CN110343773A - SV108 molecular labeling and its detection technique in a kind of structure variation TRO gene for identifying fragrant pig variety - Google Patents

SV108 molecular labeling and its detection technique in a kind of structure variation TRO gene for identifying fragrant pig variety Download PDF

Info

Publication number
CN110343773A
CN110343773A CN201910819954.8A CN201910819954A CN110343773A CN 110343773 A CN110343773 A CN 110343773A CN 201910819954 A CN201910819954 A CN 201910819954A CN 110343773 A CN110343773 A CN 110343773A
Authority
CN
China
Prior art keywords
pig
structure variation
genotype
fragrant pig
fragrant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910819954.8A
Other languages
Chinese (zh)
Inventor
冉雪琴
王嘉福
李升�
李大鹏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guizhou University
Original Assignee
Guizhou University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guizhou University filed Critical Guizhou University
Priority to CN201910819954.8A priority Critical patent/CN110343773A/en
Publication of CN110343773A publication Critical patent/CN110343773A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of for identifying the structure variation SV108 of fragrant pig variety, it is characterised in that: SV108 is located at the chrx:47770108-47770216 that pig refers to genome Sscrofa 11.1, and SV108 missing gene is set to D, and the gene not lacked normally is set to I.Using detection technique of the present invention, the SV108 genotype of test sample, it was found that fragrant pig includes three kinds of genotype both DD type, DI type and II type, based on DD type, Deng being 97.1% for gene frequency D, for the black pig of Large White and Guizhou Province north without homozygous deletion type (DD) and heterozygous (DI), only normal type (II), waiting as gene frequency D is 0%.Therefore can application structure variation SV108 as molecular markers for identification perfume (or spice) pig variety.

Description

SV108 molecular labeling in a kind of structure variation TRO gene for identifying fragrant pig variety And its detection technique
Technical field
The present invention relates to Animal molecular biology detection fields, it particularly relates to a kind of for identifying fragrant pig variety SV108 molecular labeling and its detection technique in structure variation TRO gene.
Background technique
Fragrant pig multiplies and lives in closed forest for a long time, gradually forms inbreeding and does not degenerate, and gene height is overlapped small-sized Pig kind, producing region scattered settlement seedling, strong, precious jade, Shui Deng ethnic group, plough less, have inconvenient traffic, crops are with glutinous paddy and japonica rice Based on, the masses to live here do not plant the habit of vegetables, and wild feed also compares shortage, only grow edible wild herbs, water plant etc., pig Cultivation predominantly from numerous self-fertile, raise competence is lower, 1~2, several villages boar, due to breeding too early, using excessive so that Hypogenetic boar, using once, eliminate within 2 years, the boar newly selected comes from same group again, and inbreeding forms small for a long time The adaptation environment of type pig existence heredity.As the improvement of people's living standards, some consumers have to the quality of pork it is higher Requirement.The outer ternary of " fast large-scale ", which is not able to satisfy, pursues high-quality meat consumer demand, this gives many Native Pigs in China Kind brings crisis.Using China's local pig breed characteristic with good meat quality by hybridizing production with external pig kind, and cause consumer without Method correctly judges whether it is high meat or purebred pig kind, and it is also possible to purebred local pig breed is caused to move towards rare.
Insertion/deletion, repetition, inversion, transposition and the DNA of DNA fragmentation present on genomic level greater than 1Kb are copied Shellfish number variation is referred to as structure variation.Currently, having detected that structure relevant to phenotypic variation in livestock and poultry genomics research Variation.Structure variation site TRO-E12-sv108 is located at the 12nd exon of TRO gene, in chrX:47770108-47770216 Place missing 108bp.Through crowd surveillance, structure variation TRO-E12-sv108 detects three kinds of genotype, D equipotential base in fragrant pig Because accounting for 97.1%, the black pig in Guizhou Province north and Large White are II genotype.The exons 12 of fragrant pig TRO gene high frequency lacks, very It is possible that influencing the function of TRO albumen, low with fragrant litter size of pig there may be certain contact.
Nutrient TRO gene (Trophinin) is located on X chromosome, encodes memebrane protein, mediates trophocyte and uterus The aminoterminal of adherency between intimal epithelium cell, TRO albumen is located at cytoplasm.Nutrient may be combined by homodimer In cell, the adherency of apical cell when mediating mankind's embryo implantation, the cell adherence that nutrient mediates, which can activate, nourishes outer embryo The invasion of confluent monolayer cells, however the influence adhered to parent side is unclear (Suzuki N, et al.1999).It is reported that TRO The albumen of gene coding participates in cellular signal transduction during embryo implantation, may be during mammal early stage placentation It plays an important role, also participates in the formation (Saburi S, et al.2001) of cancer.
Summary of the invention
The technical problem to be solved by the present invention is SV108 in a kind of structure variation TRO gene for identifying fragrant pig variety Molecular labeling and its detection technique.
The technical scheme is that it is a kind of for identifying the structure variation SV108 of fragrant pig, it is located at pig and refers to genome Three kinds of genotype of the position chrX:47770108-47770216 of Sscrofa11.1, structure variation SV108 are respectively designated as DD, DI and II type, wherein II is insert type genotype, DD is the genotype of homozygous deletion, the genotype that DI is heterozygous deletion.
For the primer pair of the relevant SV108 label of Testing and appraisal perfume (or spice) pig variety, the primer pair are as follows: forward primer SV108F:GGTACAGAAGAAAGACCCCAAGGA, reverse primer SV108R:GAAACTAGAACTGGTGCTGGCTG.Expand piece The base sequence of section is respectively SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3.
The present invention also provides detection method of the structure variation SV108 in different pig variety groups.
It is described that detection method includes the following steps:
(1) genomic DNA of fragrant pig is extracted;
(2) using above-mentioned fragrant pig genomic DNA as template, using the primer SV108F and SV108R, PCR amplification is carried out, Detect the genotype of pig genome SV108;
(3) according to above-mentioned testing result, if three kinds of genotype of purpose segment all occur, and based on pure and mild deletion form DD, Then pig to be measured is fragrant pig;If this segment only exists homozygous II type, test individual is the black pig of Large White or Guizhou Province north.
Amplification system used in PCR is carried out in step (2) by taking 20 μ L as an example:
2×Taq PCR Master Mix 10.00μL
F-primer(0.10μg/μL) 0.40μL
R-primer(0.10μg/μL) 0.40μL
gDNA 1.00μL
ddH2O 8.20μL
Total Volume 20.00μL
PCR reaction condition are as follows:
The present invention further provides the structure variations in the detection technique for identifying fragrant pig.
The described application the following steps are included:
(1) distribution situation of the structure variation in different pig variety groups is detected using regular-PCR technology;
(2) frequency (i.e. homozygous deletion type DD, heterozygous DI, insertion of 3 kinds of genotype in group in each pig variety are calculated The percentage of the type II sample number difference total laboratory sample number of Zhan) and allele frequency, analyze the structure variation in fragrant pig and Difference size between other pig varieties.
It (3) whether is the fragrant pig variety of deletion Genotype auxiliary mirror according to structure variation SV108.
It in an embodiment of the present invention, is candidate with the site structure variation SV108 (chrX:47770108-47770216) Structure variation distribution situation of the site in group is detected by round pcr in site;If test individual SV108 section with All missings (DD), then pig kind to be measured is fragrant pig, if test individual SV108 section (II) genotype occurrence rate is 100%, Pig kind to be measured is the black pig of Large White or Guizhou Province north.The detection in the structure variation site, to identify that fragrant pig is provided fundamental basis.
Beneficial effects of the present invention:
(1) fragrant pig structure variation provided by the invention is not by factors such as the age of fragrant pig, gender and feeding environment conditions Limitation.
(2) method for the fragrant pig structure variation SV108 of detection that the present invention establishes is accurate and reliable, easy to operate.
(3) detection technique for the structure variation SV108 that the present invention is mentioned can be the molecular marking supplementary breeding of the fragrant pig of identification Technology establishes theory and technology basis.
Detailed description of the invention
Fig. 1 is that agarose gel electrophoresis detects SV108 genotype results, M:DL2000 DNA in the embodiment of the present invention 1 Marker;1:DD type;2:DI type;3:II type;
Fig. 2 is the gene frequency of 3 pig variety SV108 in the embodiment of the present invention 2.
Specific embodiment
The present invention will be further explained for following instance, but does not limit the scope of the invention, if implementing without specializing The technical method and conventional laboratory conditions that technical method used in example and condition are well known to the skilled person, or press The method and condition of reagent manufacturers instruction suggestion is closed in photograph.
Embodiment 1 is detection method of the invention, and steps are as follows:
1, extracting genome DNA
The present invention uses blood/cell/tissue extracting genome DNA purchased from TIANGEN Biotech (Beijing) Co., Ltd. Kit, for extracting genomic DNA from blood or tissue, the specific method is as follows:
(1) experiment sample pre-processes
A. blood sample
It takes 300 μ L fresh or the blood of -80 DEG C of preservations is added in the sterile EP tube of 1.5mL, less than 300 μ L GA buffers Supply volume.
B. tissue sample
The tissue sample saved in -80 DEG C of refrigerators is taken out, clip 50mg is thoroughly shredded, and is transferred to sterile 1.5mL EP The GA buffer of 200 μ L, abundant suspended tissue's particle is added in Guan Zhong.4 μ L RNaseA (100mg/mL) are added into centrifuge tube Solution sufficiently vibrates 15sec with vortex oscillator, mixes well convenient for enzyme and solution, pollutes for RNA in removal sample, by sample Product placement stands 5min at room temperature, and centrifuge tube is carried out brief centrifugation.
(2) 20 μ L Proteinase K are added into centrifuge tube, mixing fullys shake.
A. when blood sample genome extracts, step 4 is directly carried out.
B. when ear tissue sample gene group is extracted, 56 DEG C of water-baths dissolve tissue pieces in sample thoroughly, brief centrifugation.
(3) 200 μ L GB buffers are added into centrifuge tube again, vortex oscillator mixes well, and EP pipe is placed in 70 DEG C In water-bath, water bath with thermostatic control 10min, until solution becomes limpid, brief centrifugation in EP pipe.
(4) 200 μ L dehydrated alcohols are added into EP pipe again, it is reverse to mix solution, at this time in EP pipe it is possible that EP pipe is carried out of short duration centrifugation by white flock precipitate.
(5) solution that above-mentioned steps obtain and flocculent deposit are transferred completely into adsorption column CB3 that (adsorption column is put into collection In pipe), 12000rmp is centrifuged 1min, outwells waste liquid.Adsorption column CB3 is placed back in collecting pipe.
(6) the buffer GD that dehydrated alcohol is added in 500 μ L in advance is added into adsorption column CB3, stands 2min, 12000rmp It is centrifuged 1min, waste liquid is outwelled, adsorption column CB3 is placed back in collecting pipe.
(7) the rinsing liquid PW that dehydrated alcohol is added in 600 μ L is added into adsorption column CB3, stands 2min, 12000rmp centrifugation 1min outwells waste liquid, and adsorption column CB3 is placed back in collecting pipe.
(8) repetitive operation step (8) is primary.
(9) the adsorption column CB3 and collecting pipe for obtaining previous step, 12000rmp are centrifuged 2min, waste liquid are outwelled, by adsorption column CB3 lid is opened, and is placed on clean blank sheet of paper and is placed at room temperature for several minutes, and remaining rinsing liquid in adsorbent material, Yi Mianying are removed Ring subsequent experimental.
(10) the adsorption column CB3 thoroughly dried is transferred in a 1.5mL sterile EP tube, is added dropwise to adsorbed film center is hanging The elution buffer TE of 200 μ L is stored at room temperature 3min, and 12000rmp is centrifuged 2min, and genomic DNA is in 1.5mL centrifuge tube.
The solution being collected by centrifugation can be added to again in adsorption column CB3,12000rpm is centrifuged 2min, collects DNA again Solution, to improve the yield of genomic DNA.Obtaining genomic DNA can be directly used for testing or being placed in next step -20 DEG C of preservations. 2. the amplification of target sequence and reference sequences
According to ncbi database log in the region primers, the primer pair are as follows: forward primer SV108F: GGTACAGAAGAAAGACCCCAAGGA, reverse primer SV108R:GAAACTAGAACTGGTGCTGGCTG.Target fragment difference For 592bp and 485bp.In terms of 20 μ L:
10×PCR Mix 10.00μL
Up-primer(0.10μg/μL) 0.40μL
Down-primer(0.10μg/μL) 0.40μL
gDNA 1.00μL
ddH2O 8.20μL
Total Volume 20.00μL
PCR reaction condition are as follows:
The primer that this kit is included meets PCR amplification requirement, expanding effect stabilization, high specificity, PCR amplification result Can in accurate response genome target sequence structure variation situation.
3, the genotyping of structure variation SV108
After PCR amplification, 5 μ L PCR products is taken to detect through 0.7% agarose electrophoresis, 0.5 μ g/mL ethidium bromide dye Color, gel imaging system photograph record strip band.
It is DD type by VDA genotypes if a sample only amplifies a kind of band of 485bp;When amplifying 485bp It is DI type by VDA genotypes with two kinds of bands of 592bp;It is II by VDA genotypes if only amplified a kind of band of 592bp Type (Fig. 1).The band that DD and II genotype is obtained distinguishes cloning and sequencing, and normal II genotype corresponds to the nucleotide of 592bp Sequence, that is, SEQ ID No.1, nucleotide sequence, that is, SEQ ID No.2 of the DD genotype 485bp of missing, the 108bp sequence of missing It is listed in SEQ ID No.3.
The application of 2 molecular labeling SV108 of embodiment
According to the method for embodiment 1, with pig genome area structure variation site (chrx:46186712-46187032) For candidate locus, distribution situation of the genotype of the structure variation in 3 pig variety groups is detected using round pcr, 171 Fragrant pig ear tissue picks up from Xiang Zhu farm, Congjiang County, Guizhou Province and the Qingzhen City cultivation base Xiang Zhu, 31 Large White blood samples and 22 The black pig blood sample in Guizhou Province north.With the candidate region SV108, the structure variation SV108 in detection technique analysis group is established using the present invention Distribution frequency, there are SV108 variations in fragrant pig groups as the result is shown.
3.8 3 pig variety TRO-E12-sv108 Genotypings of table
It can detect the genotype of structure variation SV108 in test individual genome using the detection technique that the present invention establishes, It is not limited by factors such as the age of fragrant pig, gender, nutrition and environment, and easy to operate, as a result accurately.Although above It, can be to it through the present invention is described in detail with a general description of the specific embodiments, but on the basis of the present invention It makes some modifications or improvements, this is obvious to those skilled in the art.Therefore, without departing from spirit of that invention On the basis of modifications or improvements, fall within the scope of the claimed invention.
Sequence table
SEQ ID No.1:
<110>Guizhou University
<120>SV108 molecular labeling and its detection technique in a kind of structure variation TRO gene for identifying fragrant pig variety.
<210> 1
<211> 592bp
<212> DNA
<213>fragrant pig SV108 section is normal
<400> 1
GGTACAGAAGAAAGACCCCAAGGATTGGGCTGCTCAGTACCGGGAGGCAGTAGAGATGGA 60
AGTCCAAGCTGCAGCTGTGGCTGTGGCTGAGGCTGAGGCCAGGGCTGAGGCAAGAGCCCA 120
AATGGGGATTGGAGAGGAAGCTGTGGCTGGGCCCTGGAATTGGGATGACATGGATATCGA 180
CTGCCTAACAAGGGAAGAGTTAGGCGATGATGCTCAGGCCTGGAGCAGATTTTCATTTGA 240
AATTGAGGCCAGAGACCAAGAAAATGCAAATGCCAGCACCAACATTGACTTCAGCAGAGG 300
AGCTAGCACCAGAGCTAACTTTAGCGATGGTGCTAGTATTTGTTTCAGTGGTGCACCCAG 360
CCCCAGTGATGGCTTTGGTGGCAGAGATGGCATTAGTTTTGGTAGCACATGCAGCACCAG 420
TGCCACCTTCAGCAGTACAGCCAGCATTAGCTTTGGTGGCACACACTACACTAGCGGCAG 480
CTTCAGCAGTGCAGCCAACATTTGCTTTGGTGGCATGCCCAACACTTGTTCTACTTTCAG 540
TGGTGGAGCCAGCATTAGCTTTGGTGGTGCAGCCAGCACCAGTTCTAGTTTC
SEQ ID No.2:
<210> 2
<211> 485bp
<212> DNA
<213>fragrant pig SV108 segment deletion
<400> 2
GGTACAGAAGAAAGACCCCAAGGATTGGGCTGCTCAGTACCGGGAGGCAGTAGAGATGGA 60
AGTCCAAGCTGCAGCTGTGGCTGTGGCTGAGGCTGAGGCCAGGGCTGAGGCAAGAGCCCA 120
AATGGGGATTGGAGAGGAAGCTGTGGCTGGGCCCTGGAATTGGGATGACATGGATATCGA 180
CTGCCTAACAAGGGAAGAGTTAGGCGATGATGCTCAGGCCTGGAGCAGATTTTCATTTGA 240
AATTGAGGCCAGAGACCAAGAAAATGCAAATGCCAGCACCAACATTGACTTCAGCAGAGG 300
AGCTAGCACCAGAGCTAACTTTAGCGATGGTGCTAGTATTTGTTTCAGTGGTGCACCCAG 360
CCCCAGTGATGGCTTTGGTGGCAGAGATGGCATTAGTTTTGGTAGCACATGCAGCACCAG 420
TGCCACCTTCAGCAGTACAGCCAGCATTAGCTTTGGTGGTGCAGCCAGCACCAGTTCTAG 480
TTTC
SEQ ID No.3:
<210> 3
<211>108
<212> DNA
<213>nucleotide sequence of fragrant pig SV108 deletion fragment
<400> 3
AGCCAGCATTAGCTTTGGTGGCACACACTACACTAGCGGCAGCTTCAGCAGTGCAGCCAA 60
CATTTGCTTTGGTGGCATGCCCAACACTTGTTCTACTTTCAGTGGTGG

Claims (5)

1. SV108 molecular labeling in a kind of structure variation TRO gene for identifying fragrant pig variety, it is characterised in that: described SV108 molecular labeling is the chrX:47770108-47770216 of Sscrofa11.1 in pig genome, which becomes Different 108bp segment, or do not lack.
2. SV108 molecule mark in a kind of structure variation TRO gene for identifying fragrant pig variety according to claim 1 Note, it is characterised in that: the primer pair of the SV108 label are as follows: forward primer SV108F: GGTACAGAAGAAAGACCCCAAGGA, reverse primer SV108R:GAAACTAGAACTGGTGCTGGCTG.
3. the detection method of SV108 molecular labeling as claimed in claim 1 or 2, it is characterised in that: the following steps are included: (1) Extract Large White to be measured, the genomic DNA of the black pig of fragrant pig and Guizhou Province north;(2) using the genomic DNA of 3 pig kinds to be measured as template, point Not Li Yong upstream and downstream primer, carry out PCR detection, analyze the genotype of SV;(3) 0.7% agarose gel electrophoresis detect PCR and produce Object, gel imaging system record strip band simultaneously judge genotype.
4. the detection method of SV108 molecular labeling according to claim 3, it is characterised in that: carry out PCR in step (2) Amplification system used, by taking 20 μ L as an example:
2×TaqPCRMasterMix 10.00μL F-primer(0.10μg/μL) 0.40μL R-primer(0.10μg/μL) 0.40μL gDNA 1.00μL ddH2O 8.20μL TotalVolume 20.00μL
PCR reaction condition are as follows:
5. SV108 molecule mark in a kind of structure variation TRO gene for identifying fragrant pig variety as claimed in claim 1 or 2 The application method of note, it is characterised in that: the following steps are included: (1) detects the structure variation in different pigs using regular-PCR technology Distribution situation in varietal population;
(2) frequency for calculating frequency and allele of 3 kinds of genotype in group in each pig variety, analyzes the structure variation and exists Difference size between fragrant pig and Large White kind;
It (3) whether is deletion Genotype supplementary globe Large White and fragrant pig variety according to structure variation SV320.
CN201910819954.8A 2019-08-31 2019-08-31 SV108 molecular labeling and its detection technique in a kind of structure variation TRO gene for identifying fragrant pig variety Pending CN110343773A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910819954.8A CN110343773A (en) 2019-08-31 2019-08-31 SV108 molecular labeling and its detection technique in a kind of structure variation TRO gene for identifying fragrant pig variety

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910819954.8A CN110343773A (en) 2019-08-31 2019-08-31 SV108 molecular labeling and its detection technique in a kind of structure variation TRO gene for identifying fragrant pig variety

Publications (1)

Publication Number Publication Date
CN110343773A true CN110343773A (en) 2019-10-18

Family

ID=68181345

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910819954.8A Pending CN110343773A (en) 2019-08-31 2019-08-31 SV108 molecular labeling and its detection technique in a kind of structure variation TRO gene for identifying fragrant pig variety

Country Status (1)

Country Link
CN (1) CN110343773A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006076825A1 (en) * 2005-01-18 2006-07-27 Kui Li A method for detecting the pork quality traits and carcass traits
CN106399523A (en) * 2016-10-11 2017-02-15 贵州大学 Molecular marker SV193 for distinguishing Chinese local pig breeds from Large White pigs and application technology of molecular marker SV193
CN106434932A (en) * 2016-10-11 2017-02-22 贵州大学 Structural variation SV200 molecular marker for identifying local pig breeds
CN106434931A (en) * 2016-10-11 2017-02-22 贵州大学 Structural variation 177 (SV177) for distinguishing varieties of large white pigs and Chinese indigenous pigs, and detection technology of SV177

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006076825A1 (en) * 2005-01-18 2006-07-27 Kui Li A method for detecting the pork quality traits and carcass traits
CN106399523A (en) * 2016-10-11 2017-02-15 贵州大学 Molecular marker SV193 for distinguishing Chinese local pig breeds from Large White pigs and application technology of molecular marker SV193
CN106434932A (en) * 2016-10-11 2017-02-22 贵州大学 Structural variation SV200 molecular marker for identifying local pig breeds
CN106434931A (en) * 2016-10-11 2017-02-22 贵州大学 Structural variation 177 (SV177) for distinguishing varieties of large white pigs and Chinese indigenous pigs, and detection technology of SV177

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHANG LIU等: "Detection of genomic structural variations in Guizhou indigenous pigs and the comparison with other breeds", 《PLOS ONE》, 20 March 2018 (2018-03-20), pages 1 - 23 *
何树芳等: "贵州地方猪品种毛色与KIT基因拷贝数之间的关联分析", 《中国畜牧兽医》, no. 03, 2 March 2015 (2015-03-02), pages 676 - 684 *
卢圣菲等: "5个猪种HSD17B12基因结构变异SV225的多态性研究", 《畜牧与兽医》, vol. 50, no. 7, 31 December 2018 (2018-12-31), pages 10 - 13 *
李大鹏: "香猪X染色体特有结构变异热点区域序列和功能分析", 《中国学位论文全文数据库》, 18 December 2018 (2018-12-18), pages 1 - 2 *

Similar Documents

Publication Publication Date Title
CN106434931B (en) A kind of structure variation SV177 and its detection technique distinguishing Large White and place of china pig variety
CN106399523B (en) A kind of molecular labeling SV193 and its application technology distinguishing Chinese native pig breed and Large White
CN106434932B (en) A kind of structure variation SV200 molecular labeling identifying Native pig breeds
CN109880890B (en) Detection method of goat HIAT1 gene insertion/deletion polymorphism and application thereof
CN107937556B (en) SNP (Single nucleotide polymorphism) site related to pig feed conversion rate and application thereof
CN109371143B (en) SNP molecular marker associated with pig growth traits
CN110079615B (en) Method for detecting CNV (CNV) marker of KMT2D gene of tea kayak sheep and application of CNV marker
CN108676897A (en) It is a kind of influence daily gain in pigs character SNP marker and its application
CN109371144B (en) SNP molecular marker associated with pig growth traits
CN109402270A (en) One kind SNP marker relevant to Large White growth traits and its application
CN108384859A (en) With the relevant SNP marker of tail type character of broadtail type sheep and application
CN109355398A (en) One kind SNP marker primer relevant to Erhualian number born alive and its application
CN103866032B (en) A kind of method and application thereof detecting goat STAT3 gene mononucleotide polymorphism
CN107267631A (en) A kind of SNP marker for influenceing daily gain in pigs character and its application
CN112501311B (en) SNP (Single nucleotide polymorphism) marker primer pair related to pig nipple number character and application thereof
CN108441566B (en) Method for detecting insertion/deletion polymorphism of goat ATBF1 gene and application thereof
CN107868832B (en) SNP molecular marker related to multiple economic traits of pig and application thereof
CN110079609A (en) A kind of molecular labeling and its application for identifying white diarrhea resistance chicken
CN108004332B (en) It is a kind of to influence the molecular labeling and its application that the main hoof of pig is grown
CN108004236B (en) Corn stalk rot disease-resistant molecular breeding method and application thereof
CN110343773A (en) SV108 molecular labeling and its detection technique in a kind of structure variation TRO gene for identifying fragrant pig variety
CN113817841B (en) SNP (Single nucleotide polymorphism) marker primer pair related to swine nipple number traits and application thereof
CN111269989B (en) Pig MID1 gene as mortality-related molecular marker and application thereof
CN107779517A (en) A kind of molecular labeling for influenceing Duroc kind pig lean meat percentage character and its application
CN110343774A (en) SV103 molecular labeling and its detection technique in a kind of KLF8 gene identifying Guizhou Native pig kind and Large White

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20191018

RJ01 Rejection of invention patent application after publication