CN110396496B - Culture method and application of duck small intestine epithelial cells - Google Patents
Culture method and application of duck small intestine epithelial cells Download PDFInfo
- Publication number
- CN110396496B CN110396496B CN201910446052.4A CN201910446052A CN110396496B CN 110396496 B CN110396496 B CN 110396496B CN 201910446052 A CN201910446052 A CN 201910446052A CN 110396496 B CN110396496 B CN 110396496B
- Authority
- CN
- China
- Prior art keywords
- small intestine
- duck
- epithelial cells
- cell
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0625—Epidermal cells, skin cells; Cells of the oral mucosa
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0679—Cells of the gastro-intestinal tract
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/05—Inorganic components
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/70—Undefined extracts
- C12N2500/80—Undefined extracts from animals
- C12N2500/84—Undefined extracts from animals from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/11—Epidermal growth factor [EGF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/30—Hormones
- C12N2501/33—Insulin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/90—Polysaccharides
- C12N2501/91—Heparin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2509/00—Methods for the dissociation of cells, e.g. specific use of enzymes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a method for culturing duck small intestine epithelial cells and application thereof, and belongs to the technical field of cell separation culture and the technical field of cytotoxicology. The cell culture method provided by the invention combines the methods of enzyme digestion and tissue mass blowing to obtain the primary cells of the duck small intestine, so that the problems that the activity of the primary cells of the duck small intestine cultured by the existing method is low and cell transfection cannot be carried out are solved, the primary cells are successfully cultured, the cell purity reaches more than 95%, and the method for culturing the epithelial cells of the duck small intestine is successfully established; and the influence of the concentration and the action time of the hydrogen peroxide on the cell activity and the apoptosis condition is tested by using the cultured primary duck small intestine epithelial cells through aging and dose-effect tests, a modeling scheme suitable for the small intestine epithelial cells is determined, a duck primary small intestine epithelial cell oxidative stress model is established, and a basis is provided for researching the molecular mechanism of duck intestinal injury in the future.
Description
Technical Field
The invention belongs to the technical field of cell separation culture and the technical field of cytotoxics, and particularly relates to a culture method of duck primary small intestine epithelial cells and a method for establishing a duck small intestine epithelial cell oxidative stress model.
Background
With the development of large-scale livestock and poultry cultivation, group transfer, immunization, transportation, limited feeding and the like become important links of standardized cultivation, and the production links can induce animals to generate oxidative stress reaction. In addition, the small environment of the cultivation house is influenced by external environmental factors, such as high temperature in summer, low temperature in winter and the like, and can induce oxidative stress reaction of organisms. Oxidative stress in the body is caused by the fact that excessive active oxygen free radicals or active nitrogen free radicals are generated in the body, the scavenging capacity of the body free radicals is exceeded, and the body oxidation and antioxidation system is unbalanced. After the poultry is subjected to oxidative stress, the productivity is reduced, and if the stress is further increased, stress syndrome and even death can occur, so that economic loss of a breeding enterprise is caused. Oxidative stress injury occurs primarily in the cardiovascular, digestive, endocrine and immune systems.
The small intestine tissue is ischemic at the earliest and recovered at the latest in the stress process, and is the center of organ dysfunction in the body stress process. Oxidative stress results in reduced feed intake and reduced feed conversion rate in animals. Many studies have demonstrated that when an animal body is stimulated by external environment, oxidative stress is likely to occur due to ischemia of intestinal tissues, and thus structural and functional disorders are caused, and digestion and absorption are affected.
No primary culture report of duck primary small intestine epithelial cells at home and abroad exists, but the separation and culture methods of other animal species epithelial cells are reported, but the selection of digestive enzymes, the preparation of culture solution and the separation process methods are different. Application No. 201510982770.5 discloses a method for separating and primary culturing chicken intestinal epithelial cells, which comprises digesting chicken intestinal tissue with thermophilic proteinase, treating cell mass in enzyme digestion solution, culturing the obtained cells with 10% chicken serum medium at 40deg.C and 7% CO 2 In an incubator. However, the thermophilic protease used in the method is expensive, and the serum used in the method is mainly obtained by a method of taking and separating blood after slaughtering the live chicken, so that the environmental controllability is poor during the acquisition, and the quality stability of the serum is poor. When the applicant adopts the method to separate the primary duck intestinal epithelial cells, the obtained duck intestinal epithelial cells have low activity, can not effectively grow in an adherence way, and can not carry out subsequent operations such as cell transfection, RNA extraction, protein extraction and the like. Application number 201610560871.8 discloses a method for culturing oviduct expansion part epithelial cells of a laying hen and establishing an oxidative stress model, wherein collagenase IV is utilized to digest sheared oviduct epithelial cells, digested digestive juice is filtered, and supernatant is removed after the filtrate is centrifuged to obtain cells. The method also has the problem of low cell viability. Therefore, the establishment of an efficient duck small intestine epithelial cell separation culture method is a basis for researching a molecular mechanism in the oxidative stress process.
Meanwhile, the establishment of the optimized duck small intestine epithelial cell oxidative stress model is the object of research on the small intestine epithelial cell oxidative stress response mechanism. Currently, there are many precedents for establishing an oxidative stress model by adding heavy metals, hydrogen peroxide and the like, but the antioxidant capacity of different tissue cells is greatly different, especially the primary cultured cells have weaker proliferation and differentiation capacity than the cell lines, so that the proper manner, concentration and treatment time for establishing the oxidative stress need to be studied, and the response mechanism of the intestinal epithelial cells in the oxidative stress process needs to be studied. Application number 201610901262.4 discloses a method for establishing a hydrogen peroxide-induced porcine spleen cell oxidative stress model, which uses porcine spleen cells as modeling cells for hydrogen peroxide-induced oxidative stress, wherein the concentration of hydrogen peroxide is 50-450 mu M. Pig spleen cells differ greatly from duck small intestine epithelial cells in species and selected cell types, and cell modeling has the specificity.
Therefore, in order to further explore the response mechanism of oxidative stress of duck intestinal epithelial cells caused by oxidative stress, an in-vitro oxidative stress model of duck intestinal epithelial cells needs to be established, and a foundation is laid for revealing the cell signal transduction and transcription regulation mechanism in the process of oxidative stress of cells.
Disclosure of Invention
The invention aims to solve the technical problem that the existing method for separating small intestine epithelial cells can not obtain high-activity treatable duck primary small intestine epithelial cells, and establishes a culture method of the duck small intestine epithelial cells, which specifically comprises the following steps:
step 1, taking a sheldrake hatching egg which is hatched for 26 days, taking out small intestine tissues of duck embryo by aseptic operation, and placing the small intestine tissues in DPBS;
step 2, after the small mesentery and pancreas in the tissue are removed, the small intestine is dissected and rinsed again with DPBS, the supernatant is cleared, and the small intestine is sheared into 1-3mm pieces 3 Is ready for use after organizing the blocks;
step 4, gently cleaning the digested tissue mass for 2 times by using DPBS, discarding the DPBS, and reserving the tissue mass;
step 6, collecting the obtained cell suspension 1000r/min, centrifuging for 3min, and discarding the supernatant;
step 7, the cells (clusters) obtained by centrifugation are subjected to culture, blowing and resuspension by using a complete culture medium, and are filtered by a 100 mu m mesh screen;
step 8, after the screened cells are gently blown and evenly beaten, inoculating the cells into a cell culture bottleIn 37 ℃,5% CO 2 Culturing for 90min under the condition, and removing adherent cells;
step 9, collecting non-adherent cells according to 10×10 6 Inoculating in cell culture plate at 37deg.C and 5% CO 2 Culturing for 24 hours.
Further, according to the method for culturing the duck intestinal epithelial cells, the type I collagenase digestion solution in the step 3 is as follows: 100 Dissolving mg type I collagenase in 1mL PBS buffer solution, blowing and mixing uniformly, and sub-packaging to 200 mu L for later use; before use, the extract is dissolved in 20mL of PBS, and the preparation of the type I collagenase digestion solution is completed.
Further, according to the method for culturing the duck small intestine epithelial cells described above, the duck small intestine epithelial cell complete culture medium in the step 7 is: 46.65mL DMEM/F12,2.5mL FBS,0.25mL heparin sodium (100. Mu.g/mL), 0.05mL EGF (10) 5 ng/mL), 0.05mL insulin (25 mg/mL), 0.5mL green streptomycin (10000U).
The invention aims to solve the other technical problem of providing a hydrogen peroxide-induced duck small intestine epithelial cell oxidative stress model establishment method, which provides an ideal in-vitro model for the subsequent deep research of the response mechanism of intestinal epithelial cell injury caused by oxidative stress.
A method for establishing an oxidative stress model of duck small intestine epithelial cells adopts hydrogen peroxide to induce and treat the duck primary small intestine epithelial cells, wherein the concentration of the hydrogen peroxide is 200 mu M, and the treatment time is 4 hours.
Preferably, the method for establishing the oxidative stress model of the duck small intestine epithelial cells comprises the following steps: the primary small intestine epithelial cells of duck cultured for 24h are respectively provided with a control group and an oxidative stress treatment group, and the cells are subjected to half-liquid exchange by a complete culture medium without double antibodies, wherein the temperature is 37 ℃ and the CO content is 5% 2 Culturing in an incubator for 12 hours to ensure the activity of cells; the experiment groups added hydrogen peroxide diluted by DMEM/F12 into each hole, and the concentration of the hydrogen peroxide is 200 mu M; the blank group was added with an equal amount of DMEM/F12, 37℃and 5% CO 2 Incubating for 4h, detecting cell survival rate by CCK8 method, and detecting related fineness by spectrophotometerAnd (5) a cytooxidative stress index.
Compared with the prior art, the invention can obtain the following technical effects:
(1) The method for culturing the primary small intestine epithelial cells of the duck is scientific and reasonable, combines the methods of enzyme digestion and tissue mass blowing to obtain the cells, solves the problems that the existing method for culturing the small intestine epithelial cells of the duck is low in activity and can not be used for cell transfection, and has the success of primary cell culture and the cell purity reaching more than 95%.
(2) According to the invention, by utilizing cultured primary small intestine epithelial cells of ducks, the influence of different hydrogen peroxide concentrations and different action times on cell viability and apoptosis conditions is detected through aging and dose-response experiments, a modeling scheme suitable for the small intestine epithelial cells is determined, and a foundation is laid for further exploring an intestinal epithelial oxidative stress response mechanism.
(3) According to the invention, the small intestine epithelial cells are cultured to establish an oxidation stress model of the small intestine epithelial cells, an in-vitro model is provided for researching the oxidation stress of the duck intestinal tracts in the future, and a technical support is provided for researching a strategy for coping with the reduction of production performance caused by the oxidation stress of the duck intestinal tracts in the duck culture process.
Of course, it is not necessary for any of the products embodying the invention to achieve all of the technical effects described above at the same time.
Drawings
The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention and do not constitute a limitation on the invention. In the drawings:
FIG. 1 is a photograph of primary small intestine epithelial cells of ducks cultured in example 1 of the present invention.
FIG. 2 is a photograph of a duck primary small intestine epithelial cell immunofluorescence stain of example 2 of the present invention against CK 18.
FIG. 3 is an agarose electrophoresis chart of an intestinal-specific expressed gene of RNA extracted from a cultured cell in example 2 of the present invention.
FIG. 4 is a graph showing changes in cell viability of duck primary intestinal epithelial cells of example 3 of the present invention at different times and with different hydrogen peroxide concentrations.
FIG. 5 is a graph showing the measurement of the concentration of malondialdehyde in cells treated with different concentrations of hydrogen peroxide in primary small intestine epithelial cells of ducks prepared in example 3 of the present invention.
FIG. 6 is a graph showing the detection of total superoxide dismutase in duck primary intestinal epithelial cells prepared in example 3 of the present invention at different hydrogen peroxide concentrations.
Detailed Description
The following will describe embodiments of the present invention in detail by referring to examples, so that the implementation process of how to apply the technical means to solve the technical problems and achieve the technical effects of the present invention can be fully understood and implemented.
EXAMPLE 1 isolation, purification and culture of Duck intestinal epithelial cells
Taking a sheldrake hatching egg which is hatched for 26 days, taking out small intestine tissues of duck embryo by aseptic operation, and placing the small intestine tissues in DPBS (38.8 mL PBS+1.2 mL double antibody, wherein PBS (phosphate buffer solution) is HyClone PBS (Sieimer's fly, USA); after removal of the mesentery and pancreas, the small intestine was dissected, rinsed with DPBS, and washed clear to supernatant; cutting small intestine into 1-3mm with ophthalmic scissors 3 Organizing the blocks; the tissue pellet was digested with 20mL of type I collagenase digest at 20mL, 37℃and 80r/min shaking for 70min; gently washing the tissue mass for 2 times by using DPBS, discarding the DPBS, and reserving the tissue mass; slightly blowing the tissue block by DPBS at 37 ℃, collecting the upper cell suspension, keeping the tissue block, continuously cleaning by DPBS, and repeating the step 7-8 times until the supernatant is clear; collecting the obtained upper cell suspension 1000r/min, centrifuging for 3min, and discarding the supernatant to obtain cell mass; the cells (clusters) obtained by centrifugation are resuspended by culture and blowing with a complete culture medium, and filtered by a nylon filter screen with 100 μm; the screened cells are uniformly blown in full culture medium in a suspension way, and are inoculated into a cell culture bottle at 37 ℃ and 5 percent CO 2 Culturing for 90min under the condition, and removing adherent mixed cells; non-adherent cells were collected and the cells were grown according to 10X 10 6 Inoculating in cell culture plate at 37deg.C and 5% CO 2 Culturing. After 18h of culture, the cells are fused to 60% -70%, after 24h of culture, the cells are fully distributed on a culture plate, and the knots are culturedSee fig. 1.
Example 2 identification of duck intestinal epithelial cells.
1) Identification of CK18 protein on duck small intestine epithelial cells obtained by screening
Taking small intestine epithelial cells cultured in a 6-hole plate for 18 hours, and washing the small intestine epithelial cells for 2 times by PBS; 400 μL of 4% paraformaldehyde is fixed for 30 min at room temperature; PBS was washed 2 times; 0.5% Triton-X100 was permeabilized for 15 min; PBS was washed 2 times; blocking with 5% BSA for 20min; adding a CK18 rabbit-derived polyclonal antibody (primary antibody) diluted by 1:50, and incubating at 37 ℃ for 1h; after PBS cleaning, adding FITC-treated goat anti-rabbit Ig secondary antibody in a ratio of 1:40, and incubating for 1h at 37 ℃; after incubation, fluorescent microscopy was used. The results of cellular immunofluorescence are shown in FIG. 2.
2) Verification of intestine-specific expressed Gene
The cultured cells were identified by detecting mRNA expression levels of specific expression of duck intestinal epithelium, as follows:
total RNA from the 6-well plate intestinal epithelial cells was extracted, and after concentration was measured, reverse transcription was performed. mRNA was reverse transcribed using a ReverTra Ace qPCR RT Kit (Toyobo, japan) kit. The quantitative conditions were carried out according to the instructions. Designing a target gene cDNA amplification primer according to the CDS region of the selected gene; the target fragment of the target gene is amplified by ordinary PCR. The primers are respectively as follows: alkaline Phosphatase (AP), primer (F: CGAAGGGCAACGAGGTGA; R: GGAGAAGACGTGCGAGTGGT), fragment length 719bp; e-cadherin (CDH 1) with primer (F: TTCATCGACGAGAACCTG; R: AAATACAAAGCGTGACAACA) and fragment length of 1054bp; glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer (F: CTTTGGACGCTGCTGTTG; R: GCTGTCACCGTTGAAGTCG) and fragment length of 964bp. The result of agarose gel electrophoresis after the target sequence is amplified by PCR is shown in FIG. 3.
Example 3 Effect of different Hydrogen peroxide treatments on cell viability
Cell viability was measured by the CCK8 method using cultured duck intestinal epithelial cells, using a 6 x 5 factor assay design, divided into 30 treatments, with 6 hydrogen peroxide concentration gradients (0, 50, 100, 200, 500, 1000 μmol/ml) and 5 time points (1, 4, 12, 24, 48 h).
1) The CCK8 method is used for measuring the cell viability, the test result is shown in fig. 4, the cell viability is about 70% under the hydrogen peroxide concentration of 200 mu M for 4 hours, which indicates that certain influence is exerted on cells, and the hydrogen peroxide concentration at other time points is too large or small for cell damage, so that the hydrogen peroxide acting time is determined to be 4 hours, and the acting concentration is determined to be 200 mu M.
2) Cell status observations indicated that cells were different in cell status under an inverted fluorescence microscope after 4h treatment at each hydrogen peroxide concentration. After 4h of treatment with hydrogen peroxide at a concentration of 50. Mu.M, only a small amount of floating cell metabolites was seen and the cell morphology was normal. After treatment with hydrogen peroxide at a concentration of 100. Mu.M for 4 hours, more cells can maintain a better form per se, and floating cell fragments can be seen. The hydrogen peroxide treatment with the concentration of 200 mu M for 4 hours causes certain damage to cells, a part of cells can maintain the good form, and gaps appear among cells in the adherent culture. Treatment with 500 μm hydrogen peroxide for 4 hours had greater damage to cells and some cell clusters had exfoliated. After 4h of treatment with hydrogen peroxide at a concentration of 1000. Mu.M, the cells were largely damaged, and the cells were detached from the cell culture plate and floated in the culture medium, and only a small amount of cells were still adherent and had a morphology other than the classical "paving stones".
3) After 4h of treatment with hydrogen peroxide at different concentrations, cell lipid peroxide (MDA) assay: as shown in fig. 4, the difference in MDA content was not significant in the 50 μm hydrogen peroxide treated group compared to the 0 μm hydrogen peroxide treated group, but the MDA content was significantly increased in the 100 μm and 200 μm hydrogen peroxide treated groups. The experimental results are shown in FIG. 5.
4) After 4h of treatment with hydrogen peroxide at different concentrations, the measurement of the superoxide dismutase (SOD) of the cells: as shown in fig. 5, the SOD content in the cells greatly changes with the addition of hydrogen peroxide with different concentrations, and the SOD content in the 50 μm hydrogen peroxide treated group is significantly lower than that in the control group; the SOD content of the hydrogen peroxide treatments of 50 μm,100 μm and 200 μm was significantly different from that of the control group; the 500 μm and 1000 μm hydrogen peroxide treated SOD content was significantly lower than for the 50 μm,100 μm and 200 μm hydrogen peroxide treated groups.
The method utilizes the primary small intestine epithelial cells which are successfully cultured to generate oxidative stress by hydrogen peroxide, the purity of the cells reaches more than 95%, the cell activity is maintained at about 70% by utilizing the action of 200 mu M hydrogen peroxide for 4 hours, the oxidative stress reaction of the cells is caused, and the corresponding change of oxidative stress indexes is caused, which indicates that the small intestine epithelial cell oxidative stress model is established.
Comparative example 1 isolation and culture of Duck primary intestinal epithelial cells by enzymatic digestion alone
Taking a sheldrake hatching egg which is hatched for 26 days, taking out small intestine tissues of duck embryo by aseptic operation, and placing the small intestine tissues in DPBS (38.8 mL PBS+1.2 mL double antibody, wherein PBS (phosphate buffer solution) is HyClone PBS (Sieimer's fly, USA); after removal of the mesentery and pancreas, the small intestine was dissected, rinsed with DPBS, and washed clear to supernatant; cutting small intestine into 1-3mm with ophthalmic scissors 3 Organizing the blocks; the tissue pellet was digested with 1mg/ml collagenase type I digest at 5 times the cell volume, 37℃and 80r/min shaking digestion for 70min. Adding complete culture medium 1:1 to terminate digestion, blowing tissue mass for 2-3min, collecting cell suspension, centrifuging the collected upper cell suspension at 1000r/min for 3min, and discarding supernatant to obtain cell mass; the cells (clusters) obtained by centrifugation are resuspended by culture and blowing with a complete culture medium, and filtered by a nylon filter screen with 100 μm; the screened cells are uniformly blown in full culture medium in a suspension way, and are inoculated into a cell culture bottle at 37 ℃ and 5 percent CO 2 Culturing for 90min under the condition, and removing adherent mixed cells; non-adherent cells were collected and the cells were grown according to 10X 10 6 Inoculating in cell culture plate at 37deg.C and 5% CO 2 Culturing. The method has low cell activity, few adherent cells, low concentration obtained by extracting cell RNA and protein, and can not carry out subsequent experiments.
Comparative example 2 isolation of Duck primary intestinal epithelial cells Using type I collagenase+thermolysin
Taking a sheldrake hatching egg which is hatched for 26 days, taking out small intestine tissues of duck embryo by aseptic operation, and placing the small intestine tissues in DPBS (38.8 mL PBS+1.2 mL double antibody, wherein PBS (phosphate buffer solution) is HyClone PBS (Sieimer's fly, USA); after removal of the small mesentery and pancreas,the small intestine is dissected, rinsed with DPBS, and washed to clear the supernatant; cutting small intestine into 1-3mm with ophthalmic scissors 3 Organizing the blocks; digesting the tissue mass with a 5-fold cell volume of 1mg/ml collagenase type IV +1mg/ml thermolysin digest, shaking digestion at 37℃for 70min at 80 r/min; gently washing the tissue mass for 2 times by using DPBS, discarding the DPBS, and reserving the tissue mass; slightly blowing the tissue block by DPBS at 37 ℃, collecting the upper cell suspension, keeping the tissue block, continuously cleaning by DPBS, and repeating the step 7-8 times until the supernatant is clear; collecting the obtained upper cell suspension 1000r/min, centrifuging for 3min, and discarding the supernatant to obtain cell mass; the cells (clusters) obtained by centrifugation are resuspended by culture and blowing with a complete culture medium, and filtered by a nylon filter screen with 100 μm; the screened cells are uniformly blown in full culture medium in a suspension way, and are inoculated into a cell culture bottle at 37 ℃ and 5 percent CO 2 Culturing for 90min under the condition, and removing adherent mixed cells; non-adherent cells were collected and the cells were grown according to 10X 10 6 Inoculating in cell culture plate at 37deg.C and 5% CO 2 Culturing. The cell viability obtained by this method is high, but the number of the hetero cells is high, and the isolated cells contain a large number of fibroblasts and smooth muscle cells.
Certain terms are used throughout the description and claims to refer to particular components or methods. It will be appreciated by those of ordinary skill in the art that different regions may be referred to by different terms as a single component. The description and claims do not take the difference in name as a way of distinguishing components. As used throughout the specification and claims, the word "comprise" is an open-ended term, and thus should be interpreted to mean "include, but not limited to. By "substantially" is meant that within an acceptable error range, a person skilled in the art is able to solve the technical problem within a certain error range, substantially achieving the technical effect. The description hereinafter sets forth a preferred embodiment for practicing the invention, but is not intended to limit the scope of the invention, as the description is given for the purpose of illustrating the general principles of the invention. The scope of the invention is defined by the appended claims.
It should also be noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a product or system that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such product or system. Without further limitation, an element defined by the phrase "comprising one … …" does not exclude the presence of other like elements in a commodity or system comprising such elements.
While the foregoing description illustrates and describes several preferred embodiments of the invention, it is to be understood that the invention is not limited to the forms disclosed herein, but is not to be construed as limited to other embodiments, and is capable of use in various other combinations, modifications and environments and is capable of changes or modifications within the spirit of the invention described herein, either as a result of the foregoing teachings or as a result of the knowledge or skill of the relevant art. And that modifications and variations which do not depart from the spirit and scope of the invention are intended to be within the scope of the appended claims.
Claims (4)
1. A method for culturing duck intestinal epithelial cells is characterized by comprising the following steps: the culture method comprises the following steps:
step 1, taking a sheldrake hatching egg which is hatched for 26 days, taking out small intestine tissues of duck embryo by aseptic operation, and placing the small intestine tissues in DPBS;
step 2, after removing the mesentery and pancreas in the tissue, cutting the small intestine, rinsing the small intestine again with DPBS, washing the small intestine until the supernatant is clear, and cutting the small intestine for later use;
step 3, digesting the sheared tissue mass by using 1mg/ml type I collagenase, and carrying out oscillation digestion for 70min at 37 ℃ and 80 r/min;
step 4, gently cleaning the digested tissue mass for 2 times by using DPBS, discarding the DPBS, and reserving the tissue mass;
step 5, lightly blowing the cleaned tissue mass by DPBS at 37 ℃, collecting an upper cell suspension, keeping the tissue mass to be continuously cleaned by DPBS for 7-8 times, and repeating the step until the supernatant is clear;
step 6, collecting the obtained cell suspension, centrifuging for 3min at 1000r/min, and discarding the supernatant;
step 7, the cell mass obtained by centrifugation is subjected to culture, blowing and resuspension by using a complete culture medium, and is filtered by a 100 mu m mesh screen;
step 8, after the screened cells are gently blown and evenly beaten, the cells are inoculated into a cell culture flask at 37 ℃ and 5 percent CO 2 Culturing for 90min under the condition, and removing adherent cells;
step 9, collecting non-adherent cells according to 10×10 6 Inoculating in cell culture plate at 37deg.C and 5% CO 2 Culturing for 24 hours to obtain primary duck intestinal epithelial cells;
the DPBS was 38.8mL PBS phosphate buffer+1.2 mL diabody.
2. A method of culturing duck intestinal epithelial cells according to claim 1, wherein: the complete medium in the step 7 is as follows: 46.65mL DMEM/F12,2.5mL FBS,0.25mL100 μg/mL heparin sodium, 0.05mL 10 5 ng/ml EGF,0.05ml25mg/ml insulin, 0.5ml10000U of green streptomycin.
3. A method for establishing an oxidative stress model of duck small intestine epithelial cells is characterized by comprising the following steps:
step 1: preparation of primary small intestine epithelial cells by the culture method of duck small intestine epithelial cells according to claim 1:
step 2: the primary small intestine epithelial cells of the ducks are treated by hydrogen peroxide, wherein the concentration of the primary small intestine epithelial cells of the ducks is 200 mu M, and the treatment time is 4 hours.
4. The method for modeling oxidative stress of duck intestinal epithelial cells according to claim 3, wherein: setting control group and oxidative stress treatment group, respectively, and half-exchanging liquid of primary small intestine epithelial cells of duck with complete medium without double antibody at 37deg.C and 5% CO 2 Culturing in an incubator for 12 hours to ensure the activity of cells; adding DMEM/F12 diluted hydrogen peroxide into each hole of the experimental group, and adopting the hydrogen peroxide to perform in vitro induction treatment on small intestine epithelial cells, wherein the concentration of the hydrogen peroxide is 200 mu M, and the treatment time is 4 hours; blank controlAdding same amount of DME/F12, 37 ℃ and 5% CO 2 Incubating in an incubator, detecting the cell survival rate by adopting a CCK8 method, and detecting the related cell oxidative stress index by using a spectrophotometer.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2018111574493 | 2018-09-30 | ||
| CN201811157449 | 2018-09-30 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110396496A CN110396496A (en) | 2019-11-01 |
| CN110396496B true CN110396496B (en) | 2023-06-20 |
Family
ID=68322988
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910446052.4A Active CN110396496B (en) | 2018-09-30 | 2019-05-27 | Culture method and application of duck small intestine epithelial cells |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110396496B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114574426A (en) * | 2022-01-25 | 2022-06-03 | 湖北省农业科学院畜牧兽医研究所 | Method for separating and identifying duck small intestine crypt stem cells and culturing 3D organs |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE602004025996D1 (en) * | 2003-11-03 | 2010-04-22 | Probiogen Ag | Immortalized duck cell lines for virus production |
| CN102120983A (en) * | 2010-01-07 | 2011-07-13 | 中国农业科学院北京畜牧兽医研究所 | Separation and culture method of epidermal stem cells of Beijing ducks |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102212504B (en) * | 2011-05-05 | 2012-12-19 | 吉林农业大学 | Rabbit intestinal epithelial cell line and preparation method thereof |
| CN104818238B (en) * | 2015-03-26 | 2019-12-20 | 四川农业大学 | Chicken intestine epithelial cell separation culture method |
| CN105483078A (en) * | 2015-12-24 | 2016-04-13 | 山西农业大学 | Isolation and primary culture methods of chicken small intestinal epithelial cells |
-
2019
- 2019-05-27 CN CN201910446052.4A patent/CN110396496B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE602004025996D1 (en) * | 2003-11-03 | 2010-04-22 | Probiogen Ag | Immortalized duck cell lines for virus production |
| CN102120983A (en) * | 2010-01-07 | 2011-07-13 | 中国农业科学院北京畜牧兽医研究所 | Separation and culture method of epidermal stem cells of Beijing ducks |
Non-Patent Citations (2)
| Title |
|---|
| 李融 ; 韩庆广 ; 赵国琦 ; .鹅小肠上皮细胞的分离培养研究.中国家禽.2009,(16),第22-25页. * |
| 郑超等.丝裂原活化蛋白激酶抑制剂对氧化应激鸭小肠上皮细胞屏障功能的影响.《中国畜牧杂志》.2021,第第58卷卷(第第4期期),第242-246页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110396496A (en) | 2019-11-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105969720B (en) | A kind of Human vascular endothelial's cell culture fluid and its cultural method | |
| JP7114134B2 (en) | Differentiation medium and method for producing oligodendrocyte progenitor cells | |
| CN113699097B (en) | Method for preparing retinal pigment epithelial cells | |
| CN106636210A (en) | Method for inducing transdifferentiation of fibroblast into similar testicular interstitial cells by combination of transcription factors | |
| CN111621475A (en) | Umbilical cord mesenchymal stem cell membrane and preparation method thereof | |
| CN110396496B (en) | Culture method and application of duck small intestine epithelial cells | |
| JP5758061B2 (en) | Cell cluster generation method | |
| CN112941011B (en) | Epinephelus lanceolatus head kidney cell line and construction method and application thereof | |
| CN109234230B (en) | Primary isolation method of skin mesenchymal stem cells | |
| CN113462639A (en) | Method for separating fibroblasts from human induced pluripotent stem cells and application of method | |
| CN104560875B (en) | A kind of In-vitro separation culture method of mammal trigeminal ganglion neuron and application | |
| CN108753703B (en) | Method for establishing paralichthys olivaceus embryonic muscle satellite cell line | |
| CN114107181B (en) | Sturgeon embryo cell line, culture medium and preparation method thereof | |
| Aleksandrova et al. | Characteristics of human neural stem cells in vitro and after transplantation into rat brain | |
| CN115786237A (en) | Method for establishing spontaneous immortalized tree shrew brain microvascular endothelial cell line | |
| CN109402045A (en) | A kind of in vitro culture and propagating method of buffalo stem spermatogonium like cell | |
| CN113046306B (en) | Culture method of pluripotent stem cells | |
| US4477567A (en) | Continuous bovine beta cell line | |
| CN109055316A (en) | A kind of building and application of nerve cell and mast cell co-culture system | |
| CN114457036A (en) | Red fluorescence labeling cell with human retina differentiation potential and construction method thereof | |
| CN109280634B (en) | Method for in vitro isolated culture of inner ear hair cells | |
| Okker-Reitsma et al. | Isolation and culture of smooth muscle cells from human umbilical cord arteries | |
| CN111876377A (en) | Stem cell cardiomyocyte induced differentiation method based on autophagy and application thereof | |
| CN117004641B (en) | Method for stably transferring agrobacterium tumefaciens-mediated longan callus | |
| CN114540282B (en) | Method for obtaining mesenchymal stem cells by induced differentiation of pluripotent stem cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |