Pro Asp Arg Ile Val Gly Glu Leu Met Gln Pro

50 55 60

Gly Gly Val Arg Ala Leu Arg Ser Leu Gly Met Ile Gln Ser Ile Asn

65 70 75 80

Asn Ile Glu Ala Tyr Pro Val Thr Gly Tyr Thr Val Phe Phe Asn Gly

85 90 95

Glu Gln Val Asp Ile Pro Tyr Pro Tyr Lys Ala Asp Ile Pro Lys Val

100 105 110

Glu Lys Leu Lys Asp Leu Val Lys Asp Gly Asn Asp Lys Val Leu Glu

115 120 125

Asp Ser Thr Ile His Ile Lys Asp Tyr Glu Asp Asp Glu Arg Glu Arg

130 135 140

Gly Val Ala Phe Val His Gly Arg Phe Leu Asn Asn Leu Arg Asn Ile

145 150 155 160

Thr Ala Gln Glu Pro Asn Val Thr Arg Val Gln Gly Asn Cys Ile Glu

165 170 175

Ile Leu Lys Asp Glu Lys Asn Glu Val Val Gly Ala Lys Val Asp Ile

180 185 190

Asp Gly Arg Gly Lys Val Glu Phe Lys Ala His Leu Thr Phe Ile Cys

195 200 205

Asp Gly Ile Phe Ser Arg Phe Arg Lys Glu Leu His Pro Asp His Val

210 215 220

Pro Thr Val Gly Ser Ser Phe Val Gly Met Ser Leu Phe Asn Ala Lys

225 230 235 240

Asn Pro Ala Pro Met His Gly His Val Ile Leu Gly Ser Asp His Met

245 250 255

Pro Ile Leu Val Tyr Gln Ile Ser Pro Glu Glu Thr Arg Ile Leu Cys

260 265 270

Ala Tyr Asn Ser Pro Lys Val Pro Ala Asp Ile Lys Ser Trp Met Ile

275 280 285

Lys Asp Val Gln Pro Phe Ile Pro Lys Ser Leu Arg Pro Ser Phe Asp

290 295 300

Glu Ala Val Ser Gln Gly Lys Phe Arg Ala Met Pro Asn Ser Tyr Leu

305 310 315 320

Pro Ala Arg Gln Asn Asp Val Thr Gly Met Cys Val Ile Gly Asp Ala

325 330 335

Leu Asn Met Arg His Pro Leu Thr Gly Gly Gly Met Thr Val Gly Leu

340 345 350

His Asp Val Val Leu Leu Ile Lys Lys Ile Gly Asp Leu Asp Phe Ser

355 360 365

Asp Arg Glu Lys Val Leu Asp Glu Leu Leu Asp Tyr His Phe Glu Arg

370 375 380

Lys Ser Tyr Asp Ser Val Ile Asn Val Leu Ser Val Ala Leu Tyr Ser

385 390 395 400

Leu Phe Ala Ala Asp Ser Asp Asn Leu Lys Ala Leu Gln Lys Gly Cys

405 410 415

Phe Lys Tyr Phe Gln Arg Gly Gly Asp Cys Val Asn Lys Pro Val Glu

420 425 430

Phe Leu Ser Gly Val Leu Pro Lys Pro Leu Gln Leu Thr Arg Val Phe

435 440 445

Phe Ala Val Ala Phe Tyr Thr Ile Tyr Leu Asn Met Glu Glu Arg Gly

450 455 460

Phe Leu Gly Leu Pro Met Ala Leu Leu Glu Gly Ile Met Ile Leu Ile

465 470 475 480

Thr Ala Ile Arg Val Phe Thr Pro Phe Leu Phe Gly Glu Leu Ile Gly

485 490 495

Claims (10)

1. the preparation method of squalene, content and/or activity including reducing squalene epoxidase in the microorganism that sets out, will To microorganism be named as mutant microbial, cultivate the mutant microbial and obtain squalene.

2. according to the method described in claim 1, it is characterized by: described reduce squalene epoxidase in the microorganism that sets out Content and/or activity are including 1) and/or 2) and/or 3):

1) the sterol response element sequence for knocking out and/or being mutated in the squalene epoxidase encoding gene promoters；

It 2) is dilute in the microorganism that sets out by least one codon mutation in the squalene epoxidase encoding gene There is codon；

3) amino acid residue being mutated in the squalene epoxidase makes the activity decline of the squalene epoxidase.

3. according to the method described in claim 2, it is characterized by: the sterol response element sequence is SEQ ID in sequence table 376-401 of No.4.

4. according to the method in claim 2 or 3, it is characterised in that: 1) be by the squalene epoxidase encoding gene 376-401 of SEQ ID No.4 deletions in sequence table in promoter；

2) to be in the microorganism that sets out by the codon mutation of glycine in the squalene epoxidase encoding gene Rare codon；

It 3) is that the glycine residue in the squalene epoxidase is sported into serine residue.

5. according to the method described in claim 4, it is characterized by: the rare codon is AGT.

6. method according to claim 4 or 5, it is characterised in that: the sequence of the squalene epoxidase is sequence table Middle SEQ ID No.5,2) it is that will encode the 30th of the squalene epoxidase in the squalene epoxidase encoding gene The codon mutation of the glycine of position is the rare codon of the serine described in microorganism that sets out, 3) it is by the spiny dogfish The 30th glycine residue sports serine residue in alkene Cycloxygenase.

7. any method in -6 according to claim 1, it is characterised in that: the microorganism that sets out is a1) or a2):

A1) yeast；

A2) saccharomyces cerevisiae.

8. following X1)-X3) in any product:

X1) DNA fragmentation, be following X11) X12) or X13):

X11) sterol in the squalene epoxidase encoding gene promoters is rung in any the method for claim 1-7 The DNA fragmentation obtained after answering element sequences to knock out and/or be mutated；

X12) by least one password in the squalene epoxidase encoding gene in any the method for claim 1-7 Son sports the DNA fragmentation that the rare codon of codon described in microorganism that sets out obtains；

X13) contain X11) and DNA fragmentation X12)；

X2 the 30th in squalene epoxidase shown in SEQ ID No.5 in sequence table glycine residue) is sported into silk The protein that histidine residue obtains；

X3) any mutant microbial in claim 1-7.

9. product according to claim 8, it is characterised in that: X11) DNA fragmentation is SEQ ID No.1 in sequence table 353-731 shown in DNA fragmentation；

X12) DNA fragmentation is DNA fragmentation shown in 732-2222 of SEQ ID No.1 in sequence table；

X13) DNA fragmentation is DNA fragmentation shown in SEQ ID No.1 in sequence table.

10. product described in claim 8 or 9 is preparing the application in squalene.