CN110423827A - A kind of fast inspection technology in loop-mediated isothermal amplification of streptococcus agalactiae scene based on pcsB gene - Google Patents
A kind of fast inspection technology in loop-mediated isothermal amplification of streptococcus agalactiae scene based on pcsB gene Download PDFInfo
- Publication number
- CN110423827A CN110423827A CN201910300214.3A CN201910300214A CN110423827A CN 110423827 A CN110423827 A CN 110423827A CN 201910300214 A CN201910300214 A CN 201910300214A CN 110423827 A CN110423827 A CN 110423827A
- Authority
- CN
- China
- Prior art keywords
- lamp
- primer
- gene
- loop
- pcsb
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses one kind with peptide glycan hydrolasepcs1 B gene is the method that the ring mediated isothermal amplification of target sequence quickly detects Streptococcusagalactiae, inner primer of the primer containing SEQID.NO.1-2, the outer primer of SEQID.NO.3-4 and the ring primer of SEQID.NO.5.It is characterized by: 1) 64 °C, LAMP reaction in 1 hour, the minimum genomic templates amount that Streptococcusagalactiae can be effectively detected by real-time transmissometer is 1 pg, and sensitivity is 100 times of regular-PCR electrophoretic analysis and fluorescent PCR.2) using SYBR Green I as colour reagent, LAMP, which reacts 1-3 hours, accurately to detect the Streptococcusagalactiae of 1 ng template.
Description
Technical field
The present invention relates to technical field of microbial detection, particularly relate to a kind of quick, Visual retrieval agalasisa hammer
The loop-mediated isothermal amplification method of bacterium.
Background technique
Streptococcusagalactiae (Streptococcus agalactiae,GBS), it is also known as B group streptococcus (Group BStreptococcus) be subordinate in classification bacterium circle (Bacteria), Firmicutes (Firmicutes), bacillus guiding principle
(Bacilli), lactobacillus mesh (Lactobacillales), Streptococcaceae (Streptococcaceae), streptococcus
(Streptococcus), Streptococcusagalactiae (Streptococcus agalactiae).Its characteristic of division is the spherical gram of chain
Positive bacteria, without motion do not produce gemma and negative catalase.In terms of harm, which is deposited in puerpera's genital tract and (takes
Band rate is 4.6%~25.4%), pregnant woman's puerperium septicopyemia and neonatal meningitis are caused, therefore, on many countries and ground
Area, such as the U.S., Europe Streptococcusagalactiae be used as pregnant woman produce inspection routine screening in essential items for inspection, China somely
Side is also important suggestion pregnant woman's screening project；Meanwhile the bacterium is also the main pathogens of mastadenitis of cow, causes milk crop
Decline and pollution；In addition, the bacterium is also very serious in the harm of cultured fishes, it is the main hammer for leading to Tilapia mossambica mortality
Bacterium, therefore, the bacterium are all important one of essential items for inspection in the milk cattle cultivating of agricultural and aquaculture.
Currently, the detection technique of Streptococcusagalactiae mainly has customary physiological biochemical method and molecular biology method.
In terms of customary physiological biochemical method identification, the biochemical indicator mainly used has: Gram's staining, ELISA experiment,
CAMP experiment, the experiment of V-P reaction (Fu Gesi-Puli's Squall) product, the experiment of peroxidating oxygenase, oxidizing ferment experiment, agglutination are real
Test with LancefieldShi group specific antigen group identification etc..The deficiency of these identification methods is mainly complicated for operation, and time-consuming
It is not strong etc. with specificity.Representational automatic quick bacteria identification systems currently on the market, as API rapid strep 32,
API 20E Vitek, RAPID Strep stri system and ATB rapid detection system etc., the deficiency of such detection system be by
The quantity limitation of type strain, testing result are simultaneously unstable in its database.
In terms of molecular biology identification, conventional method is 16S rRNA gene sequencing, but takes a long time completion.
Followed by with 16S rRNA gene, CAMP factor genecfb, Lactate oxidase geneslctO and 16S-23SrDNA sequence etc. is
Target gene and the identification methods such as fast PCR, double PCR and nest-type PRC for establishing, there is GBS GeneXpert currently on the market,
BD MAX GBS and BD the GeneOhmTM StrepB etc..The advantages of PCR method is that quick and precisely, disadvantage is the need for
PCR instrument and electrophoresis equipment etc., so the dependency degree to laboratory is higher, it is difficult to which at the scene or base applies.
Live epidemic situation monitoring for the general hospital of condition and agriculturally, in recent years, with LAMP, recombinase isothermal
It is existing to expand the GBS that (Isothermal recombinase polymerase amplification assay, RPA) is representative
Field detecting technology is fast-developing.It is reported in document to have using 16S rRNA gene, virulence factor genefbsB、cfbWithsipDeng, but the Streptococcusagalactiae LAMP method with practical application that can really look into is actually rare.Analyze its reason should with it is set
The specificity for counting primer is related with reaction sensitivity.Therefore, for the deficiency of current Streptococcusagalactiae detection method, the present invention is adopted
With novelpcs1 B gene establishes a set of more stable LAMP Fast Detection Technique by design of primers and system optimization.
Summary of the invention
Object of the present invention is to provide a kind of simple, fast agalasisa hammer for basic hospital, agricultural, aquatic products industry or grocery trade
Bacterium detection method.Used technical solution is:
A kind of fast inspection technology in loop-mediated isothermal amplification of streptococcus agalactiae scene based on pcsB gene, this method includes reagent
Have: 10 × LAMP Mix primer, Bst archaeal dna polymerase, fluorescence visual detection reagent, surpasses 2 × LAMP Mix reaction buffer
Pure water and Streptococcusagalactiae DNA profiling；The LAMP primer includes that outer primer has F3(SEQ ID NO:1) and B3(SEQ ID
NO:2), inner primer FIP(SEQ ID NO:3) and BIP(SEQ ID NO): 4 and acceleration primer LF(SEQ ID NO:5).
Wherein LAMP primer sequence are as follows:
F3:AAGTTGAGTCTGCCACAG(18bp)；
B3:CTGACAACAGGTTTTGATACC(21bp)；
FIP:GCCGAAGAAGTAGCCGTAAGATTATTTTAAACAGTTCAAACACAACCG (48bp)；
BIP: AATGAGCCAAAAGTTACTCAACCTTTTGCTCTAGGTGTTGAAGAAAC(47bp)；
LF:TGTCGAGGATGACTT(15bp);
Wherein LAMP primer is 10 × Mix primer of mixing, wherein the specific concentration of each primer is respectively 8 μM
FIP; 8 μM BIP; 2 μM F3; 2 μM B3; 4 μM LP。
The final concentration of 20mM Tris-HCl of the reaction buffer (25 DEG C of 8.8@of pH)；10mM (NH4)2SO4；50mM KCl；2mM MgSO4；0.1% Tween® 20；200 μM dATP；200 μM dCTP；200 μM dGTP；
100 μM [3H]dTTP；100 μg/mL BSA.
The Streptococcusagalactiae DNA profiling is to extract through bacterial genomes DNA extraction kit or the sample after boiling
The DNA sample of product cracking supernatant.
2 × LAMP Mix reaction buffer 40mM Tris-HCl (25 DEG C of 8.8@of pH)； 20mM
(NH4)2SO4；100mM KCl；4 MgSO4；0.2% Tween® 20；400 μM dATP；400 μM dCTP；400 μM
dGTP；200 μM[3H]dTTP；200 μg/mL BSA.Its preparation method mixes above-mentioned solvent equal under the conditions of pH is 9.0
Even acquisition.
Above-described fluorescence visual detection reagent is hydroxynaphthol blue (HNB) (being added before reaction) or SYRB fluorescent reagent
(being added after reaction).
A kind of fast inspection technology in loop-mediated isothermal amplification of streptococcus agalactiae scene based on pcsB gene, is used for Streptococcusagalactiae
Detection, specific design include: with detecting step
(1) foundation of LAMP reaction system
(2) Streptococcusagalactiae template DNA sample preparation
(3) LAMP product detection
For LAMP reaction system in above-described LAMP reaction system foundation in terms of 20 μ l, specific composition is as follows:
1 LAMP reaction system of table (20 μ l)
| Composition | Sample cell | Negative control |
| LAMP Mix(2 ×) | 10μL | 10μL |
| aFIP primer final concentration | 0.8μM | 0.8μM |
| aBIP primer final concentration | 0.8μM | 0.8μM |
| aF3 primer final concentration | 0.2μM | 0.2μM |
| aB3 primer final concentration | 0.2μM | 0.2μM |
| aLoop F primer final concentration | 0.4μM | 0.4μM |
| MgCl2(25 mM) | 3μL | 3μL |
| Aqua sterilisa | It mends to 20 μ L of final volume | It mends to 20 μ L of final volume |
| Bst archaeal dna polymerase (8U/ μ l) | 1.5μL | 1.5μL |
| bTemplate DNA | 1-3μl (1-100 ng) | / 1-100 ng A group streptococcus genome |
Note: "-" is that DNA is not added.
aPrimer need to be bonded to 10 × LAMP Mix using preceding premix, with convenient to use.
bTemplate is last addition, need to premix and is filled in detection PCR pipe in other actually detected preceding all compositions, reserve 3 μ l
It is added for sample DNA.
Above-described LAMP primer is to pass through specific detection and sensibility using the real-time transmissometer of LAMP(LA-500)
Screening is detected to obtain.
Substantive distinguishing features and marked improvement of the invention are:
The higher this method of accuracy usespcsB is that target gene carries out design of primers.pcsThe peptide that B encodes Streptococcusagalactiae is poly-
Glycosylhydrolase plays critical function in the bacterium cell wall metabolism, which can seriously reduce the survival odds of GBS.Together
Reported virulence factor genefbsB、cfbWith sipEtc. comparing, the gene is in GBS with bigger popularity and stronger
Conservative.Simultaneously compared with reported 16S rRNA gene, which has bigger variability than it.Therefore, resonable
By upper, this detection method be can effectively avoid according to the false positive rate of LAMP detection method designed by 16S rRNA gene and according to poison
False negative caused by LAMP method designed by power factor gene.
High specificity negative control bacterium detected and the no positive result of water control occur, with PCR testing result one
It causes.And it is easy to operate, be quickly obtained testing result, without instrument costly.
The sensitivity of the common PCR detection method of high sensitivity is the 0.1 ng order of magnitude, and uses detection side of the invention
Method, detectable limit to 0.001ng are 100 times of the regular-PCR and real-time quantitative PCR being compared simultaneously.According to formula:
1 mole of x of DNA=6.02 1023 Molecular (copy number)；
DsDNA=(base number) x (660 dalton/base)；
Streptococcusagalactiae molecular weight=2.1 x 106
Copy number: (6.02 x 1023Secondary copy number/mole) x (sample g)/(MW g/mol)；
The sensitivity of this LAMP detection method (1pg)=6.02 x 1023 x 10-12/ (2.1 x 106 X 660)=4.6 x
102A copy.
The short existing LAMP method of detection time is typically passed through sample strain isolation, purifying, culture, genome extraction
It is analyzed with LAMP, detection total duration is generally required 3 days and could be completed, and this detection method can be by splitting boiling for tissue sample
Solution obtains template, so that total duration control be made to complete in 1 to 3 hour.
Four, Detailed description of the invention
Different primers evaluate the expanding effect of LAMP under the conditions of 65 DEG C of Fig. 1
The meter record in every 6 seconds of real-time transmissometer is primary, and NC refers to the negative control using aqua sterilisa as template
Fig. 2 temperature pairpcsThe LAMP expanding effect of B-1 primer is evaluated
Fig. 3pcsThe LAMP specific amplification of B-1 primer is evaluated
Fig. 4pcsThe LAMP of B-1 primer expands sensitivity analysis
The amplification of Fig. 5 regular-PCRpcsThe sensitivity analysis of 1 B gene
M. DNA molecular amount marks, 1-4. Streptococcusagalactiae genomic templates 1. 100 ng, 2. 10 ng, 3. 1 ng,
4. 0.1 ng, 5. 0.01 ng.
The amplification of Fig. 6 real-time quantitative PCRpcsThe sensitivity analysis of 1 B gene
Fig. 7pcsSYBR chromogenic assay of the B-1 primer after different time LAMP
NC. using water as template, the negative control of reaction 3 hours, 1-3. is using 1 ng Streptococcusagalactiae genome as the left side template
Side is 365nm ultraviolet transmission, and fluorescence developing, right side is that directly range estimation 1. LAMP of is expanded 1 hour, 2. LAMP amplification 1
Hour, 3. LAMP expand 31 hours
The non-Streptococcusagalactiae genome LAMP SYBR chromogenic assay of Fig. 8
Using primerpcsB-1, it is 365nm ultraviolet transmission that 64 DEG C of LAMP, which are expanded on the left of 2 hours, and fluorescence developing, right side is straight
It is the negative control PC. of template using 1 ng Streptococcusagalactiae genome as template positive control that range estimation NC., which is met, using water
It is colour reagent 1-13. using the non-Streptococcusagalactiae genome of 1 ng as template using SYBR, is corynebacterium diphtheriae respectively
(Corynebacterium diphtheriae), Legionnella(Legionella spp), stenotrophomonas maltophilia
(Stenotrophomonas maltophilia), Pseudomonas aeruginosa (Pseudomonas aeruginosa), E. casselflavus
(Enterococcus casseliflavus), Friedlander's bacillus (Klebsiella Pneumoniae), bacillus subtilis
Bacterium (Bacillus subtilis), Shigella (Shigella castellani), staphylococcus aureus
(Staphylococcus aureus), haemophilus influenzae (Haemophilus influenzae), enterococcus faecalis
(Enterococcus faecalis), streptococcus pyogenes (Streptococcus pyogenes) and Streptococcus suis
(Streptococcus suis).
Fig. 9 Streptococcusagalactiae genome LAMP SYBR chromogenic assay
Using primerpcsB-1, it is 365nm ultraviolet transmission that 64 DEG C of LAMP, which are expanded on the left of 2 hours, and fluorescence developing, right side is straight
Range estimation C. is met using water as the negative control of template, 1-18. is respectively from 14 plants and 4 from source of people of the Rofe source of fish
Strain Streptococcusagalactiae genome, template quantity 1ng.
Five, specific embodiments
Design of primers
The target gene selection present invention selects three target genes altogether: cell wall metabolism regulates and controls two-component system reaction and adjusts egg
It is whitevicR, Protein histidine kinase genevicK and cytohydrolist genepcsB.Selecting reason is these three genes and nothing
The integrality of streptococcus lactis cell wall is closely related, any one gene inactivation all can cause the bacterium to be difficult to survive.
