CN110438106A - The nanometer lysozyme of engineer a kind of and the preparation method of nanometer lysozyme - Google Patents
The nanometer lysozyme of engineer a kind of and the preparation method of nanometer lysozyme Download PDFInfo
- Publication number
- CN110438106A CN110438106A CN201910721309.2A CN201910721309A CN110438106A CN 110438106 A CN110438106 A CN 110438106A CN 201910721309 A CN201910721309 A CN 201910721309A CN 110438106 A CN110438106 A CN 110438106A
- Authority
- CN
- China
- Prior art keywords
- lysozyme
- nanometer
- amino acid
- engineer
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/89—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microinjection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2462—Lysozyme (3.2.1.17)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01017—Lysozyme (3.2.1.17)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The embodiment of the present invention discloses the nanometer lysozyme and preparation method of a kind of engineer.The protein amino acid sequence of the nanometer lysozyme are as follows:
Description
Technical field
The present invention relates to the nanometer lysozymes and nanometer lysozyme of chemical material field more particularly to a kind of engineer
Preparation method.
Background technique
Currently, the functionality of material is more and more paid attention to, especially with the material of sterilizing function.
Lysozyme is a kind of protein that can hydrolyze glutinous polysaccharide.Bacteria cell wall is mainly by -acetylmuramic acid and N- acetyl
β -1,4 glycosidic bond between aminoglucose is constituted.Lysozyme can make the insoluble glutinous polysaccharide of cell wall resolve into soluble glycopeptide,
Lead to cell wall rupture, reaches sterilization functions.In addition, lysozyme can also be bound directly with negatively charged virus protein, make disease
Poison inactivation.
Lysozyme is present in various organisms, including mammal and microorganism, such as: in tissue, birds and
The body fluid such as egg white, blood plasma, urine, the milk of poultry.Lysozyme is that separation is extracted from egg white using biotechnology, it is
A kind of native enzyme.Lysozyme can be frozen or be dried, and vigor is stablized.It is to gram positive bacteria, aerobic sporogenesis
Bacterium, hay bacillus, bacillus licheniformis etc. have antibacterial action.It has effects that antibacterial, antiviral and antitumor.For
Gram-positive bacteria (G+), such as micrococcus luteus, hay bacillus or micrococcus lysodeikticus are such as big with Gram-negative bacteria (G-)
Enterobacteria, proteus, shigella dysenteriae, pneumobacillus etc..
Summary of the invention
In view of this, the embodiment of the present invention provides the nanometer lysozyme of engineer a kind of and the preparation side of nanometer lysozyme
Method can be good at the rational design for solving the problems, such as nanometer lysozyme.
A kind of nanometer lysozyme of engineer, the protein amino acid sequence of the nanometer lysozyme are as follows:
A kind of preparation method of the nanometer lysozyme of engineer, comprising:
Step 1, target gene is synthesized using chemical synthesis；
Step 2, by micromanipulation instrument, target gene connection is embedded into Plasmid DNA and mammary gland protein gene
Promoter recombination；
Step 3, using equipped with the target gene capillary needle insert people's fertilized eggs protokaryon in, injection mammal by
Smart ovum waits so that the fertilized eggs are developed in parent and enters lactation period by transgenic animals；
Step 4, it in the lactation period of transgenic animals, is directly separated from lotion, extracts nanometer lysozyme.
The protein amino acid sequence of lysozyme is by determining after genetic transcription and translation in organism.In order to improve lysozyme
Sterilization effect, the present invention is recombinated by artificial protein changes sequence, designs that heat resistance is more preferable, structure is more stable, suitable
Answer the efficient nano lysozyme of various humidity conditions, energy and different component mixing.Albumen and polypeptide design facing challenges are
The variation of any one amino acid can all cause the unstable of albumen and expression or even the change of function.The present invention solves well
It has determined the rational design problem of lysozyme.
Detailed description of the invention
In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below
There is attached drawing needed in technical description to be briefly described, it should be apparent that, the accompanying drawings in the following description is only this
Some embodiments of invention for those of ordinary skill in the art without creative efforts, can be with
Other attached drawings are obtained according to these attached drawings.
Fig. 1 illustrates the protein structure fingerprint of source of people lysozyme；
Fig. 2 illustrates the protein structure fingerprint of chicken source lysozyme；
Fig. 3 illustrates the protein structure fingerprint of the nanometer lysozyme of engineer of the present invention；
Fig. 4 illustrates that the structural stability of engineer's nanometer lysozyme and source of people lysozyme of the present invention compares.Abscissa:
Amino acid sequence positions and length mark；Ordinate: conformation change index.Thick lines represent engineer's nanometer bacteriolyze of the present invention
Enzyme；Hachure represents engineer's nanometer lysozyme.
Fig. 5 illustrates that the structural stability of engineer's nanometer lysozyme and chicken source lysozyme of the present invention compares.Abscissa:
Amino acid sequence positions and length mark；Ordinate: conformation change index.Thick lines represent engineer's nanometer bacteriolyze of the present invention
Enzyme；Hachure represents engineer's nanometer lysozyme.Comparative illustration, and biological lysozyme compare, and newly-designed lysozyme is significantly
Improve the stability of structure.
Fig. 6 illustrates the protein amino acid sequence of engineer's nanometer lysozyme of the present invention；
Fig. 7 illustrates the computer simulation three-dimensional structure of engineer's nanometer lysozyme of the present invention.
Fig. 8 illustrates the flow diagram of the preparation method of engineer's nanometer lysozyme of the present invention.
Specific embodiment
The embodiment of the present invention is described in detail with reference to the accompanying drawing.
It will be appreciated that described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.Base
Embodiment in the present invention, it is obtained by those of ordinary skill in the art without making creative efforts it is all its
Its embodiment, shall fall within the protection scope of the present invention.
For convenience of description, description apparatus above is to be divided into various units/modules with function to describe respectively.Certainly, In
Implement to realize each unit/module function in the same or multiple software and or hardware when the present invention.
The embodiment of the present invention is described below.
Fig. 1 illustrates the protein structure fingerprint of source of people lysozyme；Fig. 2 illustrates the protein structure fingerprint of chicken source lysozyme；
Fig. 3 illustrates the protein structure fingerprint of the nanometer lysozyme of engineer of the present invention；Fig. 4 illustrates engineer's nanometer of the present invention
The structural stability of lysozyme and source of people lysozyme compares.Abscissa: amino acid sequence positions and length mark；Ordinate: structure
As variability index.Thick lines represent engineer's nanometer lysozyme of the present invention；Hachure represents engineer's nanometer lysozyme.Figure
5 illustrate that the structural stability of engineer's nanometer lysozyme and chicken source lysozyme of the present invention compares.Abscissa: amino acid sequence
Position and length mark；Ordinate: conformation change index.Thick lines represent engineer's nanometer lysozyme of the present invention；Hachure
Represent engineer's nanometer lysozyme.Comparative illustration, and biological lysozyme compare, and newly-designed lysozyme substantially increases structure
Stability.Fig. 6 illustrates the protein amino acid sequence of engineer's nanometer lysozyme of the present invention；Fig. 7 illustrates the present inventor
The computer simulation three-dimensional structure of work design nanometer lysozyme.It is illustrated below in conjunction with each figure.
A kind of lysozyme of engineer, the protein amino acid sequence of the lysozyme are as follows:
The protein structure fingerprint of the lysozyme includes:
The structure and amino acid composition of the lysozyme are as follows:
4. four two sulphur are strong: 24-146；48-134；83-95；99-113
5.10 pairs of long-range hydrogen bonds: 34-124；24-122；20-101；3-38；1-40；1-87；15-97；5-126；10-
128；57-109
6. amino acid composition:
A.15 lysine；15 glutamine；
B.14 leucine
C.13 glycine；
D.10 alanine；10 glutamine；
E.8 cysteine；8 glutamic acid；
F.7 arginine；7 serines；7 asparagines；
G.6 threonine；6 valines；6 tyrosine
H.5 tryptophan；
I.3 methionine；
J.2 aspartic acid；2 phenylalanines；2 proline；
K.1 histidine；
The lysozyme is micro white freeze-dried powder, water-soluble, and heat resisting temperature is 35 degrees Celsius.
The lysozyme is in dry conditions without activity, in humid conditions with the sterilizing activity of lysozyme.
As shown in figure 8, a kind of preparation method of the lysozyme of engineer, comprising:
Step 1, target gene is synthesized using chemical synthesis；
Step 2, by micromanipulation instrument, target gene connection is embedded into Plasmid DNA and mammary gland protein gene
Promoter recombination；
Step 3, using equipped with the target gene capillary needle insert people's fertilized eggs protokaryon in, injection mammal by
Smart ovum waits so that the fertilized eggs are developed in parent and enters lactation period by transgenic animals；
Step 4, it in the lactation period of transgenic animals, is directly separated from lotion, extracts lysozyme.
The target gene are as follows:
ATGCGCCTGGCCGTGATCGCCGGCGCCATCGCCGCCAGCATCACCATCAACGGCCGCATCTTCCGCAAG
T
GCGACGCCCTGAAGACCGCCCGCAAGATCGGCATGGAGGGCTACAAGGGCGTGAGCCTGCTGCAGTGGA
T
GTGCGCCCTGCGCTGGGACAGCGGCTACCAGACCAAGCTGACCCAGTACCAGCTGGGCGAGAAGAGCAC
C
GAGTACGGCGTGTTCAACGTGCAGAGCAAGTACTGGTGCCAGGAGGGCCGCACCCCCGGCCTGATCCAG
C
TGTGCCACGCCAGCTGCAGCCTGGCCGCCAACGAGCAGATCCTGGAGCTGGCCGTGTGCCTGCGCAAGA
T
CATCAAGGAGCCCAACGGCGTGAAGCTGTGGATCCTGTGGAAGCAGAAGTGCAACCAGAAGGAGATCAA
G
AACTACATCAACGGCTGCGGCATCTAG。
The step 1 specifically:
The amino acid sequence information of antalzyme protein matter according to design, infers the code nucleic acid sequence of the target gene
Column；
Using the high-density gene chip of Integrated Probe sequence, the degeneracy of code nucleic acid codon is solved；
Detection chip determines all coding codons of each amino acid according to codon coding schedule；
According to respective codon number, the possible coded sequence of the whole of each small peptide fragment is determined；It is gradually completing protein
Amino acid sequence is counter to push away its corresponding mRNA nucleic acid sequence；Chip is by the complementary series of corresponding oligonucleotides during its
It is fixed on solid substrate surface as probe, for the detection of desired mRNA sequences, the final target gene for obtaining synthesis.
Specific embodiments of the present invention are described below.
The present invention using source of people lysozyme and chicken source lysozyme as object of reference, with protein structure fingerprint technique to lysozyme into
Row design creates the more stable engineer's nanometer lysozyme of structure.Source of people lysozyme and lysozyme of chickeniAmino acid sequence
Column length is 148 and 147 respectively.More preferable in order to design antibacterial enzyme heat resistance, alkalinity is stronger, and negative electrical charge distribution is more reasonable
Lysozyme, it is necessary to be realized by replacement amino acid.Maximum obstacle is the replacement of any one amino acid, all can be to protein
Structure and function generate uncertain influence.
The proprietary protein structure fingerprint technique that the present invention develops, can accurately assess and regulate and control replacing for each amino acid
The stability for how influencing protein structure changed.Wherein, protein structure fingerprint is shown in the graph.Fig. 1 shows source of people lysozyme
Protein structure fingerprint.Fig. 2 shows chicken source antalzyme protein structural fingerprint.Fig. 3 shows the antalzyme protein structure that the present invention designs
Fingerprint.Ruler mark represents each amino acid position in figure, and protein amino acid sequence is shown in ruler mark in the following, each letter represents
One amino acid residue.The space conformation variation of corresponding local segment has been shown below in amino acid sequence.Any one in sequence
The difference of a amino acid all necessarily causes the variation of local space conformation, and can be directly anti-by protein structure fingerprint technique
It mirrors and.Therefore the present invention is during engineer's nanometer lysozyme, and one amino acid of every design is alkaline and negative in consideration
Except distribution of charges, structure change is efficiently controlled using protein structure fingerprint technique, more stable molten of rational design structure
Bacterium zymoprotein.In rational design, using source of people lysozyme and chicken source lysozyme as object of reference.The curve of Fig. 4 and Fig. 5 respectively represents
The comparison of the stability of engineer's nanometer lysozyme and source of people lysozyme and chicken source bacteriolyze enzymatic structure.Thick curve represents this
It invents the lysozyme designed and source of people lysozyme and chicken source lysozyme compares, the present invention designs lysozyme in most sections
It is significantly more stable than conformation.
Compare with biological source of people lysozyme and chicken source lysozyme, newly-designed lysozyme is not one or two amino acid
Difference, but have very big difference.Source of people lysozyme and lysozyme of chicken are made of 148 and 147 amino acid respectively.This hair
The lysozyme of bright design has 99 amino acid entirely different with them, i.e., 2/3rds amino acid sequence is entirely different.
·Structure is completely new: the lysozyme of engineer of the present invention has four pairs of disulfide bond and 10 pairs of long-range hydrogen bonds, greatly
Strong integrally-built stability and heat resistance.Meanwhile the lysozyme amino acid composition of new completely new engineer ensure that alkalinity
Stronger, the more reasonable distribution of negative electrical charge distribution, is a kind of completely new lysozyme.
Structure and amino acid composition is listed below.
7. four two sulphur are strong: 24-146；48-134；83-95；99-113
8. 10 pairs of long-range hydrogen bonds: 34-124；24-122；20-101；3-38；1-40；1-87；15-97；5-126；10-
128；57-109
9. amino acid composition:
A.15 lysine；15 glutamine；
B.14 leucine
C.13 glycine；
D.10 alanine；10 glutamine；
E.8 cysteine；8 glutamic acid；
F.7 arginine；7 serines；7 asparagines；
G.6 threonine；6 valines；6 tyrosine
H.5 tryptophan；
I.3 methionine；
J.2 aspartic acid；2 phenylalanines；2 proline；
K.1 histidine；
State activity: the lysozyme of engineer of the present invention is very stable albumen, and micro white freeze-dried powder dissolves in
Water, heat resisting temperature can achieve 35 degrees Celsius.In dry conditions without activity, the sterilizing of lysozyme is played in humid conditions
Activity.After participating in each secondary response, the property and quantity of itself will not all change lysozyme, can persistently send out repeatedly
The effect of waving.The lysozyme of completely new engineer can be with broad-spectrum sterilization application.
Albumen synthesis: it using the biotechnology of the gene protein recombination in biological medicine, can obtain of the invention artificial
The lysozyme of design.First with chemical synthesis synthesize target gene, then by target gene connection be embedded into Plasmid DNA with
The promoter of mammary gland protein gene recombinates, and then microinjection enters mammalian zygote, and fertilized eggs is allowed to develop in parent,
In the lactation period of transgenic animals, the lysozyme of the engineer of batch can be obtained from lotion.
It is not present in nature in view of the lysozyme of this completely new engineer, synthesizes purpose base using chemical synthesis
Cause.The amino acid sequence information of antalzyme protein matter according to design, infers corresponding target gene nucleic acid sequence encoding.Using
The high-density gene chip of tens of thousands of probe sequences is integrated, the degeneracy of code nucleic acid codon is solved.Detection chip is according to close
Numeral coding schedule first determines all coding codons of each amino acid；Then, it according to respective codon number, determines every
The possible coded sequence of the whole of one small peptide fragment.It is gradually completing that protein amino acid sequence is counter to push away its corresponding mRNA nucleic acid sequence
Column.Complementary series of corresponding oligonucleotides is fixed on solid substrate surface as probe by the chip during its, is used for mesh
The detection of mRNA sequence is marked, it is final to obtain synthesis target gene.
Then by micromanipulation instrument, target gene is embedded into the promoter weight of Plasmid DNA Yu mammary gland protein gene
Group is inserted in the protokaryon of people's fertilized eggs using the capillary needle that target gene is housed, injects mammalian zygote, fertilized eggs is allowed to exist
Development in parent, waits and enters lactation period by transgenic animals.During lactation, it can be directly separated extraction from lotion and obtain
The lysozyme of the engineer of batch.
The protein amino acid sequence of lysozyme is by determining after genetic transcription and translation in organism.In order to improve lysozyme
Sterilization effect, the present invention is recombinated by artificial protein changes sequence, designs that heat resistance is more preferable, structure is more stable, suitable
Answer the efficient lysozyme of various humidity conditions, energy and different component mixing.Albumen and polypeptide design facing challenges are any
The variation of one amino acid can all cause the unstable of albumen and expression or even the change of function.The present invention well solves
The rational design problem of lysozyme.
The invention has the following advantages:
1. the present invention is the lysozyme of a completely new engineer, which is completely absent any in nature
In biology, also it is not present in market.
2. in configuration aspects, the intracorporal antibacterial enzyme comparison of the antalzyme protein and biology that the present invention designs, 2/3rds
Amino acid sequence is different.
3. the various lysozymes in the antalzyme protein and nature that the present invention designs compare, this is new in aspect of performance
Antibacterial enzyme heat resistance it is more preferable, alkalinity it is stronger, negative electrical charge distribution it is more reasonable, structure is more stable.
4. the size of nanometer lysozyme of the invention is catalyzed sterilization process about at 3-6 nanometers, itself is not consumed, and keeps function
It can be persistently.
Purposes of the invention:
Lysozyme of the invention is easy to save as dry powder, can also be preferably mixed with other dry powder material components
It closes.In addition the lysozyme is dissolved in water, and do not need that any organic additive can be full and uniform is distributed in composite material.It is heavier
It wants, lysozyme of the invention is alkali molecules, without corrosiveness, can be mixed with minerals and metal material.Bacteriolyze
The various humidity of enzyme adaptation and temperature change play better sterilization effect in the environment of bacterium and virus breed, especially
Protease the most can be present in mixing material steadily in the long term, constantly play the effect of sterilizing elimination virus.
The above description is merely a specific embodiment, but scope of protection of the present invention is not limited thereto, any
In the technical scope disclosed by the present invention, any changes or substitutions that can be easily thought of by those familiar with the art, all answers
It is included within the scope of the present invention.Therefore, protection scope of the present invention should be subject to the protection scope in claims.
Sequence table
<110>the rich new material Science and Technology Ltd. of Beijing Hua Yunguo
<120>preparation method of the nanometer lysozyme and nanometer lysozyme of a kind of engineer
<130> 1
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 148
<212> PRT
<213>artificial synthesized ()
<400> 1
Met Arg Leu Ala Val Ile Ala Gly Ala Ile Ala Ala Ser Ile Thr Ile
1 5 10 15
Asn Gly Arg Ile Phe Arg Lys Cys Asp Ala Leu Lys Thr Ala Arg Lys
20 25 30
Ile Gly Met Glu Gly Tyr Lys Gly Val Ser Leu Leu Gln Trp Met Cys
35 40 45
Ala Leu Arg Trp Asp Ser Gly Tyr Gln Thr Lys Leu Thr Gln Tyr Gln
50 55 60
Leu Gly Glu Lys Ser Thr Glu Tyr Gly Val Phe Asn Val Gln Ser Lys
65 70 75 80
Tyr Trp Cys Gln Glu Gly Arg Thr Pro Gly Leu Ile Gln Leu Cys His
85 90 95
Ala Ser Cys Ser Leu Ala Ala Asn Glu Gln Ile Leu Glu Leu Ala Val
100 105 110
Cys Leu Arg Lys Ile Ile Lys Glu Pro Asn Gly Val Lys Leu Trp Ile
115 120 125
Leu Trp Lys Gln Lys Cys Asn Gln Lys Glu Ile Lys Asn Tyr Ile Asn
130 135 140
Gly Cys Gly Ile
145
<210> 2
<211> 447
<212> DNA
<213>artificial synthesized ()
<400> 2
atgcgcctgg ccgtgatcgc cggcgccatc gccgccagca tcaccatcaa cggccgcatc 60
ttccgcaagt gcgacgccct gaagaccgcc cgcaagatcg gcatggaggg ctacaagggc 120
gtgagcctgc tgcagtggat gtgcgccctg cgctgggaca gcggctacca gaccaagctg 180
acccagtacc agctgggcga gaagagcacc gagtacggcg tgttcaacgt gcagagcaag 240
tactggtgcc aggagggccg cacccccggc ctgatccagc tgtgccacgc cagctgcagc 300
ctggccgcca acgagcagat cctggagctg gccgtgtgcc tgcgcaagat catcaaggag 360
cccaacggcg tgaagctgtg gatcctgtgg aagcagaagt gcaaccagaa ggagatcaag 420
aactacatca acggctgcgg catctag 447
Claims (8)
1. the nanometer lysozyme of engineer a kind of, which is characterized in that the protein amino acid sequence of the nanometer lysozyme are as follows:
2. according to claim 1 nanometer of lysozyme, which is characterized in that the protein structure fingerprint packet of the nanometer lysozyme
It includes:
3. according to claim 1 nanometer of lysozyme, which is characterized in that the structure and amino acid group of the nanometer lysozyme
It is divided into:
1. four two sulphur are strong: 24-146；48-134；83-95；99-113
2.10 pairs of long-range hydrogen bonds: 34-124；24-122；20-101；3-38；1-40；1-87；15-97；5-126；10-128；57-
109
3. amino acid composition:
A.15 lysine；15 glutamine；
B.14 leucine
C.13 glycine；
D.10 alanine；10 glutamine；
E.8 cysteine；8 glutamic acid；
F.7 arginine；7 serines；7 asparagines；
G.6 threonine；6 valines；6 tyrosine
H.5 tryptophan；
I.3 methionine；
J.2 aspartic acid；2 phenylalanines；2 proline；
K.1 histidine.
4. according to claim 1 nanometer of lysozyme, which is characterized in that the nanometer lysozyme is micro white freeze-dried powder,
Water-soluble, heat resisting temperature is 35 degrees Celsius.
5. according to claim 1 nanometer of lysozyme, which is characterized in that the nanometer lysozyme does not have in dry conditions
Activity, in humid conditions with the sterilizing activity of nanometer lysozyme.
6. a kind of preparation method of the nanometer lysozyme of engineer characterized by comprising
Step 1, target gene is synthesized using chemical synthesis；
Step 2, by micromanipulation instrument, target gene connection is embedded into opening for Plasmid DNA and mammary gland protein gene
Mover recombination；
Step 3, in the protokaryon that people's fertilized eggs are inserted using the capillary needle equipped with the target gene, Mammalian Fertilization is injected
Ovum waits so that the fertilized eggs are developed in parent and enters lactation period by transgenic animals；
Step 4, it in the lactation period of transgenic animals, is directly separated from lotion, extracts nanometer lysozyme.
7. according to the method described in claim 6, it is characterized in that, the step 1 specifically:
The amino acid sequence information of nanometer antalzyme protein matter according to design, infers the code nucleic acid sequence of the target gene
Column；
Using the high-density gene chip of Integrated Probe sequence, the degeneracy of code nucleic acid codon is solved；
Detection chip determines all coding codons of each amino acid according to codon coding schedule；
According to respective codon number, the possible coded sequence of the whole of each small peptide fragment is determined；It is gradually completing protein amino
Acid sequence is counter to push away its corresponding mRNA nucleic acid sequence；During its chip using the complementary series of corresponding oligonucleotides as
Probe is fixed on solid substrate surface, for the detection of desired mRNA sequences, the final target gene for obtaining synthesis.
8. the method according to the description of claim 7 is characterized in that the target gene are as follows:
ATGCGCCTGGCCGTGATCGCCGGCGCCATCGCCGCCAGCATCACCATCAACGGCCGCATCTTCC GCAAGT
GCGACGCCCTGAAGACCGCCCGCAAGATCGGCATGGAGGGCTACAAGGGCGTGAGCCTGCTGCAGTGGAT
GTGCGCCCTGCGCTGGGACAGCGGCTACCAGACCAAGCTGACCCAGTACCAGCTGGGCGAGAAGAGCACC
GAGTACGGCGTGTTCAACGTGCAGAGCAAGTACTGGTGCCAGGAGGGCCGCACCCCCGGCCTGATCCAGC
TGTGCCACGCCAGCTGCAGCCTGGCCGCCAACGAGCAGATCCTGGAGCTGGCCGTGTGCCTGCGCAAGAT
CATCAAGGAGCCCAACGGCGTGAAGCTGTGGATCCTGTGGAAGCAGAAGTGCAACCAGAAGGAGATCAAG
AACTACATCAACGGCTGCGGCATCTAG。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910721309.2A CN110438106B (en) | 2019-08-06 | 2019-08-06 | Artificially designed nano lysozyme and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910721309.2A CN110438106B (en) | 2019-08-06 | 2019-08-06 | Artificially designed nano lysozyme and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110438106A true CN110438106A (en) | 2019-11-12 |
| CN110438106B CN110438106B (en) | 2021-03-23 |
Family
ID=68433445
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910721309.2A Active CN110438106B (en) | 2019-08-06 | 2019-08-06 | Artificially designed nano lysozyme and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110438106B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS6356288A (en) * | 1986-08-25 | 1988-03-10 | Sumitomo Chem Co Ltd | Microbiological production of human lysozyme |
| WO2001000855A1 (en) * | 1999-06-23 | 2001-01-04 | Ppl Therapeutics (Scotland) Ltd. | Fusion proteins incorporating lysozyme |
| EP1303291A4 (en) * | 2000-07-07 | 2005-04-06 | Univ New York | Anti-hiv and anti-tumor peptides and fragments of lysozyme |
| CN108624606A (en) * | 2018-03-27 | 2018-10-09 | 西北农林科技大学 | A kind of recombinant human lysozyme gene of codon optimization and its application |
-
2019
- 2019-08-06 CN CN201910721309.2A patent/CN110438106B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS6356288A (en) * | 1986-08-25 | 1988-03-10 | Sumitomo Chem Co Ltd | Microbiological production of human lysozyme |
| WO2001000855A1 (en) * | 1999-06-23 | 2001-01-04 | Ppl Therapeutics (Scotland) Ltd. | Fusion proteins incorporating lysozyme |
| EP1303291A4 (en) * | 2000-07-07 | 2005-04-06 | Univ New York | Anti-hiv and anti-tumor peptides and fragments of lysozyme |
| CN108624606A (en) * | 2018-03-27 | 2018-10-09 | 西北农林科技大学 | A kind of recombinant human lysozyme gene of codon optimization and its application |
Non-Patent Citations (3)
| Title |
|---|
| HUANG,B.等: "ACCESSION:AAC63078.1", 《GENBANK》 * |
| 刘兴敏等: "溶菌酶基因合成及其原核表达", 《华南农业大学学报》 * |
| 沈冰蕾等: "人溶菌酶基因的密码子优化设计及生物信息学初步分析", 《中国兽医学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110438106B (en) | 2021-03-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Woznica et al. | Mating in the closest living relatives of animals is induced by a bacterial chondroitinase | |
| Tzen | Integral proteins in plant oil bodies | |
| CN113621052A (en) | Recombinant I-type humanized collagen polypeptide and preparation method and application thereof | |
| CN109803977A (en) | Nucleic acid product and its method of administration | |
| CN108884458A (en) | Fibroin sample protein variant and cell culture processes | |
| CN104072615B (en) | A kind of people's Tim-3 fusion protein that can block Tim-3 signal path | |
| CN102316731A (en) | Cell-permeant peptide-based inhibitor of kinases | |
| CN101336299A (en) | Angiogenic tyrosyl trna synthetase compositions and methods | |
| Green et al. | A therapeutic potential for marine skeletal proteins in bone regeneration | |
| CN1575338B (en) | Bv8 nucleic acids and polypeptides with mitogenic activity | |
| Liu et al. | Proteomics of shell matrix proteins from the cuttlefish bone reveals unique evolution for cephalopod biomineralization | |
| Grunina et al. | Recombinant human erythropoietin with additional processable protein domains: purification of protein synthesized in Escherichia coli heterologous expression system | |
| JP2001131084A (en) | Promoter for synthesis of biogenic collagen | |
| CN110438106A (en) | The nanometer lysozyme of engineer a kind of and the preparation method of nanometer lysozyme | |
| CN108558991A (en) | A kind of biologically active polypeptide GIQDPKEP and its preparation method and application | |
| WO1995006411A1 (en) | Method and composition for weight reduction | |
| Lin et al. | Ranatensin-hl: A bombesin-related tridecapeptide from the skin secretion of the broad-folded frog, hylarana latouchii | |
| Liu et al. | Mineralize It or Not: Comparative Proteomics and Elemental Analysis Reveal Ancestral Compositions of Iron Mineralized Molluscan Radulae | |
| CN101041691A (en) | Chinese south China sea signal taro snail nerve toxin gene 1t5.4 and uses thereof | |
| CN109628460A (en) | Derived antimicrobial peptide hydramacin and preparation method thereof is carried out in a kind of hadal | |
| Rubalakshmi et al. | Structural evaluation and insilico study of proteins of asterias rubens-“starfish as new source to marine proteins” | |
| CN109055471A (en) | A kind of preparation method of crocodile ossein | |
| Sciani et al. | The amphibian diacylglycerol O-acyltransferase 2 (DGAT2): a ‘paleo-protein’with conserved function but unique folding | |
| CN109517811A (en) | A kind of β -one acyl-ACP synthase mutant | |
| CN108794594A (en) | A kind of biologically active polypeptide IPLIAGS and its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20211206 Address after: 065201 Yan Jiao Zhen fan Cun, Sanhe City, Langfang City, Hebei Province Patentee after: Sanhe Zhouhe Education Consulting Center (L.P.) Address before: 100085 4-2-2405, Changying Lijing garden, Chaoyang District, Beijing Patentee before: Beijing Huayun Guofeng New Material Technology Co.,Ltd. |
|
| TR01 | Transfer of patent right |