CN110372799B - Fusion protein for preparing single-cell ChIP-seq library and application thereof - Google Patents

Abstract

The invention relates to a fusion protein for single cell ChIP-seq library preparation and application thereof, wherein the fusion protein comprises Tn5 transposase and Fc binding protein, the kit comprises the fusion protein and other auxiliary detection reagents, and the ChIP-seq detection method is carried out by using the fusion protein or the kit. The fusion protein, the kit and the method can improve library construction efficiency and reduce library background in the ChIP-seq detection process, thereby improving the accuracy of the ChIP-seq detection method and simplifying the ChIP-seq experiment process.

Description

Fusion protein for preparing single-cell ChIP-seq library and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a fusion protein for preparing a single-cell ChIP-seq library and application thereof.

Background

With the completion of gene sequencing and the advent of the post-genomic era, epigenetics has become a hot point of research in the biological field. Epigenetics (epigenetics) mainly studies the genetic modifications of DNA and related protein molecules without changes in the nucleotide sequence of the gene, which can be "memorized" by the cell and retained during the subsequent cell division, and its research direction includes: the regulation of gene transcription level selective expression and the regulation after gene transcription. At present, the hot spots of epigenetics are mainly focused on the selective expression control of gene transcription level, especially the interaction between transcription factor and DNA, DNA methylation and histone modification^[1]。

Chromatin Immunoprecipitation (ChIP), also known as binding site assay, is generally performed by the following steps: (1) crosslinking DNA and protein combined on the DNA by formaldehyde, separating chromosome and breaking into fragments with certain size; (2) immunoprecipitating and enriching a complex of the target protein cross-linked with DNA with a specific antibody; (3) carrying out reverse crosslinking under the condition of low pH value to release DNA fragments; (4) through the purification and detection of the DNA fragments, the sequence information of the interaction between the DNA and the protein is obtained. Since the ChIP technology can study the interaction between protein and DNA, it is widely used in the field of epigenetics to study the interaction between transcription factor and DNA, DNA methylation and histone modification.

With the development of new generation sequencing technology, a technology capable of researching the interaction between protein and DNA in a genome-wide range, namely chromatin co-immunoprecipitation-sequencing (namely, ChIP-seq), is developed on the basis of ChIP technology. The ChIP-seq technology comprises two parts of chromatin co-immunoprecipitation and high-throughput sequencing, wherein DNA combined with target protein is specifically enriched by the chromatin co-immunoprecipitation technology, then a sequencing library is constructed, high-throughput sequencing is carried out on enriched DNA fragments by adopting a next generation sequencing technology, and finally millions of sequence tags are accurately positioned on a genome, so that DNA segment information interacting with the target protein in the whole genome range is obtained^[2]。

At present, an optimized ChIP-seq technique related to the present technology is called "CUT&RUN(CleavageUnder Targets&Release Using Nuclease)”^[3]. The CUT&RUN fuses Protein A with nuclease MNase (Micrococcus nucleic acid), the Protein A introduces MNase into the binding site of antibody (recognizing specific transcription factor or histone modified antibody) by the characteristic that Protein A can be specifically bound with immunoglobulin G, Protein A-MNase can specifically cut the two ends of DNA bound by antibody by the endonuclease and exonuclease activity of MNase, the cut DNA fragment is released from cell nucleus, and the DNA fragments are subjected to library construction and sequencing analysis, so that the interaction map of specific Protein and DNA can be drawn at the whole genome level.

The specific technical scheme is shown in figure 1: con A beads are combined with cells, an antibody for identifying a specific transcription factor is added, incubation is carried out for a certain time to ensure that the antibody is fully combined with the transcription factor, a protein A-MNase fusion protein is added, the protein A-MNase can be specifically combined with a site combined by the antibody, and Ca is added²⁺Activating the activity of MNase nuclease by ions, wherein protein A-MNase can specifically cut the two ends of DNA combined with antibody, after the reaction of MNase is stopped, these cut DNA fragments are released from cell nucleus, then these DNA fragments are undergone the processes of library-building and secondary sequencing analysis, according to the sequencing resultBinding of a particular transcription factor can be mapped at the genome-wide level.

However, the current common ChIP-seq technology has the following disadvantages:

1. the library building efficiency is low, so that the library information is seriously lost when a small number of cells are made

When a library is built for a DNA fragment released after Protein A-MNase is cut, a traditional library building strategy of TruSeq is needed, and the connection efficiency of an Adaptor and the DNA fragment is low during library building. Especially, when a small amount of cells are used as starting materials, the loss of DNA fragments in the library building process is too much, so that the loss of main information of the library is finally caused, the failure probability of the experiment is high, and the interaction map of the protein and the DNA on the whole genome level cannot be obtained.

2. The background of the library is higher

After the Protein A-MNase cleavage reaction is terminated, all small DNA fragments will be released from the nucleus, where they are not bound to transcription factors or proteins. These small fragments are connected by an Adaptor in the library building process, and are amplified by PCR to form a high background, so that the complexity (complexity) of the library is reduced, and the experiment fails.

3. The conventional ChIP-seq technology cannot carry out in-situ detection on tissue slices and the like, and the spatial resolution of the tissue slices is damaged.

In view of the above, there is a need in the art to provide a ChIP-seq technology capable of effectively improving the efficiency of library establishment, reducing the background of the library, and realizing in situ detection.

[ REFERENCE ] to:

1. important applications and advances of next generation sequencing technologies in epigenetic research, Shen Sheng, et al, genetics, Vol.36, No.3, p.256-275, 3 months 2014

2. Chromatin immunoprecipitation-sequencing: new technology for researching protein-DNA interaction in a genome-wide range, aromatic proteins and the like, biochemical and biophysical development, page 216-225, volume 40, stage 3, 2013.

3、An efficient targeted nuclease strategy for high-resolution mappingof DNA binding sites.Skene PJ et al.,Elife,6:e21856 2017

Disclosure of Invention

The invention firstly relates to a fusion protein for chromatin co-immunoprecipitation-sequencing (ChIP-seq) library construction, wherein the fusion protein is a homodimer, and the monomer of the fusion protein comprises the following structure:

(1) a first functional block: tn5 transposase mutant;

(2) a second functional block: staphylococcus aureus Protein a (Protein a), streptococcus G Protein (Protein G), or a combination of Protein a and Protein G;

(3) the connecting structure (Linker) of each functional block and a protein purification label.

The Tn5 transposase mutant is characterized in that the following point mutations are carried out on the amino acid structure of a wild Tn5 transposase (the amino acid sequence is shown as SEQ ID NO. 1): E54K and L372P, wherein the amino acid sequence of the Tn5 transposase mutant is shown as SEQ ID NO. 2.

Preferably, each functional block of the fusion protein is connected through a Linker with an amino acid sequence shown as SEQ ID NO. 3;

preferably, the protein purification tag is: -HIS tag, GST tag, MBP tag, SUMO tag, NusA tag, or IgG magnetic bead is used to purify the fusion Protein directly using the specific affinity of Protein A tag and IgG Protein;

preferably, the second functional block is linked to the N-terminus (nitrogen-terminus) of the amino acid sequence of the first functional block;

most preferably, the monomer of the fusion protein is PAT or PAGTT, the amino acid sequence of PAT is shown in SEQ ID NO.4, and the amino acid sequence of PAGTT is shown in SEQ ID NO. 5.

The invention also relates to the application of the fusion protein in preparing a high-throughput sequencing library of a specific biological sample, wherein the biological sample comprises but is not limited to: non-crosslinked or fixed/crosslinked or fixed cultured cell samples, fresh tissue/crosslinked or fixed tissue samples, and the high throughput sequencing library is a chromatin co-immunoprecipitation-sequencing (ChIP-seq) library.

Specifically, the method for preparing the high-throughput sequencing library of the specific biological sample comprises the following steps:

(1) collecting and processing a target biological sample to obtain a single cell suspension;

(2) resuspending the cells with a binding buffer, adding a proper amount of specific protein-bound antibody, and washing to remove unbound antibody after the antibody is fully bound;

(3) resuspending the cells, adding the fusion protein, allowing the fusion protein to bind to the antibody sufficiently, and removing unbound fusion protein;

(4) activating the fusion protein, and fully reacting to obtain a DNA fragment with a label which is recognized and cut by the fusion protein;

(5) adding a termination buffer solution to terminate the reaction, and purifying the DNA fragment by using a purification kit;

(6) adding primers to perform PCR amplification to complete library construction.

The invention also relates to a kit for constructing the high-throughput sequencing library, which comprises: the fusion protein and a sample washing buffer solution, a binding buffer solution, an activation buffer solution, a library establishing primer and the like used in the conventional library establishing process, wherein the high-throughput sequencing library is a chromatin co-immunoprecipitation-sequencing (ChIP-seq) library.

Compared with the prior art, the beneficial effect of this disclosure is:

(1) the fusion protein, the kit and the method can improve library building efficiency and reduce library background in the ChIP-seq detection process, thereby improving the accuracy of the ChIP-seq detection method and simplifying the ChIP-seq experiment process.

(2) The method disclosed by the disclosure optimizes the Tn5 transposase and Fc binding protein mutant, an expression system, a purification means, an antibody, a fusion protein incubation condition and a cleavage reaction condition, and improves the binding efficiency of the antibody and the fusion protein and the efficiency and accuracy of DNA cleavage, thereby reducing the background and resolution of the library;

(3) the method disclosed by the disclosure can be used for in-situ detection of tissue slices, cell smears and cell slides, cell nuclei do not need to be cracked, chromatin is broken by ultrasound, and the spatial resolution of an original sample is reserved.

(4) The method disclosed by the disclosure can realize multi-organ and multi-tissue single cell ChIP-seq, and can simultaneously process cells from a plurality of different tissue sources or under a plurality of different pathological states in parallel.

(5) The method disclosed by the invention can quickly complete the preparation of the single cell ChIP-seq, and can be completed in a single day from the beginning of an experiment.

(6) The method disclosed by the disclosure can realize high-throughput single-cell ChIP-seq, and can obtain a ChIP-seq library of tens of thousands of single cells at one time.

(7) The method disclosed by the disclosure does not need to use a specially customized high-cost single-cell library sequencing method, and uses a specially designed Mosaic Troseq two-step PCR library preparation method, so that the obtained library can be sequenced by using an illunima standard sequencing method and platform. Compared with a specially customized single cell sequencing method, on one hand, the Mosaic Troseq library only needs 1/15 sequencing cost, and on the other hand, an experimenter can perform large-scale single cell sequencing without being skilled in professional sequencing knowledge.

Drawings

FIG. 1, the principle of action of ProteinA-MNase in ChIP-seq.

FIG. 2 is a map of the PAT expression vector construction.

FIG. 3, high purity PAT purification results.

FIG. 4, validation of binding of PAT to IgG.

FIG. 5, N-terminal insertion fusion Protein (PA2-Tn5) with Protein A block at Tn5 block, produced high activity PAT.

FIG. 6, comparison of In situ ChIP-seq (In situ-ChIP) and ultrasonic ChIP-seq (sonic ChIP) methods In the natural state (A) and the cross-linked state (B), H3K4me3In the Pou5f1 gene promoter region, H3K27ac In the Nanog gene enhancer region signal distribution (IGV track schematic).

FIG. 7, signal distribution (heat map) of H3K4me3(A) and H3K27ac (B) In the promoter region In comparison to the In situ ChIP-seq (In situ-ChIP) and ultrasonic ChIP-seq (sonic ChIP) methods In the native state (A) and the cross-linked state (B), where TSS represents the transcription initiation site.

FIG. 8, spatio-temporal specific in situ ChIP.

FIG. 9, PAGT, PAT and ChIP results show the signal distribution of H3K27ac in Pou5f1 promoter region (IGV track graph).

FIG. 10, PAGT, PAT and ChIP comparison, the signal distribution of H3K27ac in Pou5f1 promoter region (heat map).

FIG. 11, ChIP-seq flow chart of high throughput single cell.

FIG. 12, scheme for the two-step PCR library preparation by Mosaic Troseq.

Detailed Description

The formulations of the wash buffer 1, wash buffer 2, binding buffer, reaction buffer and stop buffer used for the fusion protein PAT (ProteinA-Tn5) or PAGT (ProteinA-ProteinG-Tn5) referred to in the examples below are as follows:

washing buffer 1: 50mM HEPES, 150mM NaCl and 0.5mM spermidine;

washing buffer 2: 50mM HEPES, 150mM NaCl, 0.5mM spermidine and 0.01% (w.t.) digitonin;

binding buffer: 50mM Hepes, 150mM NaCl, 0.5mM spermidine, 0.01% (w.t.) digitonin and 5mM EDTA;

reaction (activation) buffer: 25mM Mg2+ and 50mM trimethylol methylaminopropanesulfonic acid;

stop buffer: 100mM EDTA and 1% (w.t.) SDS.

The following fusion proteins of examples 5 to 6 are Protein A-Tn5, and the formulations of the used washing buffer A, washing buffer B, washing buffer C, antibody incubation buffer, etc. are as follows (high-throughput single-cell specific):

washing buffer A: 20mM HEPES, 150mM NaCl and 0.5mM spermidine;

washing buffer B: 20mM HEPES, 150mM NaCl, 0.5mM spermidine, 0.01% (w.t.) digitonin;

washing buffer C: 20mM HEPES, 150mM NaCl, 0.5mM spermidine, 0.01% (w.t.) digitonin and 0.1% Triton X-100;

activation buffer: 20mM HEPES, 10mM KCl, 1mM CaCl2, 1mM MnCl2

Antibody incubation buffer: 20mM HEPES, 150mM NaCl, 0.5mM spermidine, 0.01% (w.t.) digitonin, 0.1% Triton X-100 and 2mM EDTA;

single cell reaction buffer: 25mM Mg2+, 50mM trimethylol methylaminopropanesulfonic acid, and 0.01% (w.t.) digitonin;

single cell stop buffer: 40mM EDTA.

Single cell sorting buffer: 2% BSA/PBS +2mM EDTA

Single cell lysis buffer 10mM Tris-HCl pH 8.5, 0.05% SDS,0.1mg/ml proteinase K.

Example 1 design, expression and purification of high Activity ProteinA-Tn5(PAT protein)

The embodiment provides design and purification of a fusion protein of Tn5 with ultrahigh activity (mutant Tn5 promotes enzyme activity) and protein A-Tn5, the method has low cost and high protein production efficiency, and the method comprises the following steps:

1. design of ProteinA-Tn5 fusion Protein (PAT)

1) The nucleic acid sequences of mutant Tn5E54K and L372P (hereinafter referred to as Tn5) were cloned into pET28 expression vector as shown in fig. 2.

2) An IgG recognition domain linked to 2xProtein A.

3) The authenticity of the coding region was ensured by Sanger sequencing.

Compared with a wild Tn5, the mutant Tn5 in the PAT has stronger adaptors binding capacity, the cutting activity is improved by more than ten times, and the improvement of the cutting activity is beneficial to being applied to various experiments and technologies.

2. Purification of a PAT protein, said method comprising the steps of:

1) the correctly sequenced PAT expression plasmid obtained from step 1 above was transferred into BL21(ED3) expressing bacteria.

2) A final concentration of 1. mu.g/ml of clarithromycin was added to 10ml of LB medium, and a single PAT-expressing clone was inoculated and cultured overnight at 37 ℃ and 220 rpm.

3) The overnight-cultured broth (10ml) was inoculated directly into fresh LB medium at 37 ℃ and 220rpm as 1/100.

4) The cells were cultured for about 3 hours, cooled in ice water for about 15 minutes, and then IPTG was added to the cells to a final concentration of 0.2 mM.

5) The cells were collected by centrifugation at 23 ℃ and 100rpm for 5 hours and at 4 ℃ and 4500rpm for 10 min.

6) Fresh pellet of the cells was resuspended in 30ml of precooled PBS, centrifuged at 4500rpm at 4 ℃ for 10min and the cells were collected.

7) The cells were resuspended in 20ml of HGX buffer (cocktail + PMSF) and mixed well.

8) Ultrasonic crushing: ultrasonic treatment conditions: 4s on, 8s off, 150 watts, 5min man-hour.

9) Centrifuging at 12000rpm for 30min at 4 deg.C, collecting supernatant, and filtering with 0.22um filter membrane to remove small amount of thallus.

10) To 20ml of the supernatant, 100. mu.l of 10% PEI was added, and the precipitated bacterial DNA was thoroughly mixed and allowed to stand on ice for 10 minutes.

11) Centrifugation was carried out at 12000rpm for 10min at 4 ℃ to leave a supernatant, and filtration was carried out with a 0.22um filter.

12) The PAT protein in the filtrate was purified by affinity chromatography and dialyzed against a dialysis bag with a cut-off of 10kD containing high salt concentration at 4 ℃ for 12 h.

13) After dialysis, the PAT was concentrated using an ultrafiltration tube with a cut-off of 30kD and centrifuged at 4000rpm at 4 ℃ to a volume of 500. mu.l.

14) Add 500. mu.l of 100% glycerol and mix gently until preserved at-20 ℃.

The electrophoresis analysis of the purified protein is carried out, and the result is shown in figure 3 (BSA is used as a standard substance to quantify the concentration of the purified protein, before quantification, 10 mu l of the purified protein is diluted by 15 times, and then 1 mu l and 2 mu l of the diluted protein are respectively compared with the BSA standard substance to quantify), so that the PAT fusion protein with good quality and high enzyme activity is obtained, the foundation is laid for the relevant application of high-throughput single-cell sequencing, and the one-step affinity chromatography purification mode (PEI precipitation bacterial DNA) used by people is the most ideal selection. The advantages of using this affinity chromatography for purification of PAT are:

1, the method has the advantages of simple and convenient steps, strong operability and short required time;

2, high yield;

3, the cost of protein purification is low;

4, the purification scale can be enlarged.

The purified PAT has no bacterial DNA residue, the purity of one-step purification reaches more than 95 percent, the yield of the PAT can reach 14mg/L culture medium, and the preparation of 100 ten thousand single-cell libraries is enough.

Example 2 optimization of the respective functional blocks of the PAT fusion protein

First, the optimized screening of linker sequence

The specific linker (-GGSDDDKEF-) sequence is selected to connect different functional fragments of PAT, which can protect the natural conformation of ProteinA and Tn5, thereby obtaining fusion protein with better activity.

The method and activity verification steps for connecting fusion proteins of different linkers are as follows:

1. when 2xProtein A (IgG recognition sequence) was attached to the original sequence of Tn5, different linker sequences (see Table 1 for 10 linker sequences) were introduced by PCR.

TABLE 1 different linker sequences

2. PAT linked by different linkers were obtained as described in example 1 and subsequently functionally characterized as follows:

1) mu.l of IgG beads were washed three times with 200. mu.l of HGX buffer and centrifuged at 2000g for 3min at 4 ℃.

2) Mu.g of Tn5 (without fusion Protein A) or PAT (fusion Protein A) was added, amplified to a 100. mu.l system, and incubated at 4 ℃ for 1 h.

3) Rinsed three times with 200. mu.l of HGX buffer, centrifuged at 2000g for 3min at 4 ℃ and the supernatant discarded.

4) Tn5 or PAT was eluted with 20. mu.l of 0.5M HAc (pH 3.4) and the pH was adjusted to 7.2 with 1M NaOH.

5) 4% -7.5% SDS-PAGE detection,

we performed a set of IP (Protein immunoprecipitation) control experiments, the results of which are shown in FIG. 4, each set was performed in parallel, Tn5 was not specifically captured by IgG beads when no Fc domain of Protein A was fused, Tn5 Protein was finally present in the waste stream (post-SN), and when Tn5 was fused to the Fc domain of Protein A and linked by a linker (-GGSDDDKEF-) sequence, all PAT's were captured by IgG beads, demonstrating that Protein A can recognize IgG with high efficiency (efficiency of 98%).

The added linker screen demonstrated that the linker (-GGSDDDKEF-) sequence protected both Protein A and Tn5 in their native conformation, did not affect the enzymatic activity of Tn5, and did not affect the recognition of antibodies by Protein A, as shown in the results of FIG. 4. (see below for results description, IP1 and IP2 refer to two parallels of an experiment, and we used the linker sequence number 4 in table 1 last).

Through the screening, the Protein A and Tn5 have special advantages in protecting the natural conformation of the Protein A and the Tn5 and maintaining the Tn5 ultrahigh enzyme activity.

Effect of fusion mode of Protein A and Tn5 blocks on PAT Activity

The test method comprises the following steps:

1) two IgG recognition domains derived from Staphylococcus aureus Protein A Protein were fused at the N-terminus of Tn5 and were designated pA2-Tn 5.

2) Two IgG recognition domains derived from Staphylococcus aureus Protein A Protein were fused at the C-terminus of Tn5 and named Tn5-pA 2.

3) The purified pA2-Tn5 and Tn5-pA2 were assembled with reactive linkers (together with cleavage adapt).

4) 500ng of mouse genome is taken as a reaction substrate, and the reaction is carried out for 10min at 55 ℃ by using pA2-Tn5 and Tn5-pA2 with different concentrations.

5) The reaction was stopped with stopping buffer, reacted at 55 ℃ for 5min and detected by 1.5% agarose gel electrophoresis as shown in FIG. 5.

Through experimental comparison, as shown in the results of fig. 5, with the increase of the amount of the added PAT, the DNA fragments generated by enzyme digestion become smaller and smaller, and when the coding sequence of Protein a is added at the N-terminal of Tn5(pA 2-Tn5), the purified Tn5 has higher enzyme activity, which is 16.7 times of that of C-terminal fusion Protein a (Tn5-pA2), and we refer to pA2-Tn5 with higher enzyme activity as PAT for short.

Example 3 validation of PAT Activity by the Natural State and cell Cross-linking ChIP-seq method

1. PAT ChIP-seq method one (cells are not cross-linked and are in a natural state), comprises the following steps:

1) about 1,000,000 of the embryonic stem cells cultured in vitro were collected, washed 2 times with PBS, centrifuged to collect the cells, and washed 3 times with washing buffer 1.

2) The cells were resuspended in binding buffer, an appropriate amount of antibody H3K4me3 antibody (Millipore,04-745, Lot:2872328) was added, and the cells were incubated at 4 ℃ for 30min to allow the antibody to bind well to the target protein.

3) The cells were washed 3 times with wash buffer 2 to remove excess unbound antibody.

4) After resuspending the cells with wash buffer 2, PAT fusion protein was added and incubated at 4 ℃ for 30min to allow sufficient binding of the fusion protein to the antibody.

5) Cells were washed 3 times with wash buffer 2 to remove excess PAT fusion protein.

6) Adding reaction buffer solution to activate the activity of the PAT fusion protein, and reacting at 4 deg.C for 30min to reduce reaction background.

7) The reaction was terminated by adding a termination buffer, and after the reaction was terminated, it was purified by using QIAGEN DNA purification kit.

8) The purified DNA was directly subjected to PCR amplification using NEB Nextera index primers to complete the library construction.

9) The library that was completed was used for next generation sequencing.

The library background was examined for the above method and the following method described in comparative example 1 (H3K4me3sonic ChIP-seq based on general ultrasound), and the detailed examination results are shown in FIG. 6-A and FIG. 7-A.

From the experimental results of FIG. 6-A (Rep1 and Rep2 are two experimental replicates), it can be seen that the ChIP-Seq using the PAT fusion protein can obtain a positive signal substantially identical to the ultrasonic ChIP-Seq described in comparative example 1, while the background signal (shaded portion as shown in FIG. 6-A) is significantly lower than that of comparative example 1.

From the results shown in FIG. 7-A, it can be seen that the H3K4me3 signal obtained using ChIP-seq of the PAT fusion protein is more concentrated near the TSS and shows a higher signal-to-noise ratio than that of comparative example 1, whereas the signal of comparative example 1 is more dispersed in the promoter region.

2. PAT ChIP-seq method two (cell crosslinking), comprising the following steps:

1) 1,000,000 embryonic stem cells were collected, crosslinked with 1% formaldehyde at room temperature for 3-10min, neutralized with glycine and washed 3 times with PBS.

2) Cells were resuspended in hypotonic solution containing 0.3% SDS and chromatin was fully opened by incubation at 37 ℃ for 30 min.

3) The supernatant was removed by centrifugation.

4) The cells were washed 1 time with binding buffer, then resuspended with binding buffer and the antibody, H3K27ac antibody, added and incubated at 4 ℃ for 30min to allow sufficient binding of the antibody to the protein.

5) Wash buffer 2 the cells were washed 3 times to remove excess unbound antibody.

6) The cells were resuspended in wash buffer 2, followed by the addition of the PAT fusion protein and incubation at 4 ℃ for 30min to allow sufficient binding of the fusion protein to the antibody.

7) Wash buffer 2 the cells were washed 3 times to remove excess unbound PAT fusion protein.

8) Adding reaction buffer solution to activate the activity of the PAT fusion protein, and reacting at 4 deg.C for 30min to reduce reaction background.

9) The reaction was terminated by adding a termination buffer, and after the reaction was terminated, it was purified by using QIAGEN DNA purification kit.

10) The purified DNA was directly subjected to PCR amplification using NEB Nextera index primers to complete the library construction.

11) The library that was completed was used for next generation sequencing.

The library background was examined for the above method and the following method described in comparative example 2 (H3K27ac sonic ChIP-seq based on general ultrasound), and the detailed examination results are shown in FIGS. 6-B and 7-B.

From the experimental results of FIG. 6-B (Rep1 and Rep2 are two experimental replicates), it can be seen that the ChIP-Seq using the PAT fusion protein can obtain a positive signal substantially identical to the ultrasonic ChIP-Seq described in comparative example 2, while the background signal (shaded portion as shown in FIG. 6-B) is significantly lower than that of comparative example 2.

From the results shown in FIG. 7-B, it can be seen that the H3K27ac signal obtained using ChIP-seq of the PAT fusion protein is more concentrated near the TSS and shows a higher signal-to-noise ratio than in comparative example 2, whereas the signal of comparative example 2 is weaker in the promoter region.

The results show that: comparing the H3K4Me3In site-ChIP-seq in a natural state and the H3K27ac Insitu-ChIP-seq in a cross-linking state with the corresponding traditional hybridization ChIP-seq respectively, the library quality constructed by PAT is obviously better than that of the traditional method, and the signal to noise ratio is stronger.

3. PAT ChIP-seq method III (in situ tissue section), comprising the following steps:

1) tissue sections were washed 3 times with PBS and then 3 times with wash buffer 1.

2) Sections were washed once with binding buffer, tissue sections were covered with binding buffer, antibody, H3K4Me3 antibody, was added and incubated at 4 ℃ for 1H to allow sufficient binding of antibody to protein.

3) Wash buffer 2 washes the sections 3 times to remove excess unbound antibody.

4) The tissue sections were covered with wash buffer 2, after which the PAT fusion protein was added and incubated at 4 ℃ for 30min to allow sufficient binding of the fusion protein to the antibody.

5) Wash buffer 2 the sections were washed 3 times to remove excess PAT fusion protein.

6) Adding reaction buffer solution to activate the activity of the PAT fusion protein, and reacting at 4 deg.C for 30min to reduce reaction background.

7) Adding a termination buffer solution to terminate the reaction, directly adding NEB Nextera index primer and isothermal DNA polymerase (such as Phi29DNA polymerase) to perform PCR amplification and library building at a certain temperature.

8) After completion of PCR, the DNA was eluted and purified by AMP beads to complete the library construction.

9) The library is used directly for next generation sequencing.

Results as shown in fig. 8, we performed tissue sectioning of early E7.75 embryos (fig. 8-a), and utilized the in situ ChIP-seq of the present disclosure (fig. 8-B) to spatially explore the dynamic changes of H3K4me3 around important transcription factors early in embryonic development (progut motility) (fig. 8-C). The realization of the technology is beneficial to the direct operation of the cells or tissues, shields the background interference caused by external conditions, and really can search the most real life regulation and control process in the cells.

Example 4 construction and functional verification of PAGT fusion protein

This example provides an improved scheme of PAT fusion Protein, because Protein G has very high affinity to mouse IgG, we further developed PAGT fusion Protein, further fused IgG recognition domain of Protein G Protein in PAT, enriched the diversity of antibody sources:

construction of PAGT protein

The construction of specific ligation plasmid and Protein purification method were the same as in example 1, except that the IgG recognition domains of Protein A and Protein G were linked to the N-terminus of Tn5 (the monomers were linked to two proteins in sequence, 2xProtein A, Protein G, and Tn5 in sequence from the N-terminus to the C-terminus, and then a homodimer was formed, and the linker and PAT of each functional block were identical, and the linker sequence was-GGSDDDKEF-).

II, functional verification of PAGT protein

Small numbers of cell ChIP were performed using PAT and PAGT, and the function of the PAGT protein was verified according to the ChIP-seq detection protocol described in example 3 above (see fig. 9-10).

The results show that: compared with the experiment of H3K27ac (abcam 4729, GR3216173-1) ChIP-seq, the library quality constructed by PAGT and PAT is obviously better than that of the traditional method, the signal to noise ratio is stronger, and the library quality constructed by PAGT and PAT is not obviously different.

Example 5 high throughput ChIP-seq assay for PAT fusion proteins (cells not crosslinked, in Natural State)

The method comprises the following steps:

1) about 200,000 of the embryonic stem cells cultured in vitro were collected, washed 2 times with PBS, centrifuged to collect the cells, and washed 1 time with washing buffer A.

2) Resuspend with 1ml of washing buffer A, add 10. mu.l of ConA beads activated with activation buffer, react at room temperature for 10min, recover the cells, and discard the supernatant.

3) Resuspend the cells in 100. mu.l of washing buffer C, add an appropriate amount of H3K27ac antibody (abcam 4729, GR3216173-1, to which a deacetylase inhibitor is added throughout), incubate at 4 ℃ for 4H to allow the antibody to bind well to the protein of interest (typically 0.5. mu.g/100 ul).

4) The cells were washed 2 times with wash buffer B to remove excess unbound antibody.

5) Cells were resuspended in 1% BSA/PBS.

6) A96-well plate was prepared and prepared with washing buffer C to a final concentration of 3. mu.g/ml T5/T7 barcoded PAT, and 100. mu.l was added to each well as shown in FIG. 11.

7) The cells bound to ConA beads were FACS sorted into the above 96-well plates at 2000 cells per well and incubated at 4 ℃ for 1h to allow sufficient binding of PAT to the antibody.

8) Each well was discarded of PAT and the cells were washed 2 times with 180. mu.l of wash buffer C to remove excess fusion protein.

9) 10 μ l of single cell reaction buffer was added to activate the activity of the fusion protein, and the reaction was carried out at 25 ℃ for 60min to reduce the reaction background.

10) The reaction was stopped by adding 10. mu.l of single cell stop buffer at room temperature for 15 min.

11) After the reaction was terminated, 20. mu.l of single cell sorting buffer was added to each well, and all wells were pooled and stained for 15min on DAPI ice.

12) The cell pellet was removed by filtration through a 30 μm filter, and the cells were recovered.

13) The cells were resuspended in the appropriate single cell sorting buffer.

14) A96-well plate was prepared, 4. mu.l of single cell lysis buffer was added to each well, and the cells bound to ConA beads were sorted by FACS into the above 96-well plate at 20 cells per well.

15) Reacting at 65 ℃ for 6h, and inactivating the proteinase K at 85 ℃ for 15min after the reaction is completed.

16) Mu.l of 1.8% triton X-100 was added to each well and reacted at 37 ℃ for 60 min.

17) Original management base building is carried out by adopting a Mosaic Troseq base building method (the Mosaic Troseq base building process is shown in figure 12)

Example 6 high throughput ChIP-seq assay for PAT fusion proteins (cell Cross-linking)

The method comprises the following steps:

1) 200,000 embryonic stem cells were collected, crosslinked with 1% formaldehyde at room temperature for 3min, neutralized with glycine and washed 3 times with PBS.

2) Cells were resuspended in 200. mu.l of hypotonic solution containing 0.3% SDS and chromatin was fully opened by incubation at 62 ℃ for 10 min.

3) Mu.l of 20% Triton X-100 was added and incubated at 37 ℃ for 60 min.

4) 1ml of washing buffer A was added, 10. mu.l of ConA beads activated with an activation buffer were added, the reaction was carried out at room temperature for 10min, the cells were recovered, and the supernatant was discarded.

5) The cells were resuspended in 100. mu.l of wash buffer C, an appropriate amount of antibody (typically 0.5. mu.g/100 ul) H3K27ac antibody (the deacetylase inhibitor should be added throughout the antibody), and incubated at 4 ℃ for 4H to allow the antibody to bind well to the protein of interest.

6) The cells were washed 2 times with wash buffer B to remove excess unbound antibody.

7) Cells were resuspended in 1% BSA/PBS.

8) A96-well plate was prepared and prepared with washing buffer C to a final concentration of 3. mu.g/ml T5/T7 barcoded PAT, and 100. mu.l was added to each well as shown in FIG. 11. ,

9) FACS) cells bound to ConA beads were sorted into the above 96-well plates at 2000 cells per well and incubated at 4 ℃ for 1h to allow sufficient binding of PAT to the antibody.

10) Each well was discarded of PAT and the cells were washed 2 times with 180. mu.l of wash buffer C to remove excess fusion protein.

11) Add 10. mu.l of single cell reaction buffer to activate the activity of the fusion protein, and to reduce the reaction background, the reaction was carried out at 37 ℃ for 60 min.

12) The reaction was stopped by adding 10. mu.l of single cell stop buffer at room temperature for 15 min.

13) After the reaction was terminated, 20. mu.l of single cell sorting buffer was added to each well, and all wells were pooled and stained for 15min on DAPI ice.

14) The cell pellet was removed by filtration through a 30 μm filter, and the cells were recovered.

15) The cells were resuspended in the appropriate single cell sorting buffer.

16) A96-well plate was prepared, 4. mu.l of single cell lysis buffer was added to each well, and the cells bound to ConA beads were sorted by FACS into the above 96-well plate at 20 cells per well.

17) Reacting at 65 ℃ for 6h, and inactivating the proteinase K at 85 ℃ for 15min after the reaction is completed.

18) Mu.l of 1.8% triton X-100 was added to each well and reacted at 37 ℃ for 60 min.

19) And performing original management library building by adopting a Mosaic Troseq library building method.

Example 7 Single cell Mosaic Troseq two-step PCR library preparation method

This example provides a novel single cell Mosaic Truseq two-step PCR library preparation method, and the single cell library obtained can use illumina standard sequencing methods and platforms. Compared with a specially customized single cell sequencing method, the Mosaic Truseq library only requires 1/15 sequencing cost. The method for building the library by using the Mosaic Troseq comprises the following steps (as shown in figure 12):

1) a PCR reaction system was prepared as follows:

cell lysate	5μl
		5X Q5reaction buffer	10μl
5X Q5high GC enhancer	10μl
		10mM(each)dNTP	1μl
20mg/ml BSA	0.5μl
		Primer F1st/R1st Mix(50uM)	0.5μl
1mM MgCl2	23μl
		Q5polymerase	0.3μl

The primer sequences are as follows:

F1st—ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCGTCGGCAGCGTCTCCACGC(SEQ IDNO.6)

R1st--GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTCTCGTGGGCTCGGCTGTCCCTGT(SEQID NO.7)

the amplification procedure was: 5min at 72 ℃,30 s at 98 ℃,13 cycles (10 s at 98 ℃,30 s at 63 ℃ and 1min at 72 ℃) and 5min at 72 ℃.

2) Add 0.5. mu.l 20U/. mu.l Exo I (NEB M0293S) per well, incubate 30min at 37 ℃ and inactivate Exo I for 20min at 72 ℃.

3) Mu.l of 25uM 5 'index (Truseq P5 index) and 1. mu.l of 25uM 3' index (Truseq P7 index) were added to each well, and 8. mu.l of the reaction mixture was added.

The amplification procedure was: 30s at 98 ℃,5 cycles (10 s at 98 ℃,30 s at 63 ℃ and 1min at 72 ℃), and 5min at 72 ℃.

4) After PCR was performed, 96 wells of a 96-well plate were mixed, and purified by a column, and 60. mu.l of an elution buffer eluted DNA.

5) Purify once with 1.0X Ampure XP-beads, make once size selection with (0.5+0.5) X Ampure XP-beads, and finally dissolve the DNA with 20. mu. l H2O.

6) The illunima sequencing platform was sequenced 150bp on both ends.

Not limited to only a small number of cells, the high-throughput single-cell ChIP-seq technique of the present disclosure is applicable to all cell types (cultured cells or tissue-digested cells, etc.); is suitable for cells in a formaldehyde crosslinking or natural state; suitable for histone modification, DNA binding proteins and transcription factors. In summary, PAT and PAGT simultaneously constitute a complete set of selection schemes: the method is not limited by antibody sources, experimental sample sources and experimental conditions, and can conveniently prepare the high-quality ChIP-seq library.

Comparative examples 1&2 ChIP-seq based on ordinary ultrasound

Comparative example 1, H3K4me3 ChIP-seq (H3K4me3 communication ChIP) based on ordinary ultrasound

Comparative example 2 ordinary ultrasound based H3K27ac ChIP-seq (H3K27ac communication ChIP)

The operation method is the same and comprises the following steps:

1) 1,000,000 cells cultured in vitro were collected, crosslinked with formaldehyde at room temperature for 10min, neutralized with glycine, and washed 3 times with PBS, followed by snap freezing with liquid nitrogen.

2) The cells were suspended with 1ml hypotonic solution (plus protease inhibitor) and incubated on ice for 15 min.

3) The cells were further dispersed by mixing the cells 10-20 times with glass Dounce pestle B and disrupted.

4) The nuclei were collected by centrifugation at 3000rpm for 5min at 4 ℃.

5) The nuclei were resuspended in 100. mu.l of a cell nucleus lysate (containing 1% SDS), gently mixed, and incubated at 4 ℃ for 30min to sufficiently lyse the nuclei.

6) After incubation, centrifugation was performed briefly, and then the SDS concentration was diluted to 0.3% with ChIP dilution buffer and gently mixed.

7) Ultrasound (Q800R 2): time: 6 min; the program is 15s on and 45s off; energy: 600 watts.

8) After sonication, ChIP dilution buffer was added, mixed well, centrifuged at 20,000 for 20min at 4 ℃ and the supernatant transferred to a new EP tube.

9) Mu.l of Protein G was prepared, washed 3 times with 1% BSA/PBS, and then added to the supernatant of step 8) in 20. mu.l of Protein G magnetic beads, and incubated at 4 ℃ for 1 hour to remove non-specifically bound proteins. Mu. G H3K4me3 and 5. mu. G H3K27ac antibodies were added to the chromosome supernatant, respectively, while 1ml of 1% BSA/PBS was added to the remaining 50. mu.l protein G beads, overnight at 4 ℃.

10) After 1h, protein G beads were collected with a magnetic rack, the supernatant was transferred to a new EP tube, antibody was added, and incubation was carried out overnight at 4 ℃.

11) The next day, overnight blocked protein G magnetic beads were transferred to chromatin-antibody mixtures and incubated for 4h at 4 ℃.

12) Protein G magnetic beads were washed.

13) The magnetic beads were collected with a magnetic rack and then subjected to the following washing process.

Protein G magnetic beads were washed 1 time 5 min/time with high salt wash buffer at a.4 ℃.

At b.4 ℃ the protein G beads were washed 3 times 5 min/time with a low salt wash buffer solution.

The beads were briefly washed 1 time with 1ml of 1 XTE solution c.4 ℃.

d.4 ℃ the beads were briefly washed 1 time with 800. mu.l of 1 XTE solution and then transferred to a new EP tube.

14) The residual liquid was removed, then 110. mu.l of ChIP elution buffer was added to elute the DNA from the beads, and the ChIP elution buffer and the beads were incubated overnight at 70 ℃.

15) On the third day, the supernatant was transferred to a new EP tube using a magnetic stand, 100. mu.l of TE solution was added to elute DNA from the beads again, the TE solution eluted second and the ChIP solution buffer eluted first were combined, 3. mu.l of 10mg/ml proteinase K was added, and incubation was carried out at 55 ℃ for 6-8 hours.

16) On day four, ChIPed DNA was purified using QIAGEN DNA purification kit.

17) The purified DNA was routinely subjected to library construction using the "NEBNext Ultra DNA library Prep Kit for Illumina" Kit, which required 1 day.

18) And performing second-generation sequencing on the library which is well established.

The reagent formula comprises:

ChIP elution buffer: 50mM Tris-HCl (pH8.0), 10mM EDTA, 1% SDS;

ChIP dilution buffer: 0.01% SDS, 1% Triton X-100, 2mM EDTA, 20mM Tris-HCl (pH7.5), 150mM NaCl;

low-salt wash buffer: 0.1% sodium deoxycholate, 1% Triton X-100, 2mM EDTA, 50mM HEPES (pH7.5), 150mM NaCl;

high-salt wash buffer: 0.1% sodium deoxycholate, 1% TritonX-100, 2mM EDTA, 50mM HEPES (pH7.5), 500mM NaCl;

nuclear lysis buffer: 1% SDS, 10mM EDTA, 50mM Tris-HCl (pH 8.0).

Finally, it should be noted that: the above embodiments are only used to help those skilled in the art understand the essence of the present invention, and should not be used to limit the protection scope of the present invention.

SEQUENCE LISTING

<110> Beijing university

<120> fusion protein for preparing single cell ChIP-seq library and application thereof

<160>7

<170>PatentIn version 3.3

<210>1

<211>476

<212>PRT

<213> Artificial sequence

<400>1

Met Ile Thr Ser Ala Leu His Arg Ala Ala Asp Trp Ala Lys Ser Val

1 5 10 15

Phe Ser Ser Ala Ala Leu Gly Asp Pro Arg Arg Thr Ala Arg Leu Val

20 25 30

Asn Val Ala Ala Gln Leu Ala Lys Tyr Ser Gly Lys Ser Ile Thr Ile

35 40 45

Ser Ser Glu Gly Ser Glu Ala Met Gln Glu Gly Ala Tyr Arg Phe Ile

50 55 60

Arg Asn Pro Asn Val Ser Ala Glu Ala Ile Arg Lys Ala Gly Ala Met

65 70 75 80

Gln Thr Val Lys Leu Ala Gln Glu Phe Pro Glu Leu Leu Ala Ile Glu

85 90 95

Asp Thr Thr Ser Leu Ser Tyr Arg His Gln Val Ala Glu Glu Leu Gly

100 105 110

Lys Leu Gly Ser Ile Gln Asp Lys Ser Arg Gly Trp Trp Val His Ser

115 120 125

Val Leu Leu Leu Glu Ala Thr Thr Phe Arg Thr Val Gly Leu Leu His

130 135 140

Gln Glu Trp Trp Met Arg Pro Asp Asp Pro Ala Asp Ala Asp Glu Lys

145 150 155 160

Glu Ser Gly Lys Trp Leu Ala Ala Ala Ala Thr Ser Arg Leu Arg Met

165 170 175

Gly Ser Met Met Ser Asn Val Ile Ala Val Cys Asp Arg Glu Ala Asp

180 185 190

Ile His Ala Tyr Leu Gln Asp Lys Leu Ala His Asn Glu Arg Phe Val

195 200 205

Val Arg Ser Lys His Pro Arg Lys Asp Val Glu Ser Gly Leu Tyr Leu

210 215 220

Tyr Asp His Leu Lys Asn Gln Pro Glu Leu Gly Gly Tyr Gln Ile Ser

225 230 235 240

Ile Pro Gln Lys Gly Val Val Asp Lys Arg Gly Lys Arg Lys Asn Arg

245 250 255

Pro Ala Arg Lys Ala Ser Leu Ser Leu Arg Ser Gly Arg Ile Thr Leu

260 265 270

Lys Gln Gly Asn Ile Thr Leu Asn Ala Val Leu Ala Glu Glu Ile Asn

275 280 285

Pro Pro Lys Gly Glu Thr Pro Leu Lys Trp Leu Leu Leu Thr Ser Glu

290 295 300

Pro Val Glu Ser Leu Ala Gln Ala Leu Arg Val Ile Asp Ile Tyr Thr

305 310 315 320

His Arg Trp Arg Ile Glu Glu Phe His Lys Ala Trp Lys Thr Gly Ala

325 330 335

Gly Ala Glu Arg Gln Arg Met Glu Glu Pro Asp Asn Leu Glu Arg Met

340 345 350

Val Ser Ile Leu Ser Phe Val Ala Val Arg Leu Leu Gln Leu Arg Glu

355 360 365

Ser Phe Thr Leu Pro Gln Ala Leu Arg Ala Gln Gly Leu Leu Lys Glu

370 375 380

Ala Glu His Val Glu Ser Gln Ser Ala Glu Thr Val Leu Thr Pro Asp

385 390 395 400

Glu Cys Gln Leu Leu Gly Tyr Leu Asp Lys Gly Lys Arg Lys Arg Lys

405 410 415

Glu Lys Ala Gly Ser Leu Gln Trp Ala Tyr Met Ala Ile Ala Arg Leu

420 425 430

Gly Gly Phe Met Asp Ser Lys Arg Thr Gly Ile Ala Ser Trp Gly Ala

435 440 445

Leu Trp Glu Gly Trp Glu Ala Leu Gln Ser Lys Leu Asp Gly Phe Leu

450 455 460

Ala Ala Lys Asp Leu Met Ala Gln Gly Ile Lys Ile

465470 475

<210>2

<211>476

<212>PRT

<213> Artificial sequence

<400>2

Met Ile Thr Ser Ala Leu His Arg Ala Ala Asp Trp Ala Lys Ser Val

1 5 10 15

Phe Ser Ser Ala Ala Leu Gly Asp Pro Arg Arg Thr Ala Arg Leu Val

20 25 30

Asn Val Ala Ala Gln Leu Ala Lys Tyr Ser Gly Lys Ser Ile Thr Ile

35 40 45

Ser Ser Glu Gly Ser Lys Ala Met Gln Glu Gly Ala Tyr Arg Phe Ile

50 55 60

Arg Asn Pro Asn Val Ser Ala Glu Ala Ile Arg Lys Ala Gly Ala Met

65 70 75 80

Gln Thr Val Lys Leu Ala Gln Glu Phe Pro Glu Leu Leu Ala Ile Glu

85 90 95

Asp Thr Thr Ser Leu Ser Tyr Arg His Gln Val Ala Glu Glu Leu Gly

100 105 110

Lys Leu Gly Ser Ile Gln Asp Lys Ser Arg Gly Trp Trp Val His Ser

115 120 125

Val Leu Leu Leu Glu Ala Thr Thr Phe Arg Thr Val Gly Leu Leu His

130 135 140

Gln Glu Trp Trp Met Arg Pro Asp Asp Pro Ala Asp Ala Asp Glu Lys

145 150 155 160

Glu Ser Gly Lys Trp Leu Ala Ala Ala Ala Thr Ser Arg Leu Arg Met

165 170 175

Gly Ser Met Met Ser Asn Val Ile Ala Val Cys Asp Arg Glu Ala Asp

180 185 190

Ile His Ala Tyr Leu Gln Asp Lys Leu Ala His Asn Glu Arg Phe Val

195 200 205

Val Arg Ser Lys His Pro Arg Lys Asp Val Glu Ser Gly Leu Tyr Leu

210 215 220

Tyr Asp His Leu Lys Asn Gln Pro Glu Leu Gly Gly Tyr Gln Ile Ser

225 230 235 240

Ile Pro Gln Lys Gly Val Val Asp Lys Arg Gly Lys Arg Lys Asn Arg

245 250 255

Pro Ala Arg Lys Ala Ser Leu Ser Leu Arg Ser Gly Arg Ile Thr Leu

260 265 270

Lys Gln Gly Asn Ile Thr Leu Asn Ala Val Leu Ala Glu Glu Ile Asn

275 280 285

Pro Pro Lys Gly Glu Thr Pro Leu Lys Trp Leu Leu Leu Thr Ser Glu

290 295 300

Pro Val Glu Ser Leu Ala Gln Ala Leu Arg Val Ile Asp Ile Tyr Thr

305 310 315 320

His Arg Trp Arg Ile Glu Glu Phe His Lys Ala Trp Lys Thr Gly Ala

325 330 335

Gly Ala Glu Arg Gln Arg Met Glu Glu Pro Asp Asn Leu Glu Arg Met

340 345 350

Val Ser Ile Leu Ser Phe Val Ala Val Arg Leu Leu Gln Leu Arg Glu

355 360 365

Ser Phe Thr Pro Pro Gln Ala Leu Arg Ala Gln Gly Leu Leu Lys Glu

370 375 380

Ala Glu His Val Glu Ser Gln Ser Ala Glu Thr Val Leu Thr Pro Asp

385 390 395 400

Glu Cys Gln Leu Leu Gly Tyr Leu Asp Lys Gly Lys Arg Lys Arg Lys

405 410 415

Glu Lys Ala Gly Ser Leu Gln Trp Ala Tyr Met Ala Ile Ala Arg Leu

420 425 430

Gly Gly Phe Met Asp Ser Lys Arg Thr Gly Ile Ala Ser Trp Gly Ala

435 440 445

Leu Trp Glu Gly Trp Glu Ala Leu Gln Ser Lys Leu Asp Gly Phe Leu

450 455 460

Ala Ala Lys Asp Leu Met Ala Gln Gly Ile Lys Ile

465 470 475

<210>3

<211>9

<212>PRT

<213> Artificial sequence

<400>3

Gly Gly Ser Asp Asp Asp Lys Glu Phe

1 5

<210>4

<211>611

<212>PRT

<213> Artificial sequence

<400>4

Met Val Asp Asn Lys Phe Asn Lys Glu Gln Gln Asn Ala Phe Tyr Glu

1 5 10 15

Ile Leu His Leu Pro Asn Leu Asn Glu Glu Gln Arg Asn Ala Phe Ile

20 25 30

Gln Ser Leu Lys Asp Asp Pro Ser Gln Ser Ala Asn Leu Leu Ala Glu

35 40 45

Ala Lys Lys Leu Asn Asp Ala Gln Ala Pro Lys Val Asp Asn Lys Phe

50 55 60

Asn Lys Glu Gln Gln Asn Ala Phe Tyr Glu Ile Leu His Leu Pro Asn

65 70 75 80

Leu Asn Glu Glu Gln Arg Asn Ala Phe Ile Gln Ser Leu Lys Asp Asp

85 90 95

Pro Ser Gln Ser Ala Asn Leu Leu Ala Glu Ala Lys Lys Leu Asn Gly

100 105 110

Ala Gln Ala Pro Lys Val Asp Ala Asn Ser Ala Gly Lys Ser Thr Gly

115 120 125

Gly Ser Asp Asp Asp Lys Glu Phe Ile Thr Ser Ala Leu His Arg Ala

130 135 140

Ala Asp Trp Ala Lys Ser Val Phe Ser Ser Ala Ala Leu Gly Asp Pro

145 150 155 160

Arg Arg Thr Ala Arg Leu Val Asn Val Ala Ala Gln Leu Ala Lys Tyr

165 170 175

Ser Gly Lys Ser Ile Thr Ile Ser Ser Glu Gly Ser Lys Ala Met Gln

180 185 190

Glu Gly Ala Tyr Arg Phe Ile Arg Asn Pro Asn Val Ser Ala Glu Ala

195 200 205

Ile Arg Lys Ala Gly Ala Met Gln Thr Val Lys Leu Ala Gln Glu Phe

210 215 220

Pro Glu Leu Leu Ala Ile Glu Asp Thr Thr Ser Leu Ser Tyr Arg His

225 230 235 240

Gln Val Ala Glu Glu Leu Gly Lys Leu Gly Ser Ile Gln Asp Lys Ser

245 250 255

Arg Gly Trp Trp Val His Ser Val Leu Leu Leu Glu Ala Thr Thr Phe

260 265 270

Arg Thr Val Gly Leu Leu His Gln Glu Trp Trp Met Arg Pro Asp Asp

275 280 285

Pro Ala Asp Ala Asp Glu Lys Glu Ser Gly Lys Trp Leu Ala Ala Ala

290 295 300

Ala Thr Ser Arg Leu Arg Met Gly Ser Met Met Ser Asn Val Ile Ala

305 310 315 320

Val Cys Asp Arg Glu Ala Asp Ile His Ala Tyr Leu Gln Asp Lys Leu

325 330 335

Ala His Asn Glu Arg Phe Val Val Arg Ser Lys His Pro Arg Lys Asp

340 345 350

Val Glu Ser Gly Leu Tyr Leu Tyr Asp His Leu Lys Asn Gln Pro Glu

355 360 365

Leu Gly Gly Tyr Gln Ile Ser Ile Pro Gln Lys Gly Val Val Asp Lys

370 375 380

Arg Gly Lys Arg Lys Asn Arg Pro Ala Arg Lys Ala Ser Leu Ser Leu

385 390 395 400

Arg Ser Gly Arg Ile Thr Leu Lys Gln Gly Asn Ile Thr Leu Asn Ala

405 410 415

Val Leu Ala Glu Glu Ile Asn Pro Pro Lys Gly Glu Thr Pro Leu Lys

420 425 430

Trp Leu Leu Leu Thr Ser Glu Pro Val Glu Ser Leu Ala Gln Ala Leu

435 440 445

Arg Val Ile Asp Ile Tyr Thr His Arg Trp Arg Ile Glu Glu Phe His

450 455 460

Lys Ala Trp Lys Thr Gly Ala Gly Ala Glu Arg Gln Arg Met Glu Glu

465 470 475 480

Pro Asp Asn Leu Glu Arg Met Val Ser Ile Leu Ser Phe Val Ala Val

485 490 495

Arg Leu Leu Gln Leu Arg Glu Ser Phe Thr Pro Pro Gln Ala Leu Arg

500 505 510

Ala Gln Gly Leu Leu Lys Glu Ala Glu His Val Glu Ser Gln Ser Ala

515 520 525

Glu Thr Val Leu Thr Pro Asp Glu Cys Gln Leu Leu Gly Tyr Leu Asp

530 535 540

Lys Gly Lys Arg Lys Arg Lys Glu Lys Ala Gly Ser Leu Gln Trp Ala

545 550 555 560

Tyr Met Ala Ile Ala Arg Leu Gly Gly Phe Met Asp Ser Lys Arg Thr

565 570 575

Gly Ile Ala Ser Trp Gly Ala Leu Trp Glu Gly Trp Glu Ala Leu Gln

580 585 590

Ser Lys Leu Asp Gly Phe Leu Ala Ala Lys Asp Leu Met Ala Gln Gly

595 600 605

Ile Lys Ile

610

<210>5

<211>702

<212>PRT

<213> Artificial sequence

<400>5

Met Thr Met Ile Thr Pro Ser Leu Lys Asp Asp Pro Ser Gln Ser Ala

1 5 10 15

Asn Leu Leu Ser Glu Ala Lys Lys Leu Asn Glu Ser Gln Ala Pro Lys

20 25 30

Ala Asp Asn Lys Phe Asn Lys Glu Gln Gln Asn Ala Phe Tyr Glu Ile

35 40 45

Leu His Leu Pro Asn Leu Asn Glu Glu Gln Arg Asn Gly Phe Ile Gln

50 55 60

Ser Leu Lys Asp Asp Pro Ser Gln Ser Ala Asn Leu Leu Ala Glu Ala

65 70 75 80

Lys Lys Leu Asn Asp Ala Gln Ala Pro Lys Ala Asp AsnLys Phe Asn

85 90 95

Lys Glu Gln Gln Asn Ala Phe Tyr Glu Ile Leu His Leu Pro Asn Leu

100 105 110

Thr Glu Glu Gln Arg Asn Gly Phe Ile Gln Ser Leu Lys Asp Asp Pro

115 120 125

Ser Val Ser Lys Glu Ile Leu Ala Glu Ala Lys Lys Leu Asn Asp Ala

130 135 140

Gln Ala Pro Lys Thr Thr Tyr Lys Leu Val Ile Asn Gly Lys Thr Leu

145 150 155 160

Lys Gly Glu Thr Thr Thr Glu Ala Val Asp Ala Glu Thr Ala Glu Arg

165 170 175

His Phe Lys Gln Tyr Ala Asn Asp Asn Gly Val Asp Gly Glu Trp Thr

180 185 190

Tyr Asp Asp Ala Thr Lys Thr Phe Thr Val Thr Glu Lys Pro Glu Val

195 200 205

Ile Asp Ala Ser Glu Leu Thr Pro Ala Val Gly Gly Ser Asp Asp Asp

210 215 220

Lys Glu Phe Ile Thr Ser Ala Leu His Arg Ala Ala Asp Trp Ala Lys

225 230 235 240

Ser Val Phe Ser Ser Ala Ala Leu Gly Asp Pro Arg Arg Thr Ala Arg

245 250 255

Leu Val Asn Val Ala Ala Gln Leu Ala Lys Tyr Ser Gly Lys Ser Ile

260 265 270

Thr Ile Ser Ser Glu Gly Ser Lys Ala Met Gln Glu Gly Ala Tyr Arg

275 280 285

Phe Ile Arg Asn Pro Asn Val Ser Ala Glu Ala Ile Arg Lys Ala Gly

290 295 300

Ala Met Gln Thr Val Lys Leu Ala Gln Glu Phe Pro Glu Leu Leu Ala

305 310 315 320

Ile Glu Asp Thr Thr Ser Leu Ser Tyr Arg His Gln Val Ala Glu Glu

325 330 335

Leu Gly Lys Leu Gly Ser Ile Gln Asp Lys Ser Arg Gly Trp Trp Val

340 345 350

His Ser Val Leu Leu Leu Glu Ala Thr Thr Phe Arg Thr Val Gly Leu

355 360 365

Leu His Gln Glu Trp Trp Met Arg Pro Asp Asp Pro Ala Asp Ala Asp

370 375 380

Glu Lys Glu Ser Gly Lys Trp Leu Ala Ala Ala Ala Thr Ser Arg Leu

385 390 395 400

Arg Met Gly Ser Met Met Ser Asn Val Ile Ala Val Cys Asp Arg Glu

405 410 415

Ala Asp Ile His Ala Tyr Leu Gln Asp Lys Leu Ala His Asn Glu Arg

420 425 430

Phe Val Val Arg Ser Lys His Pro Arg Lys Asp Val Glu Ser Gly Leu

435 440 445

Tyr Leu Tyr Asp His Leu Lys Asn Gln Pro Glu Leu Gly Gly Tyr Gln

450 455 460

Ile Ser Ile Pro Gln Lys Gly Val Val Asp Lys Arg Gly Lys Arg Lys

465 470 475 480

Asn Arg Pro Ala Arg Lys Ala Ser Leu Ser Leu Arg Ser Gly Arg Ile

485 490 495

Thr Leu Lys Gln Gly Asn Ile Thr Leu Asn Ala Val Leu Ala Glu Glu

500 505 510

Ile Asn Pro Pro Lys Gly Glu Thr Pro Leu Lys Trp Leu Leu Leu Thr

515 520 525

Ser Glu Pro Val Glu Ser Leu Ala Gln Ala Leu Arg Val Ile Asp Ile

530 535 540

Tyr Thr His Arg Trp Arg Ile Glu Glu Phe His Lys Ala Trp Lys Thr

545 550 555 560

Gly Ala Gly Ala Glu Arg Gln Arg Met Glu Glu Pro Asp Asn Leu Glu

565 570 575

Arg Met Val Ser Ile Leu Ser Phe Val Ala Val Arg Leu Leu Gln Leu

580 585 590

Arg Glu Ser Phe Thr Pro Pro Gln Ala Leu Arg Ala Gln Gly Leu Leu

595 600 605

Lys Glu Ala Glu His Val Glu Ser Gln Ser Ala Glu Thr Val Leu Thr

610 615 620

Pro Asp Glu Cys Gln Leu Leu Gly Tyr Leu Asp Lys Gly Lys Arg Lys

625 630 635 640

Arg Lys Glu Lys Ala Gly Ser Leu Gln Trp Ala Tyr Met Ala Ile Ala

645 650 655

Arg Leu Gly Gly Phe Met Asp Ser Lys Arg Thr Gly Ile Ala Ser Trp

660 665 670

Gly Ala Leu Trp Glu Gly Trp Glu Ala Leu Gln Ser Lys Leu Asp Gly

675 680 685

Phe Leu Ala Ala Lys Asp Leu Met Ala Gln Gly Ile Lys Ile

690 695 700

<210>6

<211>54

<212>DNA

<213> Artificial sequence

<400>6

acactctttccctacacgac gctcttccga tcttcgtcgg cagcgtctcc acgc 54

<210>7

<211>57

<212>DNA

<213> Artificial sequence

<400>7

gactggagtt cagacgtgtg ctcttccgat ctgtctcgtg ggctcggctg tccctgt 57

Claims (2)

1. The application of a fusion protein in chromatin co-immunoprecipitation-sequencing (ChIP-SEQ) library construction is characterized in that the fusion protein is a homodimer, the monomer of the fusion protein is PAT or PAGT, the amino acid sequence of the PAT is shown as SEQ ID NO.4, and the amino acid sequence of the PAGT is shown as SEQ ID NO. 5.

2. The use of claim 1, wherein the method of using the fusion protein to prepare a chromatin co-immunoprecipitation-sequencing (ChIP-seq) library comprises the steps of:

(1) collecting and processing a target biological sample to obtain a single cell suspension;

(2) resuspending the cells with a binding buffer, adding a proper amount of specific protein-bound antibody, and washing to remove unbound antibody after the antibody is fully bound;

(3) resuspending the cells, adding the fusion protein, allowing the fusion protein to bind to the antibody sufficiently, and removing unbound fusion protein;

(4) activating the fusion protein, and fully reacting to obtain a DNA fragment with a label which is recognized and cut by the fusion protein;

(5) adding a termination buffer solution to terminate the reaction, and purifying the DNA fragment by using a purification kit;

(6) adding primers to perform PCR amplification to complete library construction;

the biological sample is:

a cultured cell sample or a fresh tissue sample that is not cross-linked or fixed;

or a cross-linked or fixed cultured cell sample or tissue sample.

Images