CN110452891A - A kind of penicillium expansum cis-Epoxysuccinate hydrolase gene and its application - Google Patents

A kind of penicillium expansum cis-Epoxysuccinate hydrolase gene and its application Download PDF

Info

Publication number
CN110452891A
CN110452891A CN201910660551.3A CN201910660551A CN110452891A CN 110452891 A CN110452891 A CN 110452891A CN 201910660551 A CN201910660551 A CN 201910660551A CN 110452891 A CN110452891 A CN 110452891A
Authority
CN
China
Prior art keywords
cis
salt
penicillium expansum
tartaric acid
epoxysuccinate hydrolase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910660551.3A
Other languages
Chinese (zh)
Other versions
CN110452891B (en
Inventor
鲍文娜
刘士旺
陈怡�
廖鸿秀
黄倩倩
房蕊
黄温迪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang Lover Health Science and Technology Development Co Ltd
Zhejiang University of Science and Technology ZUST
Original Assignee
Zhejiang Lover Health Science and Technology Development Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang Lover Health Science and Technology Development Co Ltd filed Critical Zhejiang Lover Health Science and Technology Development Co Ltd
Priority to CN201910660551.3A priority Critical patent/CN110452891B/en
Publication of CN110452891A publication Critical patent/CN110452891A/en
Application granted granted Critical
Publication of CN110452891B publication Critical patent/CN110452891B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N11/00—Carrier-bound or immobilised enzymes; Carrier-bound or immobilised microbial cells; Preparation thereof
    • C12N11/02—Enzymes or microbial cells immobilised on or in an organic carrier
    • C12N11/10—Enzymes or microbial cells immobilised on or in an organic carrier the carrier being a carbohydrate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y303/00—Hydrolases acting on ether bonds (3.3)
    • C12Y303/02—Ether hydrolases (3.3.2)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

A kind of penicillium expansum cis-Epoxysuccinate hydrolase gene and its application, belong to technical field of bioengineering.One aspect of the present invention provides a kind of penicillium expansum cis-Epoxysuccinate hydrolase polypeptide and its encoding gene, on the other hand application of the encoding gene in production L (+)-tartaric acid or its salt is provided, it can be realized the high efficient expression of cis-Epoxysuccinate hydrolase using the present invention, lay a good foundation for industrialized production L (+)-tartaric acid.