Design of primers collects whole Streptococcusagalactiae corresponding gene sequences by Genbank, using MAGA7 to each collection
Gene carry out sequence alignment, choose the conservative region on each gene, by PrimerExplorer (http: //
Primerexplorer.jp/e/) Photographing On-line LAMP primer.
Primer evaluation
The preparation of Streptococcusagalactiae genomic DNA template: bacterial genomes DNA extracts kit (Beijing Hua Yue is used
Foreign Biotechnology Co., Ltd) extract the highly pathogenic Streptococcusagalactiae E0 bacterial strain in the Rofe source of fish genome.
Reaction system establishes LAMP kit purchased from Beijing Lanpu Biological Technology Co., Ltd..
2 LAMP reaction system of table (20 μ L)
| T composition | Sample cell | Negative control |
| LAMP Mix(2 ×) | 10μl | 10μl |
| FIP primer final concentration | 0.8μM | 0.8μM |
| BIP primer final concentration | 0.8μM | 0.8μM |
| F3 primer final concentration | 0.2μM | 0.2μM |
| B3 primer final concentration | 0.2μM | 0.2μM |
| Loop F primer final concentration (option) | 0.4μM | 0.4μM |
| Loop B primer final concentration (option) | 0.4μM | 0.4μM |
| MgCl2(25 mM) | 3μL | 3μL |
| Template DNA | 1-100ng | It is not added |
| Bst archaeal dna polymerase (8U/ μ l) | 1.5μl | 1.5μl |
| Moisturizing is arrived | 20μl | 20μl |
Mentioned reagent is added in PCR pipe and is mixed, 65 DEG C is placed in and keeps the temperature 60 minutes；
The best amplification rate screening of primer is using Streptococcusagalactiae E0 strain gene group as template, using water as negative control mould
Plate, using real-time transmissometer (LAMP(LA-500)), 65 DEG C constant-temperature amplification 1 hour, the reactions change of each primer sets of real-time monitoring.
After reaction, 80 DEG C of 10 minutes inactivation Bst archaeal dna polymerases terminate reaction, by reaction product be placed in -20 DEG C it is spare or vertical
It is used for detected downstream.The detection of amplified production includes that agarose gel electrophoresis takes 3 μ l of amplified production, 2% Ago-Gel
Electrophoresis observes LAMP characteristic waterfall shape electrophorogram.
Primer most preferably expands temperature screening
Using Streptococcusagalactiae E0 strain gene group as template, using water as negative control template, using real-time transmissometer (LAMP(LA-
500)), 58 DEG C of -65 DEG C of eight temperature gradients of setting, constant-temperature amplification 1 hour, the reactions change of each primer sets of real-time monitoring.
Primer specificity evaluation
With using bacterial genomes extracts kit extract corynebacterium diphtheriae (Corynebacterium diphtheriae), legion
Bacillus(Legionella spp), stenotrophomonas maltophilia (Stenotrophomonas maltophilia), Pseudomonas aeruginosa
(Pseudomonas aeruginosa), E. casselflavus (Enterococcus casseliflavus), e coil k 1 pneumonia
Bacterium (Klebsiella Pneumoniae), bacillus subtilis (Bacillus subtilis), Shigella (Shigella castellani), staphylococcus aureus (Staphylococcus aureus), haemophilus influenzae (Haemophilus influenzae), enterococcus faecalis (Enterococcus faecalis), streptococcus pyogenes (Streptococcus pyogenes) and Streptococcus suis (Streptococcus suis) genome most preferably expands using it as negative control with each primer
Thermostatic expands 1 hour, the reactions change of each primer sets of real-time monitoring.
Primer sensitivity assessment
After being evaluated by above-mentioned primer specificity, regular-PCR amplification, qPCR amplification and LAMP are carried out to best primer and expanded, with
Compare the sensibility of LAMP detection method.Extracted DNA genome is tested with this, is carried out after measuring its concentration with sterile water
Doubling dilution, totally 7 concentration gradients, each concentration take 1 μ L as amplification template to experimental setup 0.0001ng-100ng.7 dense
Streptococcusagalactiae genome is expanded using above-mentioned three kinds of methods respectively under degree gradient.Regular-PCR amplification can basis
Detected through gel electrophoresis observation band show that qPCR amplification can be shown according to qPCR, and LAMP amplification is according to real-time turbidity
Instrument obtains.
Color developing detection
It is a kind of to be incorporated into exciting with green for all dsDNA minor grooves region using colour reagent SYRB Green I
The dyestuff of wavelength.
Influence of the reaction time to colour developing
Using water as negative control, LAMP is carried out to the highly pathogenic Streptococcusagalactiae bacterial strain E0 genome of 1 ng, it is small 1,2,3 respectively
When terminate reaction, be added SYRB Green I colour reagent develop the color, with evaluate LAMP colour developing validity and the reaction time
Influence to colour developing result.
The Evaluation on specificity of colour developing
It is narrow with corynebacterium diphtheriae (Corynebacterium diphtheriae), Legionnella (Legionella spp), thermophilic malt
Eat monad (Stenotrophomonas maltophilia), Pseudomonas aeruginosa (Pseudomonas aeruginosa), lead and yellow-collation
Enterococcus (Enterococcus casseliflavus), Friedlander's bacillus (Klebsiella Pneumoniae), withered grass
Bacillus (Bacillus subtilis), Shigella (Shigella castellani), staphylococcus aureus
(Staphylococcus aureus), haemophilus influenzae (Haemophilus influenzae), enterococcus faecalis
(Enterococcus faecalis), streptococcus pyogenes (Streptococcus pyogenes) and Streptococcus suis
(Streptococcus suis) genome is negative control, is positive right with highly pathogenic Streptococcusagalactiae bacterial strain E0 genome
According to, by 1 ng genome be template carry out LAMP, terminations in 2 hours reaction, addition SYRB Green I colour reagent develop the color
The specificity of LAMP chromogenic reaction is evaluated in detection.
The LAMP color developing detection of source of people and Rofe source Streptococcusagalactiae sample
4 plants of source of people Streptococcusagalactiaes, 14 plants of Rofe source of fish agalasisa chains using bacterial genomes extracts kit, to collection sample
Coccus carries out genome preparation, using water as negative control, carries out LAMP reaction and colour developing using 1ng preparation sample gene group as template
The validity of LAMP coloration method of the present invention is examined in detection.
As a result
Best primer screening
Using PrimerExplorer Photographing On-line, design altogetherpcs5 groups of B primer,vic4 groups of R primer,vicK primer 2 group, with
Water is control, and through 65 DEG C of constant temperature to Streptococcusagalactiae genome amplification 1 hour, using real-time transmissometer real-time monitoring, Fig. 1 is shown
Therein 3 groupspcsB primer and 2 groupsvicThe LAMP amplification situation of R primer.Final reaction result is shown, with institute of the present invention
Using primerpcsB-1 reaction speed is the rapidest,vicR primer takes second place,vicK primer effect is worst.pcsB-1 is the present invention
Selected final primer.
Optimum temperature screening
Select the used primer of the present inventionpcsB-1 analyzes the amplification situation between 58 DEG C -65 DEG C, and Fig. 2's is real-time turbid
Instrument analysis is spent the results show that 64 DEG C are optimal amplification temperature.
The Evaluation on specificity of primer
Select the used primer of the present inventionpcsB-1, with corynebacterium diphtheriae (Corynebacterium diphtheriae), legion's bar
Bacterium(Legionella spp), stenotrophomonas maltophilia (Stenotrophomonas maltophilia), Pseudomonas aeruginosa
(Pseudomonas aeruginosa), E. casselflavus (Enterococcus casseliflavus), e coil k 1 pneumonia
Bacterium (Klebsiella Pneumoniae), bacillus subtilis (Bacillus subtilis), Shigella (Shigella castellani), staphylococcus aureus (Staphylococcus aureus), haemophilus influenzae (Haemophilus influenzae), enterococcus faecalis (Enterococcus faecalis), streptococcus pyogenes (Streptococcus pyogenes) and Streptococcus suis (Streptococcus suis) genome be negative control, 64 DEG C constant-temperature amplification 1 hour.Fig. 3
Experimental result shows,pcsB-1 has good specificity, only just has LAMP amplified reaction as template using Streptococcusagalactiae.
The sensitivity analysis of primer
Select the used primer of the present inventionpcsB-1 is right with 10 times of doubling dilutions using Streptococcusagalactiae genome as template
100ng-0.1pg template carries out LAMP amplification.Fig. 4 is the results show that the minimum template quantity for being able to carry out LAMP is 1pg
(0.001ng)。
Meanwhile withpcsF3, B3 of B-1 primer are that PCR primer carries out PCR amplification electrophoretic analysis and RT-qPCR real-time quantitative
Fluorescent PCR instrument analysis, the results show that the template quantity of the lowest detection Streptococcusagalactiae of regular-PCR analysis and RT-qPCR analysis is
0.1ng(Fig. 5), it can be seen that, the sensitivity of LAMP detection method of the invention is 100 times of both methods.
SYBR chromogenic assay
Select the used primer of the present inventionpcsB-1, using Streptococcusagalactiae genome as template, using water as negative control, LAMP is anti-
It answers 1-3 hours, then terminates and react through high temperature, SYBR Green I colour reagent is added, it is aobvious to carry out 365nm ultraviolet transmission fluorescence
Color observation is directly estimated.Fig. 7 is the results show that LAMP reaction 1 i.e. observable, and effect is more significant within 2,3 hours, and compares through 3
LAMP is unchanged within a hour.
Conclusion
Select the used primer of the present inventionpcsB-1, using water as negative control template, to the pathogenic nothing of 14 plants of Rofe source of fish height
Streptococcus lactis and 4 plants of source of people Streptococcusagalactiaes carry out LAMP identification, and Fig. 9 through 2 hours LAMP the results show that react, all 18 plants
Streptococcusagalactiae SYBR colour developing is positive.
Streptococcusagalactiae LAMP detection method of the present invention be withpcs1 B gene,vicR andvicK is target sequence, passes through primer
Design and screening, it is final to determine one group of high specific LAMP primer based on pcsB gene, the primer optimal reaction temperature
Be 64 DEG C, using real-time sharpness instrument, detectable minimum genomic templates amount be 1 pg, about suitable 102The agalasisa chain of quantity
Coccus detection, which is 100 times of the regular-PCR electrophoresis and fluorescent PCR that carry out simultaneously.It is aobvious for having adopted SYBR Green I
Color reagent, either progress fluorescence detection are either estimated, and LAMP method of the present invention all can be in 1-3 hours to agalasisa chain
Coccus carries out specific detection, accuracy rate 100%.
To overcome the non-specificity caused by issuable aerosol in LAMP operation to develop the color, the present invention is anti-in LAMP
Should after need to carry out high-temperature process 10 minutes, to inactivate Bst archaeal dna polymerase, avoid because caused by uncapping colour reagent being added
False positive reaction.In addition to this, it is proposed that the method that paraffin embedding can be used handles Bst archaeal dna polymerase, adopts
With the colour reagent being added before reaction, such as hydroxynaphthol blue (HNB) dyestuff, to be further reduced non-specific responding.
In cost, this detection technique can according to the LAMP testing cost price of one sample of market related reagent price at present
Control is at 10 yuan or so.
It is recommended that the present invention is detected for hospital, aquaculture, cattle farm, dairy products etc..
Sequence table
<110>University Of Hainan
<120>a kind of fast inspection technology in loop-mediated isothermal amplification of streptococcus agalactiae scene based on pcsB gene
<150> 2018104986075
<151> 2019-05-23
<150> 2018113641308
<151> 2018-11-12
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1302
<212> DNA
<213>Streptococcusagalactiae (Streptococcus agalactiae)
<400> 1
atgaaaaaaa gaatattatc agcagtcctt gtgagtggag taactcttgg aactgctgcc 60
gtaacagtaa acgctgatga ctttgactcg aaaattgctg ctactgattc agtaatcaat 120
actttatcag ggcaacaagc agcagcacaa aaacaggtga ctgctattaa aggacaagtt 180
ggtgctttag agtctcaaca atcagaatta gaagcgcaaa atgctcaact tgaggcagta 240
tctcagcagt taggtcaaga gattcaaact ctttctaata aaattgttgc acgtaacgaa 300
tctttgaaaa agcaagttcg tagtgctcaa aagggtaact tgactaacta tattaatact 360
attttaaatt cgaaatcagt atctgatgct gttaatcgtg ttgttgctat tcgtgaggtt 420
gtttcagcta atgaaaagat gttagcacaa caagaggctg acaaagcagc cttagaagct 480
aaacaaattg aaaatcaaaa tgctataaat actgtagcag ctaacaagca agctatcgaa 540
aataataaag cagccttagc aacacaaaga gcacaattag aagcagctca attagagtta 600
tctgctcaat tgactacagt ccaaaatgaa aaagcatctt taattcaggc aaaagcacaa 660
gctgaggaag ctgcgcgtaa ggcagctgaa gcacaagctg agtctgtagc aaaagcacag 720
gcagcagcac aagttgagtc tgccacagct cctactgaaa cagttcaaac acaaccgaga 780
actgaaataa agccttctaa tcttacggct acttcttcgg caactactgt tgctaaaact 840
acagctacag ctactaatga gccaaaagtt actcaacctt ctgtagtaac taaagcagtt 900
gaagcaccta aagcagttgt ttcttcaaca cctagagcgg tatcaaaacc tgttgtcaga 960
agttatgatt caagtaacac atacccaatg ggacaatgta cttggggagc taagtcaatg 1020
gcttcttggg ttggtaacta ttggggaaat gctaatcagt ggggtgctag tgcacgtgca 1080
gctggttatt ctgtaggaac tacccctcgt gttggtgcag tagctgtttg gccatatgat 1140
ggtggtggtt acgggcacgt tgcagtagta acgtcagtgg ctaacaattc atctatccaa 1200
gttatggaat caaactatgc tggaaatatg agcattggca attaccgtgg ttcatttaac 1260
cctagtgctt ctggctctgt ttactatatt tacccaaatt aa 1302
Claims (11)
1. a kind of fast inspection technology in loop-mediated isothermal amplification of streptococcus agalactiae scene based on pcsB gene, it is characterised in that poly- with peptide
Glycosylhydrolase genepcsB is molecular target, designs ring mediated isothermal amplification (Loop-mediated isothermal
Amplification, LAMP) primer.
2. detection reagent includes 10 × LAMP Mix primer, 2 × LAMP Mix reaction buffer, Bst archaeal dna polymerase (8U/ μ
l)、MgCl2(25 mM), luciferase assay reagent, ultrapure water and Streptococcusagalactiae DNA profiling；The LAMP primer includes drawing outside
Object: F3(SEQ ID NO:1) with B3(SEQ ID NO:2), inner primer: FIP(SEQ ID NO:3) with BIP(SEQ ID NO:4)
Accelerate primer LF(SEQ ID NO:5 with ring)；
Wherein the sequence of primer is respectively as follows:
F3 AAGTTGAGTCTGCCACAG(18bp)；
B3 CTGACAACAGGTTTTGATACC(21bp)；
FIP GCCGAAGAAGTAGCCGTAAGATTATTTTAAACAGTTCAAACACAACCG(48bp)；
BIP AATGAGCCAAAAGTTACTCAACCTTTTGCTCTAGGTGTTGAAGAAAC(47bp)；
LF TGTCGAGGATGACTT(15bp);
3. a kind of fast inspection skill in loop-mediated isothermal amplification of streptococcus agalactiae scene based on pcsB gene according to claim 1
Art, which is characterized in that the Streptococcusagalactiae DNA profiling is to extract agalasisa chain using bacterial genomes DNA extraction kit
The genomic DNA of coccus culture, but be not excluded for using the cracking supernatant of high-temperature boiling in practical applications.
4. a kind of fast inspection skill in loop-mediated isothermal amplification of streptococcus agalactiae scene based on pcsB gene according to claim 1
Art, which is characterized in that the LAMP primer be withpcs1 B gene is sequence basis, specific, quick to it through real-time transmissometer
It is determined after perception and evaluation of the accuracy.
5. a kind of fast inspection skill in loop-mediated isothermal amplification of streptococcus agalactiae scene based on pcsB gene according to claim 1
Art, it is characterised in that 2 × LAMP Mix includes 40mM Tris-HCl (25 DEG C of 8.8@of pH)；20mM (NH4)2SO4；100mM KCl；4 MgSO4；0.2% Tween® 20；400 μM dATP；400 μM dCTP；400 μM dGTP；200
μM[3H]dTTP；200 μg/mL BSA.
6. a kind of fast inspection skill in loop-mediated isothermal amplification of streptococcus agalactiae scene based on pcsB gene according to claim 1
Art, which is characterized in that 10 × LAMP Mix primer includes: 8 μM of FIP; 8 μM BIP; 2 μM F3; 2 μM
B3; 4 μM LP。
7. a kind of a kind of fast inspection skill in loop-mediated isothermal amplification of streptococcus agalactiae scene based on pcsB gene based on pcsB gene
Art, it is characterised in that be used for the doubtful Streptococcus agalactiae infections of test sample, specific detecting step includes:
(1) foundation of LAMP reaction system
(2) Streptococcusagalactiae template DNA sample preparation
(3) LAMP is detected
8. a kind of fast inspection skill in loop-mediated isothermal amplification of streptococcus agalactiae scene based on pcsB gene according to claim 6
Art, it is characterised in that the LAMP reaction system are as follows:
1. LAMP reaction system of table (20 μ l)
9. a kind of fast inspection skill in loop-mediated isothermal amplification of streptococcus agalactiae scene based on pcsB gene according to claim 1
Art, it is characterised in that the LAMP detection method is fluorescent visual detection, and the fluorescence visual detection reagent is SYRB
Fluorescent reagent, but the colour reagent can be not limited in practical application.
10. a kind of fast inspection in loop-mediated isothermal amplification of streptococcus agalactiae scene based on pcsB gene according to claim 6
Technology, it is characterised in that the LAMP detection method use real-time transmissometer analyze when lowest detection genome content for
1pg(is approximately equivalent to 500 bacterium numbers), it is 100 times of normal PCR electrophoretic analysis and quantitative fluorescent PCR (0.1 ng) susceptibility.
11. the sensitivity is 300 times described in CN104774961A patent of invention, but lower than described in CN104726567A 3.55
×10-5 ng/μL。
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810498607 | 2018-05-23 | ||
| CN2018104986075 | 2018-05-23 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110423827A true CN110423827A (en) | 2019-11-08 |
| CN110423827B CN110423827B (en) | 2022-07-19 |
Family
ID=68408390
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910300214.3A Active CN110423827B (en) | 2018-05-23 | 2019-04-15 | Streptococcus agalactiae loop-mediated isothermal amplification field rapid detection technology based on pcsB gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110423827B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111455075A (en) * | 2020-04-10 | 2020-07-28 | 天津红日药业股份有限公司 | L AMP primer group, microfluidic chip and kit for detecting pathogenic microorganisms in genital tract |
| CN111534609A (en) * | 2019-11-12 | 2020-08-14 | 广州微芯生物科技有限公司 | Fluorescent quantitative PCR method for detecting toxigenic streptococcus agalactiae and corresponding kit |
| CN112322761A (en) * | 2020-11-19 | 2021-02-05 | 广西科技大学 | Method for detecting streptococcus agalactiae from aquaculture water body to prevent tilapia from suffering diseases |
| CN112824541A (en) * | 2019-11-21 | 2021-05-21 | 利多(香港)有限公司 | Methods, oligonucleotides and kits for detecting streptococci |
| CN114752692A (en) * | 2022-03-29 | 2022-07-15 | 中国检验检疫科学研究院 | Primer probe combination for detecting lactobacillus plantarum, RPA detection kit and detection method thereof |
-
2019
- 2019-04-15 CN CN201910300214.3A patent/CN110423827B/en active Active
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111534609A (en) * | 2019-11-12 | 2020-08-14 | 广州微芯生物科技有限公司 | Fluorescent quantitative PCR method for detecting toxigenic streptococcus agalactiae and corresponding kit |
| CN112824541A (en) * | 2019-11-21 | 2021-05-21 | 利多(香港)有限公司 | Methods, oligonucleotides and kits for detecting streptococci |
| CN111455075A (en) * | 2020-04-10 | 2020-07-28 | 天津红日药业股份有限公司 | L AMP primer group, microfluidic chip and kit for detecting pathogenic microorganisms in genital tract |
| CN111455075B (en) * | 2020-04-10 | 2022-12-23 | 天津红日药业股份有限公司 | LAMP primer group, microfluidic chip and kit for detecting pathogenic microorganisms in genital tract |
| CN112322761A (en) * | 2020-11-19 | 2021-02-05 | 广西科技大学 | Method for detecting streptococcus agalactiae from aquaculture water body to prevent tilapia from suffering diseases |
| CN114752692A (en) * | 2022-03-29 | 2022-07-15 | 中国检验检疫科学研究院 | Primer probe combination for detecting lactobacillus plantarum, RPA detection kit and detection method thereof |
| CN114752692B (en) * | 2022-03-29 | 2024-03-19 | 中国检验检疫科学研究院 | Primer probe combination for lactobacillus plantarum detection, RPA detection kit and detection method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110423827B (en) | 2022-07-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110423827A (en) | A kind of fast inspection technology in loop-mediated isothermal amplification of streptococcus agalactiae scene based on pcsB gene | |
| CN104232769B (en) | rRNA-targeted quantitative analysis method for microorganisms | |
| CN101712989B (en) | Method for quickly, qualitatively and quantitatively measuring Lactobacillus casei in probiotic dairy products | |
| Kim et al. | Direct loop-mediated isothermal amplification (LAMP) assay for rapid on-site detection of Bifidobacterium longum subspecies longum, infantis, and suis in probiotic products | |
| CN110878373A (en) | Recombinase polymerase amplification detection kit for phytophthora infestans and application thereof | |
| CN101712988B (en) | Method for quickly, qualitatively and quantitatively measuring Bifidobacteria in probiotic dairy products | |
| US20090136930A1 (en) | Method for the identification of microorganisms by means of in situ hybridization and flow cytometry | |
| CN101649352B (en) | Quick qualitative and quantitative measuring method of fermented lactobacillus in probiotic milk products | |
| CN110804674B (en) | Primer probe composition and kit for detecting soybean root rot based on recombinase polymerase amplification method and application of primer probe composition and kit | |
| CN102808025A (en) | Method for detecting blending of dairy cow milk into buffalo milk and buffalo milk dairy products by duplex polymerase chain reaction | |
| CN101712990A (en) | Method for quickly, qualitatively and quantitatively measuring Lactobacillus rhamnosus in probiotic dairy products | |
| ES2207799T3 (en) | OLIGONUCLEOTIDES DERIVED FROM VTS GENES OF BACTERIA E. COLI PRODUCERS OF VEROTOXINS AND THEIR USES. | |
| KR20150143347A (en) | Primer set for high sensitive real-time multiplex loop-mediated isothermal amplification reaction for determining type of shiga toxin genes of Enterohemorrhagic Escherichia coli, and method for determining type of shiga toxin genes of Enterohemorrhagic Escherichia coli using the same | |
| CN114164296B (en) | Primer probe composition for detecting pythium oligandrum, kit and application and detection method | |
| CN114540525B (en) | Primer composition for detecting or assisting in detecting chlamydia psittaci and application thereof | |
| KR20200048082A (en) | Kit for diagnosing infection due to orientia tsutsugamushi | |
| AU2003226729A1 (en) | Method for the identification of microorganisms by means of in situ hybridization and flow cytometry | |
| LU500199B1 (en) | LAMP-based nanomaterial and its application in visualization detection method for antibiotic resistant staphylococcus aureus in foods | |
| CN107723376B (en) | RPA method for detecting rickettsia prowazekii, special primer and probe thereof and application | |
| Lakshmi et al. | Opti-mization and validation of a diagnostic real-time PCR for specific detection of Mycobacterium avium subspecies Paratuberculosis | |
| CN114908177A (en) | Method for detecting Listeria monocytogenes in meat product by EMA treatment combined with micro-control chip digital PCR | |
| CN116479147A (en) | Primer probe and kit for detecting burkholderia meliotis and application of primer probe and kit | |
| CN117721185A (en) | LAMP primer group of salmonella and method for detecting salmonella in fresh milk | |
| CN117737263A (en) | LAMP kit for detecting pathogenic escherichia coli and special primer thereof | |
| CN115725751A (en) | PCR amplification primer pair and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |