CN110384712A - Application of the nucleic acid aptamer in preparation treatment Alzheimer's disease drug - Google Patents

Abstract

The invention discloses application of the nucleic acid aptamer in preparation treatment Alzheimer's disease drug.Go out the nucleotide sequence of the aptamer Ob2, the nucleic acid aptamer Ob2 in conjunction with people AChE as shown in SEQ ID NO:2 by SELEX technology screening.Vitro detection Ob2, which has, inhibits the active effect of AChE.It is administered by telocoele, Ob2 can improve the Spatial memory ability of Alzheimer disease (AD) model mice, the effects of reducing hippocampus of mice and cortex A β 40 and 42 content of A β and senile plaque deposition quantity.High specific and high associativity due to aptamer, the aptamer for people AChE are the powerful of examination of the inside with outside AChE, and are expected to exploitation as the new A ChE inhibitor of the diseases such as treatment AD.Research foundation is provided for the novel special AChE exploitation inhibited, provides new method and new approaches for AD treatment.

Description

Application of the nucleic acid aptamer in preparation treatment Alzheimer's disease drug

Technical field

The invention belongs to fields of biomedicine, and in particular to nucleic acid aptamer treats Alzheimer's disease drug in preparation In application.

Background technique

Alzheimer disease (Alzheimer ' s Disease, AD) is that one kind causes elderly population dementia most common gradually Into property irreversibility central nervous system degenerative brain disorder, typical clinical symptom is one memory, language and influence people's progress The obstacle of the cognitive function of daily routines.With people's life-time dilatation, dementia patients quantity is rapidly increasing, and is brought simultaneously Great family and social economical burden.According to statistics, it just will appear the new dementia of an example within every 3 seconds in global range in 2018 Example, and Dementia patients' number has reached 50,000,000 people.To the year two thousand fifty, this number will increase more than twice, reach 1.52 hundred million. The totle drilling cost of global dementia in 2018 is 1 trillion dollars, and to the year two thousand thirty, this number will increase to 2 trillion dollars.

The big intracerebral of AD patient has several different neuropathological features, including extracellular amyloid plaques, intracellular mind It is lost through fibrinogen entanglement, star spongiocyte denaturation, microglia of reactivity, inflammation and neuron and cynapse.Extracellularly The beta amyloid patch (beta-amyloid protein, A β) of aggregation cuts starch from beta-secretase and gamma-secretase Sample precursor protein (amyloid b-precursor protein, APP).Neurofibrillary tangles are by peroxophosphoric acid in neuron Protein tau composition.Although these neuropathological features are in the parietal lobe of cortex and temporal lobe, hippocampus, entorhinal cortex and amygdaloid nucleus performance It is very prominent, but be also one of them, AD earliest pathological phenomena is cholinergic neurons of basal forebrain retrogression.

Acetylcholine (acetylcholine, ACh) is the neurotransmitter that all cholinergic neurons have, widely distributed In periphery and central nervous system, recognize in cerebral cortex development, cortical activity, brain blood flow control, sleep-wake cycle, adjusting Know that function and learning and memory process etc. play an important role.It is by establishing synaptic contact in iuntercellular, in cortex It is played a crucial role in the structure and Remolding of Functions of loop, to assist cognitive function more complicated after growing up.Greatly Quantity research shows that each molecular marked compound variation of AD patient's basal forebrain cholinergic nerve system includes choline acetyltransferase (choline acetyltransferase, ChAT) activity, ACh are horizontal and the intake of choline high-affinity is remarkably decreased, before substrate These cholinergic deficiency severity of brain are positively correlated with the cognitive behavior obstacle of AD patient and non-cognitive behavior obstacle.

Acetylcholinesterase (Acetylcholinesterase, AChE) is present between cholinergic neuron cynapse, passes through Hydrolysis ACh terminates its continuous action to postsynaptic membrane, guarantees the normal transmitting of nerve signal in vivo.Suffering from AD Individual in, AChE activity increase, cause the decomposition of neurotransmitter ACh to enhance, so that the choline levels in brain be made to decline. In addition, another relationship of AChE and AD is AChE subparticipation A β and neurofibrillar formation.Some researches show that AChE passes through The aggregation that compound promotes beta-amyloyd peptide fragment is formed with the fibrinogen of growth, these compounds formed are shown than independent The bigger cytotoxicity of A β plaque block.

The ACh of cholinergic neuron release can combine two different receptor subtypes: nicotine type nicotinic ACh receptor and muscarine by Body.Researches show that these two types of receptors to play an important role to AD medicament research and development.Cholinergic neuron based on AD loses hypothesis And the decline of ACh level, the treatment method of AD, which mainly passes through, inhibits AChE, activating nicoting type choline receptor and muscarinic type gallbladder Alkali receptor.It wherein activates the M-ChR in brain that can stimulate the processing of non-starch sample α secretase of APP, inhibits simultaneously The beta-secretase of APP processes approach, to significantly reduce the beta-amyloid protein (beta-amyloid of cerebral cortex and hippocampus Protein, A β) it is horizontal.Acetylcholinesterase inhibitor (Acetylcholinesterase inhibitor, AChEI) passes through Inhibit the hydrolysis of AChE, increases ACh content between brain cynapse, so as to improve the cognitive function of AD.In addition, AChEI in addition to By inhibiting AChE to improve outside AD symptom, the deposition of amyloid plaques can also be delayed.

AChEI has obtained the AChEI: Tacrine, more of U.S. FDA approval as current most effective AD therapeutic agent Donepezil, Rivastigmine, galanthamine.Tacrine is the drug of U.S. FDA first approval treatment AD, is a kind of non-selective Invertibity AChEI withdraws from American market in May, 2012 due to that transaminase can be caused to increase with hepatotoxicity wind agitation.It is more how piperazine (Donepezil) is the second generation reversible sexual centre AChEI of specificity together, acts on very little to periphery AChE, inhibits AChE active Intensity is 570 times for inhibiting butyrylcholine esterase, and selectivity with higher, it is big that side effect is low and without obvious hepatotoxicity wind agitation The choice drug of most AD patients.Rivastigmine is carbamates, long-acting reversible, noncompetitive AChEI, to big brain The AChE of horse and cortex has selectivity, for light, moderate Alzheimer's disease oral medication.Galanthamine is derived from snow The alkaloid of ball bulb, can reversible inhibition AChE activate presynaptic and postsynaptic nicotine type nicotinic ACh receptor simultaneously, and nicotine type nicotinic ACh receptor stimulating agent can improve animal and man memory.

Aptamer (aptamer) is also referred to as aptamers or aptamer, is the Fas lignand system evolution technology by exponential enrichment (systematic evolution of ligands by exponential enrichment, SELEX) screens obtained energy Be folded into single stranded DNA/RNA oligonucleotide of three-D space structure, can a variety of targets of specific recognition, such as protein, polypeptide, gold Belong to even complete cell of ion, small molecule etc..SELEX technology is by the Ellington and Tuerk in the U.S. et al. in nineteen ninety For the first time in the technology that can be used for screening the single-minded nucleotide for targeting a certain certain target molecules of different experiments room invention, Ta Menfen The RNA segment that can be specifically bound with organic dyestuff and bacteriophage T4DNA polymerase Shai Xuan have not been obtained, and has been referred to as to be adapted to Son, thus this completely new concept of aptamer occurs and gradually develops.Nucleic acid aptamer energy and target molecule are special with high-affinity Property combine (dissociation constant be pM- μM), property is similar to antibody, but compared to for antibody its with more unique advantages, As: 1) quickly and controllable: aptamer is obtained through produced in vitro completely, so can rapid synthesis；In-vitro screening makes aptamer Specificity and affinity be strictly controlled, and allow generate be directed to toxicity and non-immunogenic target spot introduction；2) excellent Pharmacokinetics: natural RNA/DNA has lower pharmacokinetics, the main reason is that degradation and the kidney of nuclease It removes；Aptamer can solve both limitations by chemical modification appropriate；3) resistance to nuclease: nucleic acid in vivo passes through restriction endonuclease With 5 ' -3 ' and 3 ' -5 ' exonucleases in conjunction with and degrading in serum；Chemical modification appropriate prevents aptamer in serum It is middle to degrade through both enzymes；4) clearance rate: preventing the degradation of nuclease even across extensive modification, and aptamer also must be big It could be rested in blood circulation for a long time in 40kD；5) administration mode multiplicity: the solubility of most of therapeutic monoclonal antibodies Relatively low, volume is also very big, therefore most of Antybody therapy drugs are administered by venoclysis (usually more than 2-4h), are fitted Gamete can pass through vein or subcutaneous injection；6) stability is good: aptamer after high temperature, denaturation can activity recovery again, and Freeze-dried powder can save longer time at room temperature (more than 1 year)；7) hypotoxicity and low immunogenicity；8) low cost etc..

The advantages of based on aptamer, nucleic acid aptamer class drug are able to fast development, mainly pass through inhibition or activation target Molecule interferes downstream signaling pathway and plays therapeutic effect.Existing 11 kinds of aptamers in clinical test different phase at present, It can be used for treating the various diseases such as macular degeneration, cancer, thrombotic diseases and inflammation.Other than being used alone as drug, fit Gamete, which passes through, combines various therapeutic agents, including chemotherapeutics, nano material, protein/polypeptide, nucleic acid, photosensitizer etc., is used as target To carrier drug delivery to specific organization.

Summary of the invention

The first purpose of the invention is to provide nucleic acid aptamers or its chemical modification object to prepare acetylcholinesterase suppression Application in preparation, the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO:2.

A second object of the present invention is to provide nucleic acid aptamers or its chemical modification object to treat Alzheimer in preparation Application in family name's medicine.

The chemical modification object is 2', ribose of at least one nucleotide for including in above-mentioned nucleic acid aptamer On hydroxyl be added replaced any one in hydrogen atom, fluorine atom ,-O- acyl group and amino, and at the end 3' or the end 5' Any modification of FCM, FITC, biotin.

We successfully screen to obtain by SELEX technology can be with the DNA aptamer Ob1, Ob2, Ob3 in conjunction with AChE.First Probe into whether aptamer Ob1, Ob2, Ob3 have external inhibition Mice Homogenate AChE activity with AChE activity detection kit Effect, the results showed that aptamer Ob2 has external inhibition Mice Homogenate AChE active function；Then detection aptamer Ob2 makees With time and concentration variation on the active influence of Mice Homogenate AChE, while detecting the variation of aptamer Ob2 concentration and people is recombinated The active influence of AChE.The result shows that: aptamer Ob2 inhibits Mice Homogenate AChE active function and time correlation in vitro, 30min or so Ob2 can make Mice Homogenate AChE maximum inhibition reach maximum；Aptamer Ob2 inhibits Mice Homogenate Effective 503nhibiting concentration IC of AChE₅₀=0.3174 μM, people is inhibited to recombinate the effective 503nhibiting concentration IC of AChE₅₀=2.5665 μM. Telocoele is administered and detects effect of the aptamer Ob2 on AD model mice Tg6799 for AChE.Aptamer as the result is shown Ob2 can improve AD model mice Spatial memory ability without influencing its locomitivity；Western blot shows aptamer The decline of protein B ACE1, sAPP β and the GFAP expression of hippocampus of mice area, Ob2 treatment group and cortical area, and pass through α secretase The catabolite sAPP alpha expression amount of approach does not have significant change；ELISA shows that aptamer Ob2 can reduce hippocampus of mice and cortex A 42 content of β 40 and A β；Thioflavin S dyeing and immunofluorescence show hippocampus of mice area, aptamer Ob2 treatment group and cortex senile plaque Deposition quantity and area coverage reduce；Simultaneously under Ob2 processing group hippocampus of mice area reactivity star spongiocyte fluorescence intensity Drop.Aptamer for people AChE is the powerful of examination of the inside with outside AChE, and is expected to exploitation as the new of the diseases such as treatment AD Type AChE inhibitor.

This research by SELEX technology successfully screen to obtain can with the DNA aptamer Ob2 of high-affinity combination AChE, and Prove that the aptamer has the function of inhibiting AChE external activity.Exploitation for new potent special AChE inhibitor provides Research foundation provides new method and thinking for AD treatment.

Detailed description of the invention

Fig. 1 is the activity that vitro detection aptamer Ob2 inhibits AChE.A: for the aptamer Ob1-Ob3 of AChE and control Aptamer Scr inhibits Mice Homogenate AChE activity situation in vitro,^**P<0.01.B: for the aptamer Ob2 various concentration of AChE It is external to inhibit Mice Homogenate AChE active function time relationship.C: for AChE aptamer Ob2, control aptamer Scr and Positive control medicine donepezil inhibits Mice Homogenate AChE active function concentration relationship in vitro.D: for the aptamer of AChE Ob2, control aptamer Scr and positive control medicine donepezil inhibit people to recombinate AChE active function concentration relationship in vitro.

Fig. 2 is the shadow after aptamer Ob2 and Scr intracerebral is administered to transgenic mice Tg6799 locomitivity and working memory It rings.The administration of a:Tg6799 mouse pipe laying and behavior and biochemical test time sequencing schematic diagram.B:Tg6799 mouse pipe shows It is intended to.C: each group mouse movement total distance and center time in spacious field experiment.Each group mouse enters each arm in d:Y maze experiment Total degree and it is spontaneous alternately rate.

Fig. 3 is that the Spatial memory ability of water maze after the adapted sub- Ob2 intracerebral of transgenic mice Tg6799 is administered changes It is kind.A: mouse mouse in space exploration experiment passes through the number of original platform position,^*P<0.05.B: mouse is real in hidden platform Incubation period in testing,^*P<0.05.C: the average swim speed of mouse.D: in space exploration experiment, mouse is in target quadrant institute Stay the percentage that the time accounts for total time.E-f: in space exploration experiment, the group mouse movement track Scr and Ob2 represents figure.

Fig. 4 is correlative protein expression situation after the adapted sub- Ob2 and Scr intracerebral administration of transgenic mice Tg6799.A: small Mouse hippocampus BACE1, sAPP α, sAPP β and star spongiocyte labelled protein GFAP protein immunoblotting band.B: mouse Hippocampus BACE1, sAPP α, sAPP β and star spongiocyte labelled protein GFAP protein immunoblotting band gray scale Data-Statistics Analysis chart,^**P<0.01,^*P<0.05,ns:no significance.C: mouse cortex BACE1, sAPP α, sAPP β and star-like glue Cell plastid labelled protein GFAP protein immunoblotting band.D: mouse cortex BACE1, sAPP α, sAPP β and star-like colloid are thin Born of the same parents' labelled protein GFAP protein immunoblotting band gray value statistical analysis figure.^**P<0.01,^*P<0.05,ns:no significance。

Fig. 5 be aptamer Ob2 and Scr administration after mouse A β 42 and A β 40 hippocampus of mice and cortex content.A: mouse 42 content of hippocampus and cortex A β；B: 40 content of hippocampus of mice and cortex A β；

Fig. 6 is hippocampus of mice and cortex immunofluorescence dyeing after the administration of aptamer Ob2 and Scr intracerebral.A: hippocampus of mice area 6E10 and GFAP immunofluorescence dyeing, which represent, schemes.B: mouse cortex 6E10 represents figure with GFAP immunofluorescence dyeing.C: mouse sea Horse 6E10 positive plaques number and GFAP average fluorescent strength,^*P<0.05.D: mouse cortex 6E10 positive plaques number,^*P< 0.05。

Fig. 7 is hippocampus of mice and cortex plaque burden after the administration of aptamer Ob2 and Scr intracerebral.A: hippocampus of mice area Sulfur Plain S patch dyeing (left side) and patch number and area percentage (right side).B: mouse cortex thioflavine S patch dyes (left side) and patch Number (right side).

Specific embodiment

The following examples are further illustrations of the invention, rather than limiting the invention.

Embodiment 1: for the synthesis of people's AChE nucleic acid aptamer

3 adaptor sequences (Ob1, Ob2, Ob3) for people AChE are obtained using SELEX technology screening.Wherein screen Target behaviour AChE, the random library used (85nt) is containing 25 random sequences.We are in Shanghai invitrogen public affairs Department synthesizes the following adaptor sequence for people AChE, and purity is pure up to HPLC.Wherein Scr is random sequence as negative right According to for subsequent experiment.

Ob1:5'-TAATACGACTCACTATAGCAATGGTACGGTACTTCCCTCTCGTGCTAAA CATAGGCCCGTA CAAAAGTGCACGCTACTTTGCTAA-3'(SEQ ID NO:1)

Ob2:5'-TAATACGACTCACTATAGCAATGGTACGGTACTTCCCTTCGAAAACACC CTGCCCCTCACA CAAAAGTGCACGCTACTTTGCTAA-3'(SEQ ID NO:2)

Ob3:5'-TAATACGACTCACTATAGCAATGGTACGGTACTTCCCATTAGAATCTGT GACAATAACGTT CAAAAGTGCACGCTACTTTGCTAA-3'(SEQ ID NO:3)

Scr:5'-TGGTAGGTACGAGATCTATTAAACCTCGCATTTCCAGAATCATGTTATT AAACACCAGACC GATAGAGTAGGCACTTTGCGAGAC-3'(SEQ ID NO:4)

Embodiment 2: aptamer inhibits AChE activity experiment in vitro

The preparation of (1) 10% Mice brain tissues homogenate: mouse takes out rapidly its brain after sacrificed by carbon dioxide on ice platform Tissue, weighing rinse brain tissue surface with 4 DEG C or less physiological saline, blot surface moisture with filter paper, weigh, by weight (g): Volume (mL)=1:9 ratio, is added 9 times of physiological saline, and shredding tissue block as early as possible with small scissors (will contain organized small beaker It is put in ice-water bath), and little magnetic bead is added, it is quickly homogenized with mechanical homogenizers, homogenate is under the conditions of 4000rpm/min, 4 DEG C It is centrifuged 30min, takes its supernatant to be sub-packed in 2mL centrifuge tube, is saved backup in -80 DEG C.

(2) BCA method measures the protein concentration in 10% Mice Homogenate: by the bovine serum albumin of 2mg/mL in kit White standard items carry out doubling dilution with distilled water, concentration be respectively 2mg/mL, 1mg/mL, 0.5mg/mL, 0.25mg/mL, 0.125mg/mL,0mg/mL.Working solution, which is prepared, presses A liquid: B liquid=50:1 is prepared, and required working solution dosage is 100 hole × 3 μ L/ Multiple holes × (standard items number+total number of samples).Prepared 100 μ L of working solution is added in every hole in 96 orifice plates, is then separately added into Brain homogenate protein example after prepared standard items and dilution, every 5 μ L of hole, each three multiple holes, whole operation on ice are simultaneously most Amount avoids generating bubble.After the completion of sample-adding, beaing 96 orifice plate, four side walls mixes well sample with working solution, and by 96 orifice plates It is placed in 37 DEG C of baking ovens and is incubated for colour developing 30min, be subsequently placed at light absorption value of the test sample at 595nm in microplate reader.According to Standard curve reads each protein sample concentration within the scope of curve linear, calculates protein concentration according to protein sample extension rate.

(3) AChE determination of activity: 96 orifice plates are used, 50 μ L brain homogenate solutions are taken by kit specification, with reagent 1 μm of ol/mL standard control in box measures its vigor.Using 96 orifice plates, three groups of repetitions are done in each reaction, and reaction system is specific Operation such as table 1, it is molten to calculate homogenate by formula 1 in the absorbance (OD value) of wavelength 405nm for microplate reader test sample after completion of the reaction The enzyme activity of liquid；

The concrete operation step of 1 enzyme activity determination of table

Calculation formula 1:

(4) aptamer inhibits AChE determination of activity

A) dilution of aptamer: before dilution, assembling DNA to tube bottom the primer pipe centrifugation several seconds, careful tube used for bottom pouring lid, with Exempt to cause powder to splash out to cause DNA to lose, adds suitable physiological saline, 50 μM of concentration, needed for when use, is diluted to again Concentration；Aptamer dosing pre-treatment: 95 DEG C of heating 5min, cooled on ice 10min, 37 DEG C of placement 10min.

B) reaction step: taking 6 μ L aptamer solution to be measured and 6 μ L Mice Homogenate solution, mixes and keeps the temperature at 37 DEG C of postposition 30min takes 5 μ L as measurement sample；It is operated again by measurement pipe in upper table 1 and the concrete operation step of control tube；Finally with enzyme mark Instrument test sample OD value at 405nm, the percentage being calculated compared with brain homogenate solution is the measurement hole OD value of sample is i.e. For enzyme inhibition rate；

C) enzyme inhibition rate of each aptamer data processing: is calculated by calculation formula 2.Wherein instrument connection 1 is Mice Homogenate Solution, instrument connection 2 are the mixture of aptamer to be measured and Mice Homogenate solution, and control wells 1 and control wells 2 are respectively front two Empty blank assay is to eliminate systematic error.

Calculation formula 2:

As the result is shown: proving three kinds the screened early period aptamers for being directed to AChE with AChE activity detection kit In Ob1-Ob3, wherein Scr presses down Mice Homogenate AChE activity without obvious as negative control, Ob1 and Ob3 for random sequence Effect processed, effect with to compare aptamer Scr similar, Ob2, which has, apparent inhibits Mice Homogenate AChE active function (Fig. 1 a). Further for probe into aptamer Ob2 inhibit in vitro mouse AChE activity whether with Ob2 and Mice Homogenate incubation time and Ob2 concentration change and change, we have detected various concentration aptamer Ob2 inhibit in vitro Mice Homogenate AChE activity be adapted to Sub- Ob2 action time relationship (Fig. 1 b), discovery aptamer Ob2 and Mice Homogenate action time, mouse brain was even in 0-15min AChE maximum inhibition rapid increase is starched, the subsequent rate of climb is slack-off, and 30min or so Ob2 can make Mice Homogenate AChE maximum inhibition reaches maximum.Meanwhile compared with positive control medicine donepezil, we have detected the variation of Ob2 concentration To mouse brain AChE activity change (Fig. 1 c), it has been found that aptamer Ob2 has extraordinary inhibiting effect to mouse brain AChE, Effective 503nhibiting concentration IC₅₀=0.3174 μM of (donepezil IC₅₀=0.4653 μM).Meanwhile we also demonstrate aptamer Ob2 equally has Inhibiting enzyme activity to people AChE, and detects Ob2 concentration and change influence (Fig. 1 d) active on rhAChE, and discovery is suitable Gamete Ob2 equally has good inhibiting effect, IC50=2.5665 μM of (donepezil of effective 503nhibiting concentration to rhAChE IC₅₀=0.9514 μM).

Embodiment 3: the administration of mouse telocoele pipe laying and animal behavior experiment

(1) it anaesthetizes: 3-4 months big male Alzheimer disease model mouse Tg6799 is selected, with 4% chloraldurate by every 0.2mL anesthesia is administered in 20g mouse peritoneal, and every increase 1g dosage increases 0.01mL, and mouse falls down, pinch tail without pain reaction, Of flaccid muscles, smooth breathing is to reach abundant anaesthetic effect；

(2) fixed: the mouse anaesthetized being placed on adapter with the posture of prostrate and fixes (entire head water It is flat, cannot shake)；

(3) preserved skin and pipe laying: mouse head skin attachment hair is cut off, is cut after 75% alcohol routine disinfection operative region Skin, exposure skull dip in a small amount of physiological saline with aseptic cotton carrier and embrocate skull surface, and exposure bregma, " mouse brain is vertical for coordinate reference Body positions map ", it determines that pipe is embedded in telocoele using oscillatory type slicer after pipe laying, selects to open 0.8mm by bregma, backward The coordinate of 0.16mm, depth 2.3mm as formal pipe laying.It is punched after fixed point with drill bit, is careful not to damage endocranium and brain is real Matter.After being implanted into casing, with dentistry powder by casing and skull close adhesion, after dentistry powder solidifies completely, removes mouse and cover Mouse is randomly divided into experimental group and control group by conduit cap, and uses marker to tint in dentistry powder as the label of experimental group. Mouse two cage raisings of partition after pipe laying, are administered after art 3-4 days with four-way administration pump.

(4) aptamer medicament is prepared and is administered: being used normal saline aptamer (Ob2 and Scr), concentration is 100 μM, is filled Divide and mix, manner of formulation is for example aforementioned.Start to be administered within the 4th day after mouse pipe laying, 4 μ L are administered in every mouse every time, are administered every three days Once, it is administered 15 times altogether, injects inner tube after administration every time and the conduit of connection requires to be rinsed well with distilled water, to prevent physiology Salt water blocks injection inner tube.After administration, continuous three days handle mouse, every mouse slow-witted 5min in experimenter's hand makes small The operation of mouse adaptation experimenter, it is therefore an objective to which in official act experiment, experimenter will not cause to stimulate to mouse crawl to it.It is small After mouse handle, start within the 4th day to carry out a series of behavioral experiments, including spacious field experiment, the labyrinth Y, morris water maze.

A) spacious field is tested: spacious field experiment (open field test, OFT) is a kind of for evaluating animal spontaneous activity, visiting The experiment of Suo Hangwei, anxiety, depressive state.Experimental box is in the gray polyvinyl chloride square box having a size of 40 × 40 × 30cm It carries out, data is acquired by video camera, analyze software records experimental data.Experiment will wipe clean experiment box before starting with alcohol Son then puts down mouse into spacious field center gently, and mouse is allowed freely to explore 5 minutes, with 7.0 software collection mouse of Etho Vision Total distance etc. is moved in movement 5 minutes.It also needs to wipe clean test block with alcohol before being often put into a mouse, and uses cardboard It fans and accelerates residual alcohol volatilization, avoid the interference of mouse smell and alcohol smell to mouse.

B) labyrinth Y-: the labyrinth Y is three arms etc. point radiant type labyrinth, is mainly used in working memory, the discrimination formula of animal Study, is made of the support arm that three identical, mutual angles are 120 °, and each support arm size is 35 × 5 × 10cm, in Y fan The good camera of frame above palace observes the activity of mouse below camera by the computer far from the labyrinth Y.By three, the labyrinth Y support arm Recorded at random is A, B, C, and mouse is put into the end of one of support arm, continuous autonomous alternately 8min, and successively record alternating Sequentially, the autonomous alternately rate of detection.Smell is remained with a mouse upper in 75% labyrinth alcohol wipe Y arm after every mouse. Alternately rate %=replaces number/(total degree -2) × 100%.

C) morris water maze: water maze is a kind of forced mouse swimming, and the experiment for being hidden in underwater platform is found in study, It is mainly used for testing mouse to space orientation ability of learning and memory.Water maze by constant temperature swimming pool (diameter 120cm, high 50cm), Round platform (diameter 9cm), water maze image automatic collection and the software analysis system group of adjustable height and moveable position At.Water temperature constant temperature is set in 18~22 DEG C in experimentation, and light source is using wall lamp and guarantees do not have shadow on the water surface of pond, avoids Light has reflection the water surface, in case the illumination shadow for staying in the water surface is mixed the shadow of shadow and mouse by the acquisition system of software Confuse, spatial cues (object of reference) are no less than three, 4 objects are pasted on pool wall as near vision object of reference, and in pond In outer room there are many long distance vision object of reference and in an experiment keep reference position it is constant.Experimental period: hidden platform Test is 6 days, training time 90s；Experiment number: in the test of hiding platform, training 4 times daily, daily, each quadrant It is only used once, mouse be not put into continuously to centainly the same quadrant, if mouse finds platform in test, allow it in platform Stop 30s, as after 90s mouse still do not find platform if guide mouse to appear on the stage and allow mouse stop 30s；Hidden platform After the test, platform is removed, mouse is faced the wall and meditated from platform opposite side quadrant midpoint and is put into water, allows it freely to explore in water and seeks Levelling, and record mouse and pass through the number of original platform, account for percentage of total time etc. in the time where original platform quadrant.

As the result is shown: by 3-4 months big male Alzheimer's disease transgenic mice Tg6799 be randomly divided into Scr group with Ob2 group, using stereotaxic instrument in mouse telocoele pipe laying, pipe such as Fig. 2 b, pipe laying starts to be administered after terminating 3-4 days, Administration mode and handle operation start to carry out a series of behavioral experiments on the 4th day it has been observed that after mouse handle, including Spacious field experiment, the labyrinth Y, morris water maze (Fig. 2 a).Spacious field experimental result shows Scr group and Ob2 group mouse movement total distance And center time (Fig. 2 c) is not statistically significant.Y maze experiment is the result shows that Scr group and arm entry in Ob2 group eight minutes No difference of science of statistics (Fig. 2 d) between total degree and spontaneous two groups of rate of alternating illustrates that AChE specific inhibitory aptamer Ob2 is administered The locomitivity of experimental mice is not influenced afterwards, drug side-effect has limitation, while without improvement AD mouse working memory Effect.Then We conducted morris water maze laboratories, and two groups of mouse find during the training of the first six day as the result is shown The incubation period of visible platform gradually decreases with the increase of training number of days, and Ob2 group mouse incubation period lower than Scr group mouse, two There is statistical difference through one-way analysis of variance between group,^*P < 0.05 (Fig. 3 b).Swimming rate no difference of science of statistics between two groups (Fig. 3 d).In space exploration test, Ob2 group mouse spanning platform number is higher than Scr group mouse, and difference is statistically significant,^*P< 0.05 (Fig. 3 a), it is high with Scr group to time Ob2 group in target quadrant institute between two groups, there is trend but no significant difference (is schemed 3c).The motion profile of Scr and Ob2 group mouse is shown in Fig. 3 e and Fig. 3 f.Illustrate that AChE specificity aptamer Ob2 can improve Tg6799 The Spatial memory of model mice.

Embodiment 4: protein blot experiment

Mouse takes out rapidly full brain and is put into the physiological saline of ice and rinse brain tissue surface blood after sacrificed by carbon dioxide Liquid then takes hippocampus of mice and cortex to be put into clean EP pipe respectively, and whole process operates on ice；RIPA lysate (RIPA+ is added 1%PMSF), cortex adds 500 μ L, and hippocampus adds the 150 subsequent mechanical homogenizers of μ L to be quickly homogenized, revolving speed 6500rpm, and 10s/ times × 3 A circulation, every 10s intermediate hold 10s；Sample is then put into 4 DEG C of rotation suspension instrument and sufficiently cracks 30min, 4 DEG C, 16900rcf It is centrifuged 30min, supernatant is taken to be stored in -20 DEG C；Protein quantification is done in the manner aforesaid after taking supernatant to dilute, according to protein quantification concentration 5 × loading buffer containing beta -mercaptoethanol is added, 100 DEG C of 10min of subsequent metal bath exempt from albuminous degeneration for albumen Epidemic disease Blot experiment.

As the result is shown: the AD model mice that protein immunoblotting experiment detection is handled through AChE specificity aptamer Ob2 Tg6799 cortex and hippocampus correlative protein expression, hippocampus of mice area (Fig. 4 a) and cortical area (Fig. 4 c) correlative protein expression result table Bright Tg6799 model mice is after AChE specificity aptamer Ob2 processing, hippocampus of mice area (Fig. 4 b) and cortical area (Fig. 4 d) egg White BACE1, albumen sAPP β and Protein G FAP substantially reduce (^*P < 0.05,^**P < 0.01), and the drop of enzymatic pathway is secreted by α It solves product sAPP alpha expression amount and control mice (Scr group) is not statistically significant.

Embodiment 5:ELISA detects A β yield (referring to kit specification)

(1) prepared by brain tissue homogenate: weighing brain weight, the 5M guanidine hydrochloride for organizing 8 volumes of addition cold by 100mg is molten Liquid, mechanical homogenisation after mixing, 6500rpm, 10s × 3cycle, room temperature shaker place 3-4h.It is cold that 10 times of volumes are added in subsequent sample PBS (contains 1 × protease inhibitors), and 16000g is centrifuged 20min under the conditions of 4 DEG C, takes supernatant to do protein quantification with BCA method, is used in combination Standard Diluent Buffer is by 1:1000 dilute sample as sample to be tested.

(2) standard items are prepared: illustrating that a certain amount of Standard Reconstitution is added by standard items body Buffer, subsequent by specification dilution standard product, concentration be respectively 500pg/mL, 250pg/mL, 125pg/mL, 62.5pg/mL, 31.25pg/mL、15.63pg/mL、0pg/mL。

(3) experimentation: sample to be tested (50 hole μ L/) and standard items (50 hole μ L/) are separately added into orifice plate, and reserved Blank well；In addition to blank well, every hole is added 50 μ L and detects antibody-solutions, with cover board film sealing plate, with finger from grillage and lath It slips over to ensure that plate hole is fully sealed, mixes gently, place room temperature shaker and be incubated for 3h；Cover board film is removed after incubation, is discarded Liquid in hole is had the final say on sheet paper, is completely removed residual in plate hole with 1 × washing buffer (every 260 μ L of hole) hole flushing 4 time Liquid stay；In addition to blank well, the anti-rabbit secondary antibody liquid of 100 μ L1 × HRP label is added in every hole, is mixed gently, and room temperature shaker is incubated for 30min；Liquid and hole flushing 4 times are discarded according to (5), adds 100 μ LTMB developing solutions, places room temperature, is protected from light and is incubated for 30min；Every hole is added 100 μ L terminate liquids terminate reaction, gently beat side edge thereof mixing, are subsequently placed at measurement light absorption value (450nm) in microplate reader, draw Standard curve processed reads sample to be tested concentration according to standard curve, and according to protein quantification concentration calculation sample size (ng/ mg)。

As the result is shown: mouse cortex and proteins of hippocampi tissue being extracted according to ELISA kit method, use ELISA method detection Total A β 40 and 42 content of A β, the results show that compared with control mice (Scr group), for the aptamer Ob2 processing group mouse of AChE In hippocampus and cortex A β 42 (Fig. 5 a) and A β 40 (Fig. 5 b) content substantially reduce (^*P < 0.05,^**P<0.01)。

Embodiment 6: mouse immune fluorescence

(1) mouse heart perfusion: by aforementioned anesthesia method by after mouse anesthesia, four limbs is stuck in syringe needle and are fixed in bubble On foam plate, breastbone most protrusion is clamped with tweezers on the other hand, the other hand cuts off the skin and rib cage in thoracic cavity, exposure heart with scissors And liver, blunt separation pericardium and surrounding soft tissue；Left hand haemostatic clamp lifts apex, and the right hand punctures perfusion needle (No. 6) The apex of the heart, after the sense that occurs falling through, inserting needle about 5mm fixes needle point with haemostatic clamp, opens physiological saline valve, cut off right auricle of heart, until The liquid flowed out from right auricle of heart can stop perfusion for colourless, liver color is white；The conduit of subsequent perfusion needle mouth changes 4% poly first into The conduit of aldehyde perfusion liquid continues perfusion, and anxiety, tail tilting explanation reach fixed effect to mouse four limbs suddenly at this time, continues perfusion 5min or so.

(2) brain and dehydration are taken: taking brain after being perfused successfully, skin of head is cut off and exposes skull, the right hand, which is held to cut, gently cuts off cranium Bone middle line, this process need it is adherent cut upwards, be otherwise easily destroyed brain tissue, then with tweezers clamp skull from it is interior it is past turn up, from It is lower gradually to reject skull upwards, by the exposure of brain tissue amount, with tweezers from olfactory bulb remove full brain, go deep into basis cranii and remove to be spiritually attracted Fork and trigeminal neuralgia and cross-section cerebellum, are immediately placed in 4% paraformaldehyde perfusion liquid after taking out full brain, solid after 4 DEG C of preservations overnight It is fixed；Formaldehyde perfusion liquid is outwelled and is blotted with filter paper by next day；It is placed in flowing running water and persistently rushes 1h or so；It will after flushing Brain tissue is put into the 15mL centrifuge tube equipped with 30% sucrose solution and is dehydrated, 4 DEG C of preservations, until full brain is deposited to tube bottom.

(3) frozen section: setting freezing-microtome temperature, and brain tissue is taken out from sucrose solution and sops up extra liquid Body is covered with OCT frozen section embedding medium on sample carrier, is put into freezing-microtome to bleaching, and then takes out and quickly uses knife Piece equating, and by brain tissue finishing be concordantly placed on sample carrier, coat one layer of OCT on brain tissue surface, be placed in freezing stage after Continuous freezing 30min.According to the position and form of mouse brain map cortex and hippocampus, start to be sliced, adjustment freezing microtome slice With a thickness of 35 μm, piece cut can be collected continuously or continuously be collected together after 5-6 piece, and required brain piece is collected in EP It in pipe and is temporarily put in freezing microtome and temporarily saves, slice terminates piece depositing in -80 DEG C.

(4) it immunofluorescence: 1. rinses: PBS is added in the brain section taken out toward -80 DEG C, pours into six orifice plates that PBS has been added It is middle to rinse three times, each 5min；2. closing: 5%BSA (containing 0.3%TritonX-100) confining liquid of PBS preparation is added in room Warm shaking table closes 1h；Closing terminates hindbrain piece and rinses in PBS three times, each 5min；3. incubating primary antibody: primary antibody is added into brain piece Solution is incubated overnight in 4 DEG C of shaking tables；Simultaneously PBS rinsing is added three times in next day recycling primary antibody, each 5min；4. incubating secondary antibody: toward brain piece The middle fluorescence secondary antibody that corresponding kind source property is added is incubated for 1h, and three times, each 5min dilutes and be added fluorescence for subsequent PBS rinsing Operating process after secondary antibody will be protected from light；5. patch: using DAPI mountant mounting, patch after patch after slide surface liquid is slightly dry Piece process is sure not to make brain piece dry tack free, observation of finally taking pictures under confocal fluorescent microscopic.

As the result is shown: in a variety of central nervous system diseases, reactive star spongiocyte can limit inflammation progress and Protect the neuron in brain tissue retrogression.The special aptamer Ob2 of AChE is directed to transgenic mice intracerebral patch to probe into The influence of deposition and star spongiocyte takes experimental group (Ob2 group) to do with control group (Scr group) mouse brain slice after laxative Immunofluorescence, Ob2 processing group mouse 6E10 positive plaques are in hippocampus (Fig. 6 a) and cortical area (Fig. 6 b) precipitation number as the result is shown Amount is less than control group,^*P < 0.05 (Fig. 6 c-d), while Ob2 processing group hippocampus of mice area reactivity star spongiocyte fluorescence is close Control group will be lower than by spending (GFAP average fluorescent strength),^*P < 0.05 (Fig. 6 a&c).

Embodiment 7: thioflavin S dyeing

Brain section is placed in 0.01% thioflavine S dye liquor of 50% ethyl alcohol preparation and dyes 8min；Brain piece is taken out with eyebrow pencil to put Enter and is rinsed in 50% ethyl alcohol twice, each 5min；It takes out brain piece to rinse in PBS twice, each 5min；Mounting after brain piece patch It is observed under confocal fluorescent microscopic.

As the result is shown: being directed to influence of the special aptamer Ob2 of AChE to transgenic mice intracerebral plaque deposition to probe into, beat Experimental group (Ob2 group) and control group (Scr group) mouse brain slice is taken to do the dyeing of thioflavin S patch after medicine, as the result is shown Ob2 Processing group hippocampus of mice area's plaque deposition quantity and patch area coverage are considerably less than control group,^*P < 0.05,^**P < 0.01 (figure 7a), while Ob2 group mouse cortex area plaque deposition quantity ratio Scr group significantly reduces,^*P < 0.05 (Fig. 7 b).

The measurement data of above embodiments is indicated with mean ± standard error.The statistical analysis application SPSS of all experimental datas 20.0 softwares.Different statistical analysis is taken according to different experimental designs；The data analysis of two independent samples uses independent sample This t is examined；Sample data analysis uses two-way analysis of variance (Two-Way ANOVA) between two groups of repeated measurement data.With α =0.05 is used as test stone.Think that experimental data difference has statistical significance when P < 0.05.

The above is only the preferred embodiment of the present invention, it is noted that above-mentioned preferred embodiment is not construed as pair Limitation of the invention, protection scope of the present invention should be defined by the scope defined by the claims..For the art For those of ordinary skill, without departing from the spirit and scope of the present invention, several improvements and modifications can also be made, these change It also should be regarded as protection scope of the present invention into retouching.

Sequence table

<110>Nanfang Medical Univ

<120>application of the nucleic acid aptamer in preparation treatment Alzheimer's disease drug

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 85

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

taatacgact cactatagca atggtacggt acttccctct cgtgctaaac ataggcccgt 60

acaaaagtgc acgctacttt gctaa 85

<210> 2

<211> 85

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

taatacgact cactatagca atggtacggt acttcccttc gaaaacaccc tgcccctcac 60

acaaaagtgc acgctacttt gctaa 85

<210> 3

<211> 85

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

taatacgact cactatagca atggtacggt acttcccatt agaatctgtg acaataacgt 60

tcaaaagtgc acgctacttt gctaa 85

<210> 4

<211> 85

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

tggtaggtac gagatctatt aaacctcgca tttccagaat catgttatta aacaccagac 60

cgatagagta ggcactttgc gagac 85

Claims (4)

1. the application of nucleic acid aptamer or its chemical modification object in preparation acetylcholinesterase inhibitor, the nucleic acid adaptation The nucleotide sequence of son is as shown in SEQ ID NO:2.

2. application according to claim 1, which is characterized in that the chemical modification object is in the nucleic acid aptamer Including at least one nucleotide the position ribose 2' on hydroxyl by any one in hydrogen atom, fluorine atom ,-O- acyl group and amino It is replaced, and any modification of FCM, FITC, biotin is added at the end 3' or the end 5'.

3. the application of nucleic acid aptamer or its chemical modification object in preparation treatment Alzheimer's disease drug, the nucleic acid The nucleotide sequence of aptamer is as shown in SEQ ID NO:2.

4. application according to claim 3, which is characterized in that the chemical modification object is in the nucleic acid aptamer Including at least one nucleotide the position ribose 2' on hydroxyl by any one in hydrogen atom, fluorine atom ,-O- acyl group and amino It is replaced, and any modification of FCM, FITC, biotin is added at the end 3' or the end 5'.