Description

A kind of penicillium expansum cis-Epoxysuccinate hydrolase gene and its application
Technical field
The invention belongs to technical field of bioengineering, and in particular to a kind of penicillium expansum cis-Epoxysuccinate hydrolase base Cause and its application.
Background technique
Tartaric acid, a kind of α-carboxylic acid also known as 2,3- dihydroxysuccinic acid or 2,3- dyhydrobutanedioic acid.1769, Sweden Chemist Carl Wilhelm Scheele is most early in having found that L (+)-tartaric acid is deposited in the leftover bits and pieces arcilla of grape wine Therefore named " tartaric acid ".L (+)-tartaric acid is widely present in nature, therefore be otherwise known as " Threaric acid ", especially sieve Content is higher in shop sign in the form of a streamer fruit and grape, is important food emulsifying agent, beverage acid, medical resolving agent, calcium sulphate retarder, print Resist agent, photographic developer, metal polish are contaminated, is widely used in food industry, medication chemistry and construction industry.Microorganism turns Change method is current L (+)-tartaric acid industrialized production main stream approach, i.e., using cis-butenedioic anhydride as raw material, passes through hydrolysis and epoxidation reaction Become cis-form epoxy succinic acid or its salt, then utilize the microorganism containing cis-Epoxysuccinate hydrolase, biocatalysis is suitable Formula Epoxysuccinic acid or its salt generate L (+)-tartaric acid or its salt.
It is reported at present to can be used for producing L (+)-tartaric acid or the microorganism of its salt and have: Nocardia (Nocardia), Corynebacterium (Coryncbacterium), Rhod (Rhodococcus), rhizobium (Rhizobium), pseudomonas (Pseudomonas), achromobacter (Achromobacter), acetobacter (Acetobacter), Agrobacterium (Agrobacterium), alcaligenes (Alcaligenes), acinetobacter (Acinetobacter), Klebsiella (Klebsiella) and double end bacterium (Labrys).Wherein, Nocard's bacillus is derived from The gene order of the cis-Epoxysuccinate hydrolase of category, Rhod and Klebsiella and its amino acid sequence of coding It has been reported that and constructing genetic engineering bacterium, the production for L (+)-tartaric acid or its salt.These reported production L (+)-wine The strain of stone acid or its salt is bacterium, has no and produces L (+)-tartaric acid or the report of its salt using fungi.
It is generally believed that microbe transformation method production L (+)-tartaric acid has, enzyme stereocpecificity is good, enzymatic reaction is fast, produces The features such as product optical purity and product yield are high, separation and purification of products is simple and easy.But due to enzyme intrinsic in microbial body System is extremely complex, and the expression quantity of cis-Epoxysuccinate hydrolase is not high, and activity is also by extracellular many factors intracellular It restricts, causes L (+)-tartaric acid production efficiency low.There is cis-Epoxysuccinate hydrolase using technique for gene engineering building The high efficient expression of cis-Epoxysuccinate hydrolase may be implemented in the genetic engineering bacterium of gene, this also becomes industrial production L (+)- The key of tartaric acid.
Summary of the invention
In view of the problems of the existing technology, it is an object of the invention to design to provide a kind of cis- epoxy succinic of aspergillus niger Sour hydrolase gene and its technical solution of application.
The present invention is realized especially by following technical scheme:
A kind of penicillium expansum cis-Epoxysuccinate hydrolase polypeptide, it is characterised in that the amino acid sequence of the polypeptide Are as follows:
1) amino acid sequence shown in SEQ ID No.2；Or
2) amino acid sequence shown in SEQ ID No.2 is replaced, one or several amino acid residue shapes is deleted and/or added At the amino acid sequence with same function.
A kind of penicillium expansum cis-Epoxysuccinate hydrolase polypeptide is in production L (+)-tartaric acid or its salt Using.
The gene of the coding penicillium expansum cis-Epoxysuccinate hydrolase polypeptide, it is characterised in that its nucleotides sequence It is classified as:
1) nucleotide shown in SEQ ID No.1；Or
2) nucleotide sequence shown in SEQ ID No.1 is substituted one or several nucleotide, and it is cis- to obtain coding penicillium expansum The gene order of Epoxysuccinic acid hydrolysis enzyme polypeptide.
The encoding gene produces the application in L (+)-tartaric acid or its salt in regulating and controlling microbial.
The recombinant expression carrier comprising coding penicillium expansum cis-Epoxysuccinate hydrolase polypeptide gene.
The recombinant microorganism bacterial strain of the expression penicillium expansum cis-Epoxysuccinate hydrolase polypeptide.
A kind of method of production L (+)-tartaric acid or its salt utilizes the cis- epoxy succinic of penicillium expansum Sour water solution enzyme polypeptide and cis-form epoxy succinic acid or its reactant salt.
A kind of method of production L (+)-tartaric acid or its salt, using the recombinant microorganism bacterial strain with it is cis- Epoxysuccinic acid or its reactant salt.
A kind of method of production L (+)-tartaric acid or its salt, it is characterised in that specifically:
1) recombinant microorganism bacterial strain is cultivated in suitable culture medium；
2) by the cell of recombinant microorganism bacterial strain, cell extract or cell-free extract obtained in step 1) or by described heavy The cis-Epoxysuccinate hydrolase of group microbial strains purifying is fixed on solid support or is embedded in immobilization carrier；
3) by prepared product obtained in recombinant microorganism bacterial strain obtained in step 1) or step 2 and cis-form epoxy succinic acid or Its salt reacts under conditions of being suitable for hydrolysis to produce L (+)-tartaric acid or its salt；With
4) enzyme and/or cell of above-mentioned fixation or embedding are optionally reused.
One aspect of the present invention provides a kind of penicillium expansum cis-Epoxysuccinate hydrolase polypeptide and its encoding gene, separately On the one hand application of the encoding gene in production L (+)-tartaric acid or its salt is provided, can be realized using the present invention cis- The high efficient expression of Epoxysuccinic acid hydrolase is laid a good foundation for industrialized production L (+)-tartaric acid.
Detailed description of the invention
Fig. 1 is SDS- polyacrylamide gel electricity of the recombination engineering after IPTG is induced in the embodiment of the present invention 4 Swimming result.
Specific embodiment
Further to illustrate that the present invention to reach the technical means and efficacy that predetermined goal of the invention is taken, ties below Close preferred embodiment, polypeptide to the encoding gene of cis-Epoxysuccinate hydrolase proposed according to the present invention, its coding and Its related application its specific embodiment, structure, feature and its effect, detailed description is as follows.Integral Thought of the invention includes The following: isolating and purifying cis-Epoxysuccinate hydrolase from penicillium expansum fermentation liquid, hydrolyzes to cis-form epoxy succinic acid The end N- and the end C- of enzyme are sequenced, and degenerate primer are designed according to the amino acid sequence of this end N- and the end C-, from expansion Cis-Epoxysuccinate hydrolase gene is cloned in Penicillium patulum, constructs prokaryotic expression carrier, converts Escherichia coli, it is cis- to being transferred to The Escherichia coli of Epoxysuccinic acid hydrolase gene are cultivated, and the function of cis-Epoxysuccinate hydrolase gene is verified.With Upper each point is all separate embodiments, below with reference to specific embodiment and attached drawing is cooperated to be described in further detail.
Embodiment 1: penicillium expansum cis-Epoxysuccinate hydrolase isolates and purifies
The present invention use bacterial strain for penicillium expansum (Penicillium expansum) WH-3, which is preserved in the micro- life of China Object culture presevation administration committee common micro-organisms center (CGMCC), preservation registration number are CGMCC No.16798, are named as expansion Penicillium patulum (Penicillium expansum) WH-3, preservation day: on December 03rd, 2018, depositary institution address: court, Beijing Institute's (the postcode: 100101) of positive area's North Star West Road 1.
Take penicillium expansum (Penicillium expansum) WH-3 is stored in PDA slant medium, the slant medium Configuration method are as follows: weigh 200g peeling fresh potato, potato is cut into small pieces and is put into pot, adds water 1000ml, is heated to Boiling keeps 30min.It is filtered on measuring cup while hot with double gauze again, leaves filtrate.20g glucose and 15~20g is added Agar, and filtrate is supplemented to 1000ml, 121 DEG C of 20 min of high pressure sterilization.After the completion of sterilizing, crossed in ultraviolet disinfection ultra-clean Sterilized eggplant-shape bottle is poured on platform, after slant medium cooled and solidified in eggplant-shape bottle, is sealed against and indoor inversion puts one Night.If not having long bacterium on slant medium, it is spare to put it into 4 DEG C of refrigerators.
1: penicillium expansum cis-Epoxysuccinate hydrolase isolates and purifies
(1) on the slant medium for covering with the dense spore of penicillium expansum WH-3,5mL spore suspension is added, is scraped with inoculation shovel Spore is taken, washes down spore sufficiently, is filtered to remove mycelium with three layers of sterile lens wiping paper.The spore suspension formula of liquid is 0.1% Tween80 and 0.9% NaCl.
(2) filtered above-mentioned spore liquid is counted after diluting with blood counting chamber, by 1x106The concentration of a/mL is inoculated with Spore is into the 250mL conical flask for the seed culture medium that 50mL is housed, 25 DEG C of 150rpm 24~36h of shaken cultivation, obtains described Penicillium expansum bacterial strain seed liquor.Seed culture medium is self-control PDB culture medium, preparation method are as follows: weighs the fresh of 200g peeling Potato is cut into small pieces and is put into pot by potato, adds water 1000ml, is heated to boiling, and keeps 30min.Again while hot with double gauze It is filtered on measuring cup, leaves filtrate.10g glucose is added, and filtrate is supplemented to 1000ml, 121 DEG C of 20 min of high pressure sterilization.
(3) seed liquor of above-mentioned 20ml penicillium expansum is taken to be inoculated in the 1000mL conical flask equipped with 200mL culture medium, 25 DEG C 150rpm shaken cultivation 3 days, obtain corresponding penicillium expansum cell and fermentation liquid.Culture medium is yeast extract sugarcane Sugared (YSM) culture medium, preparation method are as follows: weigh 40g yeast extract, 160g sucrose adds distilled water to be settled to 1000ml, and 121 DEG C 20 min of high pressure sterilization.
(4) it is filtered to remove thallus, obtains fermentation liquid.
(5) add ammonium sulfate to 35% saturation degree in fermentation liquid, 10000rpm is centrifuged 20min, collects supernatant 1.
(6) in supernatant 1 plus ammonium sulfate is to 75% saturation degree, 10000rpm is centrifuged 20nin, collects and precipitates and with being pre-chilled The dissolution of 0.1mol/L kaliumphosphate buffer.
During which (7) 4 DEG C of 48h that dialyse in 0.1mol/L kaliumphosphate buffer replace 3~4 dialyzates.
(8) enzyme solution after dialysing crosses DEAE-Sepharose column, and crossing column efflux has enzyme activity.
(9) it crosses column efflux to be concentrated by ultrafiltration, obtains concentrate 1, will be concentrated, 1 crosses Pheny-Sepharose column, uses 0.1mol/L kaliumphosphate buffer (pH8.0) elution, collects the efflux with enzymatic activity, and be concentrated by ultrafiltration, obtains concentrate 2.
(10) concentrate 2 crosses MonoQ HR5/5 column, and is eluted with 0.1mol/L kaliumphosphate buffer (pH8.0), collects tool There is the efflux of enzymatic activity, and be concentrated by ultrafiltration, obtains concentrate 3.
(11) it takes concentrate 3 to carry out SDS- polyacrylamide gel electrophoresis, and is dyed with coomassie brilliant blue R250, as a result shown Show, the band in SDS- polyacrylamide gel electrophoresis glue of cis-Epoxysuccinate hydrolase after purification is single, and molecule Amount is about 30kDa.
2: the measurement of penicillium expansum cis-Epoxysuccinate hydrolase vigor
10 mL fermentation liquids are taken, sodium hydrogen cis-epoxysuccinate (pH8.0) solution of 1mL 1mol/L, 37 DEG C of reaction 1h, measurement is added The content of reaction solution mesotartaric acid.
The detection method of reaction solution mesotartaric acid content is as follows: taking the ammonium metavanadate solution of 2.5ml1%, is placed in a 25ml Volumetric flask in, after adding suitable above-mentioned reaction solution, then plus 1ml1mol/L sulfuric acid, 25ml is settled to distilled water, after mixing Light absorption value of a part at spectrophotometric determination 480nm is taken, and is calculated instead according to the L (+) of formulation-tartaric acid standard curve Answer the content of liquid mesotartaric acid.
L (+)-tartaric acid standard curve the production method is as follows: take 0.25g L-TARTARIC ACID sodium, be dissolved in 25ml distilled water In, L (+)-EWNN solution that concentration is 10 mg/ml is made.2.5ml1% is added in the volumetric flask of 11 25ml respectively Ammonium metavanadate solution, then take respectively 0ml, 0.1ml, 0.2ml, 0.3ml, 0.4ml, 0.5ml, 0.6ml, 0.7ml, 0.8ml, Above-mentioned L (+)-EWNN solution of 0.9ml, 1.0ml is added sequentially in above-mentioned 11 volumetric flasks, then is separately added into The sulfuric acid of 1ml1mol/L, is settled to 25ml with distilled water, takes a part its 480nm of spectrophotometric determination after mixing respectively The light absorption value at place makes L (+)-tartaric acid standard curve.
Enzyme-activity unit is defined as: under the above-described reaction conditions, enzyme needed for 1 mL fermentation liquid 1h generates 1 μm of ol tartaric acid Amount.
Embodiment 2: the end N- and the end C- of penicillium expansum cis-Epoxysuccinate hydrolase are sequenced
Penicillium expansum cis-Epoxysuccinate hydrolase -terminal amino acid sequence and C- terminal amino acid sequence pass through common Method detection, method are as follows: the cis-Epoxysuccinate hydrolase obtained after above-mentioned isolate and purify is carried out SDS- polypropylene After acrylamide gel electrophoresis, it is transferred on pvdf membrane by Western hybridization.The film is dyed with coomassie brilliant blue staining liquid, cutting The corresponding band of cis-Epoxysuccinate hydrolase simultaneously recycles, and then surveys its end N- and the end C- respectively with Protein Sequencer 10 amino acid sequences.Sequencing result shows that the amino acid sequence of the end N- 10 of the cis-Epoxysuccinate hydrolase is MSRDEPPSML (SEQ ID NO:3), the amino acid sequence of the end C- 10 are ARYFGIESEL (SEQ ID NO:4).
Embodiment 3: design degenerate primer, clonal expansion mould WH-3 cis-Epoxysuccinate hydrolase gene
According to N- end sequence (SEQ ID NO:3), the C- end sequence of above-mentioned penicillium expansum cis-Epoxysuccinate hydrolase It is as follows that (SEQ ID NO:4) and the termination codon subsequence (TAA/TGA/TAG) for not encoding amino acid design two degenerate primers:
Primer 1:5'-ATGWSNXGNGAYGARCCNCC-3'；
Primer 2: 5'-YYANAYYTCNYSYTCNATNCC -3'；
Wherein, R:A/G, Y:C/T, W:A/T, S:G/C, X:A/C, N:A/G/C/T.
The step of cloning cis-Epoxysuccinate hydrolase gene with degenerate primer is as follows:
(1) inoculating spores liquid is in homemade PDB culture medium, 25 DEG C of 150rpm shaken cultivation 48h, collects penicillium expansum ball, According to Ezup Column Fungi Genomic DNA Purification Kit(Sangon Biotech) described in side The genome of method pumping topic penicillium expansum WH-3.
(2) using above-mentioned genome as template, using primer 1 and primer 2 as primer, PCR reaction is carried out.PCR reaction system are as follows: 1 μ L, 10 × PCR buffer of the resulting template 2 μ L, Taq archaeal dna polymerase (5 Μ/μ L) of step 15 μ L, (the 10 μm of ol/ μ of primer 1 L) 1 μ L, primer 2 (10 μm of ol/ μ L) 1 μ L, dNTP (100mmol/L) 1 μ L, H239 μ L of O, 50 μ L of total volume.
(3) above-mentioned 50 μ L PCR reaction system carries out following PCR response procedures:
94 DEG C of preheating 5min；Then 94 DEG C of 50s, 46 DEG C of 30s, 72 DEG C of 1min, 30 circulations；Last 72 DEG C of extensions 10min.
(4) above-mentioned PCR product is taken to carry out Ago-Gel (1%) electrophoresis.Electrophoresis result shows, 750bp to 1000bp it Between have a clearly band.Recycle the band and and pUCmCarrier T connection, conversion enter bacillus coli DH 5 alpha, picking colony Carry out sequence verification.Sequencing result is as shown in SEQ ID NO:1, and the length is 801 nucleotide, and wherein ATG is initiation codon Son, TGA are terminator codon.Nucleotide sequence shown in SEQ ID NO:1 is translated into amino acid sequence using DNAStar software Column obtain (the amino acid sequence of cis-Epoxysuccinate hydrolase i.e. of the invention of the amino acid sequence as shown in SEQ ID NO:2 Column).By the encoding gene of cis-Epoxysuccinate hydrolase of the invention and amino acid sequence respectively with reported cis- ring Oxydisuccinic acid hydrolase sequences are compared, find they and cis-Epoxysuccinate hydrolase of the invention encoding gene and Amino acid sequence similarity is no more than 50%, thus illustrates, the coding of present invention cis-Epoxysuccinate hydrolase obtained Gene is a new gene.
Embodiment 4: the building of penicillium expansum cis-Epoxysuccinate hydrolase prokaryotic expression vector and its in large intestine Expression in bacillus
The forward primer 3 that contains I recognition site of restriction enzyme Nco according to sequence design shown in SEQ ID NO:1 and contain The sequence of the reverse primer 4 of I recognition site of restrictive restriction endonuclease BamH, primer 3 and primer 4 is respectively as follows:
Primer 3:5'- CATGCCATGGATATGTCACGGGATGAACCCC；
Primer 4:5'-CGGGATCCTCACAATTCACTTTCTATTCCAAAAT.
Using the genome of penicillium expansum WH-3 as template, primer 3 and primer 4 are primer, carry out PCR reaction.PCR reactant System are as follows: 1 μ L, 10 × PCR buffer of the resulting template 2 μ L, Taq archaeal dna polymerase (5 Μ/μ L) of 3 step 1 of embodiment, 5 μ L, Primer 3 (10 μm of ol/ μ L) 1 μ L, primer 4 (10 μm of ol/ μ L) 1 μ L, dNTP (100mmol/L) 1 μ L, H2O 39 μ L, 50 μ of total volume L。
Above-mentioned 50 μ LPCR reaction system carries out following PCR response procedures:
94 DEG C of preheating 5min；Then 94 DEG C of 50s, 50 DEG C of 30s, 72 DEG C of 1min, 30 circulations；Last 72 DEG C of extensions 10min.
Recycle PCR product and and pUCmCarrier T connection, conversion enter bacillus coli DH 5 alpha, and picking colony carries out sequencing and tests Card.Sequencing result is compared with the encoding gene (as shown in SEQ ID NO:1) of cis-Epoxysuccinate hydrolase, as a result Display: the encoding gene success of the cis-Epoxysuccinate hydrolase containing I recognition site of restriction enzyme Nco I and BamH It is inserted into pUCmCarrier T.Then with restriction enzyme Nco I and BamH I respectively to contain cis-Epoxysuccinate hydrolase base The pUC of causemCarrier T and pET-15b expression vector carry out double digestion, use T4The cis- epoxy amber that DNA ligase gets off digestion Amber acid hydrolase gene is attached with the pET-15b carrier after digestion, and connection product is converted e. coli bl21 (DE3), Picking colony is sequenced.Sequencing result is compared with cis-Epoxysuccinate hydrolase gene, sequence exact matching is said The bright pET-15b recombinant vector successfully constructed containing cis-Epoxysuccinate hydrolase gene and containing pET-15b recombination carry The genetic engineering bacterium of body.
As shown in Figure 1, this genetic engineering bacterium about exists after IPTG induction and SDS- polyacrylamide gel electrophoresis Have between 30kDa obvious band (swimming lane 1), the albumen size which shows with according to the cis-Epoxysuccinate hydrolase Amino acid sequence calculates resulting albumen size and is consistent；Containing only pET-15b carrier and without any extraneous nucleotide Insert Fragment E. coli bl21 (DE3) be control, it is no corresponding protein band (swimming lane 2), illustrate after IPTG is induced, cis- epoxy succinic The sour encoded recombinant protein energy high efficient expression of hydrolase gene.
Embodiment 5: L (+) tartaric acid is prepared using genetic engineering bacterium of the present invention
Genetic engineering bacterium described in embodiment 4 is in LB culture medium after 37 DEG C of shaken cultivation 12h, then transfers and cultivate into 1L LB In base, 37 DEG C, after 200rpm shaken cultivation about 2h, be added 0.1 M IPTG, 37 DEG C, 200rpm continue 8 h of shaken cultivation.LB training Support the formula of base are as follows: 1% tryptone, 0.5% yeast extract, 1% sodium chloride, pH7.0.It states in culture solution and is added then up Excessive CaCl is added after 37 DEG C of continuation, 200rpm vibrate 12h in 10g cis-form epoxy succinic acid disodium2Aqueous solution has precipitating to give birth to At.The product of precipitating is filtered, the precipitating being obtained by filtration is washed to obtain 14.0g calcium tartrate, then paratartaric acid Calcium successively carries out sulfuric acid solution, the purification of Yin and Yang ion exchange column, concentration, crystallization, separation and drying and obtains 6.5g solid product. Through the detection of Nicolet-Nexus670 Fourier transform formula infrared spectrometer, nuclear magnetic resonance Bruker Avance DMX500 core Magnetic resonance device hydrogen spectrum and the detection of carbon spectrum and Bruker Esquire 3000plusMass spectrograph detection determines that the solid product is winestone Acid.It is detected through WZZ-2B polarimeter, the specific rotatory power of the solid product is [α]=+12.1 °, it was demonstrated that the solid product is dextrorotation Type tartaric acid, i.e. L (+)-tartaric acid, and purity is 99.9%.
Cis-form epoxy succinic acid disodium in the present embodiment could alternatively be cis-form epoxy succinic acid or its with it is various sun from The salt that son is formed, cation include and are not limited only to ammonium ion, potassium ion, magnesium ion and calcium ion etc..
Embodiment 6: genetic engineering bacterium of the present invention is embedded using κ-carragheen and prepares L (+)-tartaric acid
By the medium centrifugal of embodiment 5 and genetic engineering bacterium cell is collected, the 10g genetic engineering bacterium cell is taken to be added to In 100mL 40g/L κ-carrageenan solutions, after mixing in 42 DEG C, 4 DEG C of coolings, after solidification with 0.3 M Klorvess Liquid in 4 DEG C of immersion 10h, gel is cut into small pieces, and is saved in 4 DEG C.Above-mentioned immobilized cell 30g is taken to be put into the cis- ring of 30mL 1.0M In two sodium solution of oxydisuccinic acid, after 37 DEG C of reactions for 24 hours, immobilized cell is recovered by filtration.It is water-soluble that CaCl2 is added in filtered fluid Liquid filters after being sufficiently stirred, washing precipitating, adds sulfuric acid solution precipitating, the purification of cation and anion exchange column, concentration, crystallization and dries It is dry to obtain L (+)-tartaric acid 3.8g.
The immobilized cell of recycling is placed into two sodium solution of 30ml 1.0M cis-form epoxy succinic acid, 37 DEG C of reactions After for 24 hours, immobilized cell is recovered by filtration.CaCl is added in filtered fluid2Aqueous solution filters after being sufficiently stirred, washing precipitating, Sulfuric acid solution precipitating, the purification of cation and anion exchange column, concentration, crystallization and drying is added to obtain L (+)-tartaric acid 3.9g.
It can be used repeatedly for the immobilized cell.
Cis-form epoxy succinic acid disodium in the present embodiment could alternatively be cis-form epoxy succinic acid or its with it is various sun from The salt that son is formed, cation include and are not limited only to ammonium ion, potassium ion, magnesium ion and calcium ion etc..
Although show and describing the present invention, ordinary skill in the art with reference to determination preferred embodiment of the invention Personnel will be appreciated that can be under the premise of without departing substantially from the present inventive concept and range being defined by the appended claims to this hair The bright modification carried out in various forms and details.
Sequence table
<110>Scientific and Technological Institutes Of Zhejiang
<120>a kind of penicillium expansum cis-Epoxysuccinate hydrolase gene and its application
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 801
<212> DNA
<213>penicillium expansum (Penicillium expansum)
<400> 1
atgtcacggg atgaaccccc ttcaatgcta tttttcgatg tcttggggac aattgtggaa 60
tggagatatt gcatcgcgaa cgaactgaat gccgccgcac aaaaggttct acaagaccaa 120
gctcgatctc cgagtcccga tatgcgagca cgtgtctccg atatgtccgc ttcgagctgg 180
caggagatct ccgaggaatg gcatcggtca tatatgaatt ttggagacaa ttacgataca 240
tctaagccct ttatgtcagt agatgagtac aaccgaattt cgctggaaga tattctcacc 300
aaatggcttc tccgtgattt atttaacgag gacgatctca aacatttgac gctcgcttgg 360
catcgacttg actcataccc tgacagtgcg ccgggtcttt cgttgctgaa tactaaattt 420
tcgacgtcta cattatccaa tgggaatgtt aaacttctcg aagacctaca aggacacaat 480
tctttgcctt tcacgcacat taccagtgca gagcacttca gggcttacaa accctcacca 540
gaggtctatg atggtgctgc tcgcagattc ggtttcaaga attcgcaatg ttgtctcgtc 600
gcagcccatc ttgaggactt gcaagctgct aagaaatgcg ggtttcaaac aatctatctc 660
gagagagagt tggaagaagc ttgggatagt agagacgttg cacgagctag agaagaaggt 720
gttgtcgatg tttgggttgg agttggaggc tcgggtctga ttgaagttgc tcgatatttt 780
ggaatagaaa gtgaattgtg a 801
<210> 2
<211> 266
<212> PRT
<213>penicillium expansum (Penicillium expansum)
<400> 2
Met Ser Arg Asp Glu Pro Pro Ser Met Leu Phe Phe Asp Val Leu Gly
1 5 10 15
Thr Ile Val Glu Trp Arg Tyr Cys Ile Ala Asn Glu Leu Asn Ala Ala
20 25 30
Ala Gln Lys Val Leu Gln Asp Gln Ala Arg Ser Pro Ser Pro Asp Met
35 40 45
Arg Ala Arg Val Ser Asp Met Ser Ala Ser Ser Trp Gln Glu Ile Ser
50 55 60
Glu Glu Trp His Arg Ser Tyr Met Asn Phe Gly Asp Asn Tyr Asp Thr
65 70 75 80
Ser Lys Pro Phe Met Ser Val Asp Glu Tyr Asn Arg Ile Ser Leu Glu
85 90 95
Asp Ile Leu Thr Lys Trp Leu Leu Arg Asp Leu Phe Asn Glu Asp Asp
100 105 110
Leu Lys His Leu Thr Leu Ala Trp His Arg Leu Asp Ser Tyr Pro Asp
115 120 125
Ser Ala Pro Gly Leu Ser Leu Leu Asn Thr Lys Phe Ser Thr Ser Thr
130 135 140
Leu Ser Asn Gly Asn Val Lys Leu Leu Glu Asp Leu Gln Gly His Asn
145 150 155 160
Ser Leu Pro Phe Thr His Ile Thr Ser Ala Glu His Phe Arg Ala Tyr
165 170 175
Lys Pro Ser Pro Glu Val Tyr Asp Gly Ala Ala Arg Arg Phe Gly Phe
180 185 190
Lys Asn Ser Gln Cys Cys Leu Val Ala Ala His Leu Glu Asp Leu Gln
195 200 205
Ala Ala Lys Lys Cys Gly Phe Gln Thr Ile Tyr Leu Glu Arg Glu Leu
210 215 220
Glu Glu Ala Trp Asp Ser Arg Asp Val Ala Arg Ala Arg Glu Glu Gly
225 230 235 240
Val Val Asp Val Trp Val Gly Val Gly Gly Ser Gly Leu Ile Glu Val
245 250 255
Ala Arg Tyr Phe Gly Ile Glu Ser Glu Leu
260 265
<210> 3
<211> 10
<212> PRT
<213>penicillium expansum (Penicillium expansum)
<400> 3
Met Ser Arg Asp Glu Pro Pro Ser Met Leu
1 5 10
<210> 4
<211> 10
<212> PRT
<213>penicillium expansum (Penicillium expansum)
<400> 4
Ala Arg Tyr Phe Gly Ile Glu Ser Glu Leu
1 5 10

Claims (9)

1. a kind of penicillium expansum cis-Epoxysuccinate hydrolase polypeptide, it is characterised in that the amino acid sequence of the polypeptide are as follows:
1) amino acid sequence shown in SEQ ID No.2；Or
2) amino acid sequence shown in SEQ ID No.2 is replaced, one or several amino acid residue shapes is deleted and/or added At the amino acid sequence with same function.
2. a kind of penicillium expansum cis-Epoxysuccinate hydrolase polypeptide as described in claim 1 is in production L (+)-tartaric acid Or the application in its salt.
3. encoding the gene of penicillium expansum cis-Epoxysuccinate hydrolase polypeptide described in claim 1, it is characterised in that its Nucleotide sequence are as follows:
1) nucleotide shown in SEQ ID No.1；Or
2) nucleotide sequence shown in SEQ ID No.1 is substituted one or several nucleotide, and it is cis- to obtain coding penicillium expansum The gene order of Epoxysuccinic acid hydrolysis enzyme polypeptide.
4. encoding gene as claimed in claim 3 produces the application in L (+)-tartaric acid or its salt in regulating and controlling microbial.
5. the recombinant expression carrier comprising encoding gene described in claim 3.
6. expressing the recombinant microorganism bacterial strain of penicillium expansum cis-Epoxysuccinate hydrolase polypeptide as described in claim 1.
7. a kind of method of production L (+)-tartaric acid or its salt, it is characterised in that suitable using penicillium expansum described in claim 1 Formula Epoxysuccinic acid hydrolyzes enzyme polypeptide and cis-form epoxy succinic acid or its reactant salt.
8. a kind of method of production L (+)-tartaric acid or its salt, it is characterised in that utilize recombinant microorganism as claimed in claim 6 Bacterial strain and cis-form epoxy succinic acid or its reactant salt.
9. the method for a kind of production L (+)-tartaric acid as claimed in claim 8 or its salt, it is characterised in that specifically:
1) recombinant microorganism bacterial strain is cultivated in suitable culture medium；
2) by the cell of recombinant microorganism bacterial strain, cell extract or cell-free extract obtained in step 1) or by described heavy The cis-Epoxysuccinate hydrolase of group microbial strains purifying is fixed on solid support or is embedded in immobilization carrier；
3) by prepared product obtained in recombinant microorganism bacterial strain obtained in step 1) or step 2 and cis-form epoxy succinic acid or Its salt reacts under conditions of being suitable for hydrolysis to produce L (+)-tartaric acid or its salt；With
4) enzyme and/or cell of above-mentioned fixation or embedding are optionally reused.
CN201910660551.3A 2019-07-22 2019-07-22 Penicillium expansum cis-epoxy succinate hydrolase gene and application thereof Active CN110452891B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910660551.3A CN110452891B (en) 2019-07-22 2019-07-22 Penicillium expansum cis-epoxy succinate hydrolase gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910660551.3A CN110452891B (en) 2019-07-22 2019-07-22 Penicillium expansum cis-epoxy succinate hydrolase gene and application thereof

Publications (2)

Publication Number Publication Date
CN110452891A true CN110452891A (en) 2019-11-15
CN110452891B CN110452891B (en) 2021-08-03

Family

ID=68481628

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910660551.3A Active CN110452891B (en) 2019-07-22 2019-07-22 Penicillium expansum cis-epoxy succinate hydrolase gene and application thereof

Country Status (1)

Country Link
CN (1) CN110452891B (en)

Also Published As

Publication number Publication date
CN110452891B (en) 2021-08-03

Similar Documents

Publication Publication Date Title
CN112831485B (en) Low-temperature activity improved exoinulase mutant MutDR121EH9
CN105296456B (en) A kind of stability-enhanced glutamic acid decarboxylase enzyme mutant of pH and its application
CN106754610B (en) Recombinant engineering bacterium for surface display expression of glutamate decarboxylase and construction method and application thereof
CN103614398B (en) The encoding gene of cis-Epoxysuccinic acid hydratase, the polypeptide of its coding and related application thereof
CN106967659A (en) A kind of structure and fermentation process of the antibiotic-free resistance recombined bacillus subtilis for expressing glutamate decarboxylase
CN109777793B (en) GDSL lipase, genetically engineered bacterium and application thereof
CN101481681B (en) Method for producing D(-)-tartaric acid or salt thereof by using gene engineering bacteria
CN107893060A (en) A kind of marine bacteria source thermostabilization salt tolerant SGNH family&#39;s hydrolases and application
CN107177607A (en) Bacillus subtilis BS04 urate oxidase gene and application thereof
CN105018443B (en) A kind of epoxide hydrolase mutant and preparation method thereof
CN102978220B (en) Epoxide hydrolase enzyme gene and encoding enzyme and carrier and engineering bacteria and application
CN113106044A (en) Streptomyces modified bacterium and application thereof in feather degradation
CN112980815B (en) alpha-L-fucosidase OUCJdch-16 and application thereof
CN112251428A (en) Glutamic acid decarboxylase mutant and application thereof in production of gamma-aminobutyric acid
CN103992992A (en) Coding gene of (+) gamma-lactamase in Sulfolobus solfataricus P2, and application thereof
CN110452891A (en) A kind of penicillium expansum cis-Epoxysuccinate hydrolase gene and its application
CN111172089A (en) Method for synthesizing trehalose by using recombinant trehalose synthase
CN106635941A (en) Thermophilic esterase derived from aquifex aeolicus strain and functional verification of thermophilic esterase
CN106544336A (en) A kind of nitrile hydratase improved by aliphatic dintrile regioselectivity
CN110468115B (en) Aspergillus niger cis-epoxy succinate hydrolase gene and application thereof
CN103382464B (en) Derive from the Ntn hydrolase of the ancient bacterium of hyperthermophilic and encoding gene thereof and application
CN112725315B (en) Application of chitosanase and mutant thereof in preparation of chitosan oligosaccharide
CN106754848B (en) Alkaline pectinase mutant with improved thermal stability
CN113481186B (en) GH18 chitinase ChiA and application thereof
CN109609485A (en) A kind of chitin deacetylase and its application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant