CN110317237A

CN110317237A - A kind of α-selenium-ribonucleoside triphosphote synthesis and its high specific nucleic acid enzymatic polymerization and its application

Info

Publication number: CN110317237A
Application number: CN201910315133.0A
Authority: CN
Inventors: 黄震
Original assignee: 黄震
Current assignee: Chengdu se Ruien Biomedical Technology Co.,Ltd.
Priority date: 2019-04-18
Filing date: 2019-04-18
Publication date: 2019-10-11
Anticipated expiration: 2039-04-18
Also published as: CN110317237B

Abstract

The invention discloses a kind of α-selenium-ribonucleoside triphosphote synthesis, and its high specific nucleic acid enzymatic polymerization and its application.By dNTP α Se be substrate come improve enzymatic DNA polymerization specificity and accuracy, and its polymerase chain reaction PCR amplification amplification, constant-temperature amplification amplification, rolling circle amplification amplification or other DNA polymerization in application with.DNA polymerase reaction speed is reduced by dNTP α Se, the specificity and accuracy of DNA polymerization and amplification amplification is improved, reduces by-product.In addition, the selenium modifying DNA generated also can be used as the template or primer of DNA polymerization and amplification.In addition, equally can reduce RNA polymerase reaction speed by NTP α Se, the accuracy of RNA polymerization is improved, reduces by-product.Selenium atom can be by aoxidizing or hydrolyzing or other methods remove, to obtain natural unmodified nucleic acid simultaneously.

Description

A kind of α-selenium-ribonucleoside triphosphote synthesis and its high specific nucleic acid enzymatic polymerization and It is applied

Technical field

The invention belongs to chemistry and molecular biology fields, and in particular to a kind of α-selenium-ribonucleoside triphosphote synthetic method And its high specific DNA enzymatic promotees polymerization and application, is included in the amplification of polymerase chain reaction PCR amplification or constant-temperature amplification amplification (example As ring mediated isothermal amplification LAMP amplifies) or rolling circle amplification amplification or other DNA polymerization reactions in reduce side reaction and answer With and other application method.In addition, the NTP α Se substrate replaced by selenium atom, RNA polymerase can introduce Se atom Into RNA, NTP α Se equally can reduce RNA polymerase reaction speed, improve the accuracy of RNA polymerization, inhibit RNA polymerization Non-specificity extends side reaction, reduces by-product.Simultaneously selenium atom can by aoxidize or hydrolyze or other methods remove, To obtain natural unmodified nucleic acid.

Background technique

Introducing chemical modification (including base modification, sugar-ring modification and phosphoric acid backbone modification) in nucleic acid can change nucleic acid Original property, has great significance to nucleic acids research.The monatomic modification of specific nucleotide can be the minimum change the case where Under, retain the physicochemical property of original nucleic acid as far as possible, while carrying out characteristic newly to nucleic acid belt to improve, therefore meaning is particularly important.Example Such as, the nucleic acid of selenium modification can not only have repellence to the hydrolysis of nuclease, moreover it is possible to grow the crystal of high quality and phase is helped to survey It is fixed, thus have and make broad application prospect and space.However, modification is put into the very wide nucleic acid chains of length range, with The method of current chemical synthetic oligonucleotide chain is difficult to realize.Therefore, introducing modified nucleoside by polymerase is main way Diameter.

DNA is aggregated in biology, medicine and biosystem and plays an important role, including DNA duplication and hereditary information are deposited Storage.The DNA synthesis of high specific is also most important to biotechnology and medical diagnosis on disease.However currently, due between primer or The non-specific amplification occurred between person's primer and template still often will affect PCR amplification amplification or constant-temperature amplification amplification, or rolling The specificity of circle amplification amplification or other polymerization reactions, the confidence level of the final result for influencing experiment or experimental result.In addition, RNA polymerase can additionally extend RNA sequence, and non-specific extension side reaction occurs, generates by-product.

In conclusion problem of the existing technology is: archaeal dna polymerase promotees to be also easy to produce non-specific amplification in reaction, right Design of primers is more demanding, and the complexity for expanding template sample more easily leads to nonspecific products generation.In addition, RNA polymerase Promote to be also easy to produce non-specific RNA product (such as additional extended sequence) in reaction, by-product is caused to generate.

Summary of the invention

In view of the problems of the existing technology, the present invention provides a kind of substitution substrate of chemical modification (dNTP α Se and NTP α Se) synthetic method, dNTP α Se reduce DNA polymerase reaction speed, which can be effectively Inhibit non-specific amplification, the method for improving polymeric enzyme reaction specificity, and its put in polymerase chain reaction PCR amplification Greatly or constant-temperature amplification amplification (such as ring mediated isothermal amplification LAMP amplification) or rolling circle amplification amplification perhaps reverse transcription or The application and other application method of side reaction are reduced in other polymerization reactions.Equally, NTP α Se reduces RNA polymerase reaction speed Degree, the substitution substrate (NTP α Se) can effectively inhibit non-specific extension and occur, it is expected to eliminate polymeric enzyme reaction pair Product.

In order to achieve the above technical purposes, the present invention is realized especially by following technical scheme:

A kind of α-selenium-ribonucleoside triphosphote synthetic method, by the one kettle way, without protection core in advance it is sweet in active base Group, can directly react generation, specifically includes the following steps:

1) respectively by monomer nucleosides, pyrophosphoric acid tributyl ammonium and 3H-1,2-benzothiaselenol-3-one (BTSe) It is placed in different flasks, and be respectively dried in vacuo；

2) DMF, tri-n-butylamine and the chloro- 4H-1,3,2- benzo dioxaphosphepin of anhydrous 2- are injected into pyrophosphoric acid tributyl ammonium Cyclohexadiene -4- ketone solution obtains mixed liquor；

3) mixed liquor is stirred to react under ar gas environment, and monomer nucleosides solution, the reaction was continued 1h is added；

4) BTSe solution is injected into reaction vessel and carries out oxidation reaction；

5) after reaction time 1h, twice of reaction solution volume of water is added in the reaction vessel, hydrolyzes 2h；

6) dithiothreitol (DTT) there are in the environment of sodium chloride and ethyl alcohol sequentially added into reaction solution, mixed liquor is freezed, Centrifugation；

7) remove supernatant, will be precipitated and dissolved in water, centrifugation removes supernatant up to target product.

Further, the monomer nucleosides, pyrophosphoric acid tributyl ammonium and 3H-1,2-benzothiaselenol-3- The molar ratio of one (BTSe) is 1:2:2.

Further, the monomer nucleosides is selected from desoxyadenossine, deoxycytidine, deoxyguanosine, thymidine, deoxidation modification core One of glycosides (nucleosides including base modification), adenosine, cytidine, guanosine, uridine or modified nucleoside (nucleosides including base modification) Kind.

In another aspect of this invention, above-mentioned synthetic method obtains α-selenium-ribonucleoside triphosphote also in protection model of the invention Within enclosing.

α-selenium-ribonucleoside triphosphote structural formula is as follows:

Base includes A, C, G, T and U and modified base.

In another aspect of this invention, dNTP α Se and NTP the α Se being prepared is additionally provided, and its poly- in enzymatic DNA Application in conjunction or RNA polymerization reaction.

Further, the selenium DNA compound of enzyme' s catalysis is obtained by DNA or RNA primer amplification.

Further, α-selenium-ribonucleoside triphosphote enzymatic method synthesizes Se modifying DNA.

Further, nucleic acid with hydrogen peroxide (or other oxidations or hydrolysis) solution of selenium modification contacts similar to generate Natural acid.

Further, which includes archaeal dna polymerase, RNA polymerase or reverse transcriptase.

Further, RNA polymerase participates in reaction, and substrate uses NTP α Se.

Further, reverse transcriptase participates in reaction, and substrate uses dNTP α Se.

The enzymatic DNA polymerization reaction is included in the amplification of polymerase chain reaction PCR amplification or constant-temperature amplification amplification (example As ring mediated isothermal amplification LAMP amplifies) or rolling circle amplification amplification perhaps reduce in reverse transcription or other polymerization reactions it is secondary The application of reaction and other application method.

Specifically by α-selenium-ribonucleoside triphosphote of selenium atom substitution, (dNTP α Se substitutes natural dNTP substrate, successfully Se atom is introduced into DNA with archaeal dna polymerase, dNTP α Se reduces DNA polymerase reaction speed, greatly improves DNA The specificity and accuracy of polymerization and amplification amplification inhibit DNA to polymerize non-specific side reaction and occur, reduce by-product.

The method of enzymatic DNA polymerization and amplification amplification may include PCR amplification, isothermal duplication, rolling circle amplification, or reversion Record and other polymerizations expand amplification method.

It is a kind of for generating the enzyme method technique of nucleic acid, have non-specific nucleic acid product, the work in products therefrom mixture Skill includes: that primer sequence (or promoter sequence) and template sequence are annealed；And there are enzyme and include at least one modification Modification of nucleic acids is formed in the case where the mixture of ribonucleotides of nucleotide；Wherein, the non-specific nucleic acid product in product mixture Amount be less than the amount of other same method using similar natural nucleotide.

Further, modified nucleic acid is separated；And make modified nucleic acid and hydrogen peroxide (or other oxidations or water Solution) solution contact to generate similar natural acid.

Further, the method is cDNA synthesis or reverse transcription and other polymerizations, PCR amplification, rolling ring expansion Increasing or isothermal duplication (such as LAMP amplification) process.

It is a kind of for carrying out the reagent mixture of nucleic acid extension, the mixture includes: DNA primer sequence, DNA Template sequence, archaeal dna polymerase, α-selenium-ribonucleoside triphosphote dNTP α Se.

It further, include reaction buffer, which includes Tris HCl, (NH₄)₂SO₄, 10mM KCl, 2mM MgSO₄, 0.1%X-100 or any combination thereof.

It is a kind of for carrying out the reagent mixture of rna transcription synthesis, the mixture includes: DNA promoter sequence, DNA Template sequence, RNA polymerase, α-selenium-ribonucleoside triphosphote NTP α Se.

A kind of reagent mixture, comprising: primer (or promoter) sequence；Template sequence；Polymerase；α-three phosphorus of selenium-nucleosides Sour (dNTP α Se and NTP α Se).

In another aspect of this invention, additionally provide α-selenium-ribonucleoside triphosphote enzymatic method synthesis Se modifying DNA and Application in RNA.

In another aspect of this invention, a kind of reagent mixture extended for carrying out nucleic acid with synthetic reaction is provided, It is characterized in that, the mixture includes: nucleic acid primer sequence, RNA template sequence, reverse transcriptase, α-selenium-ribonucleoside triphosphote dNTPαSe。

The invention has the benefit that

The present invention can be direct without protecting the sweet middle reactive group of core in advance by one pot process α-selenium-ribonucleoside triphosphote Reaction generates.α-selenium-ribonucleoside triphosphote is as enzymatic reaction substrate simultaneously, and Se atom of the same clan replaces O atom, to polymerase activity Smaller with the influence of identity, smaller to the space structure disturbance of the DNA of synthesis, dNTP α Se reduces DNA polymerase reaction speed Degree, at the same it is obvious to the inhibitory effect of non-specific synthesis, the sequence of the DNA of synthesis is not influenced.In addition, being taken by selenium atom Se atom can be introduced into RNA by the NTP α Se substrate in generation, RNA polymerase, and NTP α Se equally can reduce RNA polymerization Enzyme reaction rate improves the accuracy of RNA polymerization, inhibits RNA to polymerize non-specific side reaction and occurs, reduces by-product.And Synthetic product (selenium DNA or RNA) had not only had certain stability but also easily can have been aoxidized or be hydrolyzed to conventional nucleic acid (naturally Nucleic acid).

Detailed description of the invention

Fig. 1 is HPLC purifying Se-TTP crude product chromatography provided in an embodiment of the present invention；

Fig. 2 is for the diastereoisomer of each dNTP α Se of high-efficient liquid phase chromatogram technique analysis provided in an embodiment of the present invention I and II；

Fig. 3 is archaeal dna polymerase identification dNTP α Se difference non-corresponding isomers analysis provided in an embodiment of the present invention；

Fig. 4 is provided in an embodiment of the present invention in the case where different temperatures is without DNA profiling, and dNTP α Se inhibits non-specific Property DNA primer extend analysis；

Fig. 5 is that single or multiple dNTP α Se triphosphates provided in an embodiment of the present invention inhibit the polymerization of DNA constant temperature non-specific Property DNA polymerization analysis；

Fig. 6 is the non-specific amplification in four kinds of differences dNTP α Se suppression PCR provided in an embodiment of the present invention；

Fig. 7 is inhibition point of the dCTP α Se provided in an embodiment of the present invention to non-specific product in the PCR reaction of different primers Analysis；

Fig. 8 is inhibition point of the dCTP α Se provided in an embodiment of the present invention to non-specific product in template complex cDNA amplification Analysis；

Fig. 9 is the Se modifying DNA sequencing analysis of Bst extension synthesis provided in an embodiment of the present invention；

Figure 10 is H provided in an embodiment of the present invention₂O₂The ESI mass spectrum of selenium-DNA before and after deselenization.

Specific embodiment

Below in conjunction with specific embodiment of the present invention, technical solution of the present invention is clearly and completely described, is shown So, described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.Based on the reality in the present invention Example is applied, every other embodiment obtained by those of ordinary skill in the art without making creative efforts all belongs to In the scope of protection of the invention.

The synthesis and purifying of 1 α of embodiment-selenium-ribonucleoside triphosphote (dNTP α Se)

1) dNTP α Se is synthesized

By monomer nucleosides (1,1mmol, desoxyadenossine dA [250mg], deoxycytidine dC [225 mg], deoxyguanosine dG [265mg] or thymidine dT [240mg]), pyrophosphoric acid tributyl ammonium (945mg, 2mmol, 2equiv) and 3H-1,2- Benzothiaselenol-3-one (BTSe, 435mg, 2mmol, 2equiv) is respectively put into the good flask of air-tightness, with oil Each comfortable high vacuum is pumped to filter drying 1 hour or more.Again into the pyrophosphoric acid tributyl ammonium after drying inject DMF (1.5mL) and Tri-n-butylamine (TBA, 3.0mL) is for dissolving pyrophosphate.Then the anhydrous 2- chloro- 4H-1 being dissolved in DMF (3.0mL), 3, 2- benzo dioxaphosphepin cyclohexadiene -4- ketone (405mg, 2mmol, 2equiv) injects in pyrophosphate solution.

Reaction flask equipped with the reaction mixture is stirred at room temperature 60 minutes under argon gas protection environment.Upper step is anti- Answer liquid that the deoxyribonucleoside (1.5mL for being dissolved in DMF is added；Note: desoxyadenossine dA is dissolved in 1.0mL DMF and 1.5mL DMSO；Deoxyguanosine dG is dissolved in 3.0mL DMSO).It keeps Phosphorylating Nucleosides reaction to protect in argon gas and stirring carries out at room temperature After reaction 1 hour, the BTSe being dissolved in Isosorbide-5-Nitrae-dioxane (2.5mL) is injected into equipped with the anti-of the nucleosides reaction mixture It answers in bottle, carries out the oxidation reaction of BTSe at room temperature 1 hour.Then by (about twice of reaction solution volume of 30mL water Amount) be added in BTSe reaction mixture, at room temperature hydrolyze 2 hours after, having fresh dithiothreitol (DTT) (DTT, 2mM) Ethyl alcohol/NaCl precipitating is carried out in the presence of in the environment of, and (NaCl [4.5mL, 3M] and ethyl alcohol [150mL] are added sequentially to reaction solution In), then mixed solution is freezed at -80 DEG C after twenty minutes, room temperature, 14,000rpm revolving speed under be centrifuged 10 minutes). Remove supernatant, precipitating is re-dissolved in 1000 μ L water and then repeats above-mentioned centrifugal condition and is precipitated again, finally by precipitating weight It is newly dissolved in a small amount of water (400 μ L), then carries out freeze-drying rapidly in freeze-dryer

2) it purifies

Using reversed-phase high performance liquid chromatography (RP-HPLC), using Ultimate XB-C18 HPLC column (10 μm, 30 × 250mm, Welch) purification of crude product.

Use 95% buffer solution A (20mM triethylamine acetate (TEAAc), pH6.6) and 5% buffer solution B to 20% buffering Linear gradient elution sample (flow 15mL/min) 50 minutes of liquid B (50% acetonitrile solution, 20mM TEAAc, pH6.6). Different diastereoisomers are collected respectively.The diastereoisomer of purifying is lyophilized and is redissolved in and contains 10mM tri- on a small quantity In the solution of (methylol) aminomethane/HCl (Tris-HCl, pH7.5) and 20mM DTT, it is stored in -80 DEG C of environment.

The HPLC of dNTP α Se after purification is analyzed: by Ultimate AQ-C18 column (5 μm, 4.6 × 250mm, Welch) in the linear gradient (1mL/min) of 95% buffer solution A and 5% buffer solution B to 26% buffer solution B.

When synthesizing dNTP α Se, by being reacted with selective phosphorylation agent with each nucleosides.The selectivity phosphorus Acidizing reagent is raw by 2-chloro-4H-1,3,2-benzodioxaphospho rin-4-one and pyrophosphate reaction in-situ At, reduce 2-chloro-4H-1, the reactivity of 3,2-benzo dioxaphosphorin-4-one, provide have compared with The phosphorylation agent of good region reactivity.Therefore, the phosphorylation agent property of can choose each nucleosides of phosphorylation 5 '- OH generates cyclic annular phosphorous acid.Then the phosphite is by 3H-1,2-benzothiaselen ol-3-one (BTSe) by Se- function It can group's oxidation insertion.It followed by hydrolyzes, generates required Se- phosphate nucleoside triphosphatase.Each dNTP α Se is due to its α-P Chiral centre is generated, therefore every kind of dNTP α Se is provided with two kinds of diastereoisomers.

The structure difference of the dNTP α Se and NTP α Se of synthesis is as follows:

Base includes A, C, G, T and U and modified base.

A kind of its isomers is respectively as follows:

Crude product is first by ethanol precipitation (having 2mM dithiothreitol (DTT), to avoid oxidation and deselenization) purifying.Compound precipitates It is purified again by reversed-phase high performance liquid chromatography (such as Fig. 1, TTP α Se purifying), every a pair of of the diastereomer of dNTP α Se can be fine Ground separates (Fig. 1).In addition, the efficient liquid of all eight kinds of diastereoisomers dATP α Se, dCTP α Se, dGTP α Se and TTP α Se (Fig. 2,1 non-corresponding isomers retention time of peak is shorter, is denoted as dNTP α Se I, and 2 diastereoisomer of peak is denoted as dNTP for phase chromatography αSe II.(A) 1: sample introduction dATP and dATP α Se I and II altogether； 2:dATPαSe I；3:dATPαSeII；(B) 1: sample introduction altogether DCTP, dCTP α Se I and II；2: dCTPαSe I；3:dCTPαSe II；(C) 1: sample introduction dGTP, dGTP α Se I and II altogether；2: dGTPαSe I；3:dGTPαSe II；(D) 1: sample introduction TTP and TTP α Se I and II altogether；2:TTPαSe I；3:TTP α Se II), Mass spectrum (table 1),¹H-,¹³C-, and³¹P- nuclear magnetic resonance spectroscopy (table 2-4).

The dNTP α Se synthetic product of 1 high resolution mass spectrum of table analysis synthesis

2 dNTP α Se's of table¹H-NMR chemical shift (δ, ppm), solvent D₂O

3 dNTP α Se's of table¹³C-NMR chemical shift (δ, ppm), solvent D₂O

4 dNTP α Se's of table³¹P-NMR chemical shift (δ, ppm), solvent D₂O

2 dNTP α Se diastereoisomer of embodiment extends experiment as the archaeal dna polymerase of substrate

Extended DNA polymeric enzyme reaction and each dNTP α Se diastereoisomer have carried out 5'-FAM-labeled substrate (0.5 μM of DNA primer) and template (DNA profiling, 0.5 μM), DNA polymerase (DNA polymerization, 0.04U/ μ L；Klenow,0.2U/μ L；Bst large fragment, 0.3U/μ L) and nucleotide (DNAPolI reaction in 125 μM, Klenow and Bst reaction in 15 μM).Reaction The urea-denatured dye solution of equivalent 8M is added in 37 DEG C of incubation 60min of mixture, every pipe.It terminates in 95 DEG C of dry baths and is incubated for completely 10min, through Urea denaturation polyacrylamide gel electrophoresis (Urea-PAGE) and FAM fluorescence imaging analysis, (Fig. 3, (A) are used for product B, the DNA primer of C, template and Product Sequence.DNA primer and DNA synthetic product are held 5 ' is labeled as 6-FAM.(B) drawn by DNA Object extends polymerase I (a), and Klenow (b), Bst (c) and four natural nucleotides of use and dNTP α Se I or II replace corresponding Natural dNTP.1st, 4,7,10 swimming lanes (negative control) it is fewer respectively than the sample in 13 swimming lanes (include all natural dNTPs) DATP, dGTP, dCTP and TTP are added.The swimming lane of 2nd, 5,8 and 11 is then respectively dATP α Se I, dGTP α Se I, dCTP α Se I Corresponding natural nucleotide is replaced with TTP α Se I.The swimming lane of 3rd, 6,9 and 12 is dATP α Se II, dGTP α Se II, dCTP α Se II and TTP α Se II replaces corresponding natural nucleotide respectively.Lane14 and Lane15 is respectively DNA primer and DNA synthesis Product.(C) corresponding natural nucleotide is replaced in the mixing (1:1 ratio) that DNA primer extends dNTP α Se I and II respectively).

As a result as can be seen that all natural dNTPs positive control generate full length DNA product, and it is each missing one The negative control of dNTP is then without generating any full length product.It was found that in selenium ribonucleoside triphosphote first (dNTP α Se I, Faster diastereoisomer is migrated in HPLC) it can effectively be identified by archaeal dna polymerase, and dNTP α Se II is (in HPLC The relatively slow fast diastereoisomer of middle migration) do not identified by polymerase.Because archaeal dna polymerase identifies that Sp-dNTP α S is diastereomeric Body is as substrate, similarly, can be divided into dNTP α Se I as Sp type (temporary designations), and dNTP α Se II is that Rp type is (temporary Name).The accurate space chemistry of dNTP α Se I and II is currently studied.Each dNTP α Se I can be generated as right The same high quality of natural dNTP answered expeditiously generates full length product (Fig. 3 B).DNTP α Se II diastereomer then neither Substrate is not inhibitor (Fig. 3 B, 3C) again.Result of study shows that all dNTP α Se I are the good substrates of archaeal dna polymerase. These experimental results also indicate that, every a pair of of the diastereomer of separation dNTP α Se may not be it is necessary, diastereoisomer II will not Inhibit DNA polymerization reaction.This discovery can largely save the work for isolating and purifying dNTP α Se.

3 dNTP α Se of embodiment inhibits primer itself non-specific amplification at different temperatures

Establish reaction system by following components: DNA primer (2 μM), Bst (0.5U/ μ L) and dNTP (are all natural dNTP Or dCTP α Se and other several natural dNTP, 200 μM every kind).It reacts 60 minutes, gathers at 20,30,40,50 and 60 DEG C Synthase denaturation is carried out in 95 DEG C of native polyacrylamide gel electrophoresis (PAGE) analyses after ten minutes with mark fluorescent group Colour developing (Fig. 4, primer sequence are 5'-FAM-GTCGAGTCAAGAG CATCC-3').

Since the oxygen atom of dNTP (O atom radius: 0.73A) is taken by bigger selenium atom (1.16A) in α phosphate position In generation, this may slow down DNA polymerization, to improve the accuracy of dNTP incorporation.

The primer extend of not DNA profiling is devised, because primer can be used with each other as non-specific template, thus The non-specific by-product extended is generated, such as the DNA by-product of primer dimer and background synthesis.In order to reduce not to draw Object extends, and has studied the natural and Se modified nucleoside acid not reaction (Fig. 4) of template at different temperatures.Only natural nucleus glycoside When acid is used as substrate, discovery substrate is used up, and non-specificity DNA extends, by foring multiple by-products.Phase Instead, the corresponding natural dNTP of dNTP α Se (such as dCTP α Se I) replacement (30-60 DEG C) can effectively prevent in wide temperature range Only non-specific DNA primer extends.

4 dNTP α Se of embodiment inhibits constant temperature to polymerize non-specific DNA primer extension

Reaction system is established by following components: DNA primer (2 μM), DNA profiling (2 μM), Bst (0.5U/ μ L) and natural And/or Se- modified nucleoside is sour (200 μM, each nucleotide).Extend 60 minutes or 90 minutes at 55 DEG C.Product is with non denatured (primer, template and product in Fig. 5, (A) B-C are analyzed according to glue after PAGE, gel-red dyeing.Polymerizate is carried out non denatured Primer or template, or (C) is used only with or without the use of primer and template in PAGE analysis, (B).DNA extension is according to following Carry out: template, dNTP or dNTP α Se, Bst polymerase react under buffer condition, 55 DEG C, 60 minutes).

It devises in the case where having DNA profiling and Bst, carries out DNA synthesis with primer extend, be 55 DEG C in optimum temperature Under synthesized (Fig. 5).As a result, it has been found that natural dNTPs causes non-specific DNA in the case where DNA profiling exists and lacks Polymerization, generates multiple by-products (especially longer by-product, Fig. 5 B).On the contrary, dNTP α SeI replaces (one or more nucleosides Acid) sample in, generate cleaner polymerizate (there is and lack DNA profiling), yield is also similar.Since primer does not have Label, these PAGE gels are dyed by GelRed, visualize the DNA generated in response sample." onlyprimer " experiment (figure Lacking signal (lane3-6) in 5B) is especially existed since the dNTPs of Se modification completely inhibits non-specific extension In the case where multiple Se-dNTPs.In the case where no DNA, the de novo formation (Fig. 5 C) of archaeal dna polymerase is not observed. It was furthermore observed that list dNTP α Se I replacement can effectively inhibit the formation of by-product.In addition, multiple Se-dNTPs can be complete Non-specificity is prevented entirely, and combined coefficient is also similar.Archaeal dna polymerase still has function or even all 4 natural nucleus glycosides When acid is all substituted for 4 dNTP α Se I, yield remains to remain unchanged.Obviously, compared with natural dNTPs, the dNTPs of Se modification There is higher specificity in terms of DNA primer extension and polymerization.

5 dNTP α Se of embodiment inhibits DNA non-specific PCR amplification

Reaction system is established by following components: DNA primer (0.4 μM), DNA profiling, Taq (0.075U/ μ L Transgen Co., Ltd), nucleotide (200 μM) and 1 × Taq buffer (20 mM Tris-HCl, pH value 8.3；20mM potassium chloride；10mM (NH₄)₂SO₄；2mM MgCl₂).Reaction condition is: 94 DEG C 3 minutes；35 circulations: 94 DEG C of 30s, best primer annealing temperature 30s, 72 DEG C of 90s；Last 72 DEG C of extension 5 minutes.Then agarose gel electrophoresis, ethidium bromide staining imaging analysis product (Fig. 6-8).

In Taq archaeal dna polymerase chain reaction amplification ring-type and linearization plasmid, it is found that dN TP α Se I can obviously press down Nonspecific products processed generate (Fig. 6, exact matching primer (forward direction: 5'-TCAAGATCCGCCACAACATC-3'；It is reversed: 5'- CTGGGTGCTCAGGTAGTG-3'), specific product length is 119bp.It (A) is the P of template with cyclic plasmid (pEGFP-C1) CR amplification；(B) it is the PCR amplification of template with linearization plasmid (pEGFP-C1)) PC R yield is not influenced but.Especially DCTP α SeI almost inhibits nonspecific products and generates more special product.

For the generality of influence of the dCTP α SeI to non-specific amplification of test, 3 new primer pair (AF/ are had checked AR, BF/BR, CF/CR) and pervious primer pair (DF/DR).The result shows that all produced using the reaction of 4 kinds of natural dNTPs Raw apparent nonspecific products, when Se-dCTP replaces natural dCTP, these products can be totally constrained (Fig. 7, (A) four To the sequence of primer；(B) influence dCTP α Se specific to polymerization with natural dNTPs compared in PCR reaction is with pEGFP-C1 Plasmid is template；Primer pair A-D is the specific primer of exact matching).

Relative to the total cDNAs come from cell total rna reverse transcription, the plasmid used (pEGFP-C1) is in PCR reaction It is a very simple template, therefore even if reaction condition is optimized, is easy to generate using cDNAs template in PCR Nonspecific products.To the amplified reaction of cDNA template, (Fig. 8, (A) source of people cDNA template and are drawn amplification target sequence as the result is shown Object；(B) compared with natural dNTP, inhibition of the dCTP α Se to non-specific amplification in cDNA amplification), dCTP α Se expands cDNA The inhibition of middle non-specific amplification: after replacing dCTP (left lane) with dCTP α SeI (intermediate swimming lane), non-specific DNA cloning It is totally constrained, and amplification efficiency is not significantly affected.

The sequencing of the PCR product of 6 PSe-DNA of embodiment and corresponding n DNA

With dNTP α Se, native template DNA (5'-acgacgttgtaaaacgacggccagtgaattc gagctcggtacccggggatcctctagag-tcgacctgcaggcatgcaagcttggcgtaatc-atgg-tc at-3') Se-DNA (Fig. 9) is prepared first with primer T (5'-aatttcacacaggaaacagctatgaccatgattacgcc-3').With The Se-DNA of urea PAGE gel (12.5%) purifying polymerization.PCR amplification of the Se-DNA of purifying as template, with dNTP α Se And/or natural substrate 0.2mM, 0.6 μM of primer, 0.15U/ μ l Taq archaeal dna polymerase and Mg²⁺2mM.Then with forward primer and Reverse primer is sequenced.

It is right in order to confirm the sequence integrity after carrying out DNA polymerization using dNTP α Se as substrate, by template of Se-DNA Sequence after amplification is sequenced.Firstly, use dNTP α Se as the DNA of substrate and n DNA templated synthesis containing Se, and Se-DNA product has been purified by PAGE glue.In order to promote the separation of Se-DNA, use longer DNA as primer.After purification Se-DNA as template, using dNTP α Se as substrate, carried out 30 circulation PCR amplifications.Then with its forward and reverse primer It is sequenced.Meanwhile identical experiment is carried out with natural dNTPs, and compare to sequencing result.It was found that they have Identical ultimate sequence (table 5；The sequence of Fig. 9, primer T (with the unpaired end 5'-), primers F and primer R are respectively 5'-d (aatttcacacaggaaatgaccatgattacgcc) -3', 5'-d (aatttcacacaggaaacagct) -3' and 5'-d (acgacgttgtaaaacacacg)-3')。

The sequencing of 5 PCR product of table

The oxidation deselenization of 7 Se-DNA of embodiment is n DNA

In order to convert corresponding native DNA for Se-DNA, aoxidized with hydrogen peroxide.It is anti-by index amplification (EXPAR) is answered to be prepared for the DNA of single-stranded natural and selenium modification.The two DNA sequence dnas are purified through PAGE, C18 pillar desalination (Sep-pac Vac, Waters company).Then with 3% fresh H₂O₂Deselenization processing, room temperature 24 hours or 50 are carried out to Se-DNA DEG C 2 hours.Through ESI-MS analysis, (Figure 10, single-stranded Se-DNA sequence are 5 '-d (pApGpTpApCpTpApGpA to gained sample PTpGpTpGpApGpApCpApTpC), containing dC- selenium phosphoric acid.Se-DNA molecular formula: C₁₉₇H₂₄₇N₇₉O₁₁₆P₂₀Se₃, [M-H⁺]^-: 6432.8(calc.)；Se-DNAs (corresponding nativeDNA) molecular formula of complete deselenization: C₁₉₇H₂₄₇N₇₉O₁₁₉P₂₀, [M-3Se +3O-H⁺]^-:6243.1(calc.).A: through H₂O₂It handles and without H₂O₂The mass spectrum overlapping of the Se-DNA of processing at room temperature for 24 hours Map (respectively red and grey chromatography), the quality observed is respectively 6431.9 (6432.8, calc.) and6433.3 (6432.8,calc.)；B: at 50 DEG C, H₂O₂It does not handle and handles 2 hours, the mass spectrum overlapping map of Se-DNA is (respectively red Color and grey chromatography), the quality observed is respectively 6431.9 (6432.8, calc.) and 6243.1 (6245.2, calc.).

Result of study shows that dNTP α Se and Se-DNA can be directly used as conventional substrate and DNA profiling respectively.This DNA In Se modification can be with 24 hours at room temperature not by hydrogen peroxide removal (Figure 10 A).And under identical oxidizing condition, only 50 DEG C and the short time processing, selenium can by hydrogen peroxide selectivity oxidation removal (Figure 10 B), generate corresponding routine DNA (n DNA).Although Se-DNA is relatively stable, it is translated into corresponding routine DNA with can be convenient.

It although an embodiment of the present invention has been shown and described, for the ordinary skill in the art, can be with Understand without departing from the principles and spirit of the present invention can to these examples carry out it is a variety of variation, modification, replacement and Modification, the scope of the present invention is defined by the appended.

Sequence table

<110>Huang Zhen

<120>a kind of α-selenium-ribonucleoside triphosphote synthesis, and its high specific nucleic acid enzymatic polymerization and its application

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

gtcgagtcaa gagcatcc 18

<210> 2

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

tcaagatccg ccacaacatc 20

<210> 3

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

ctgggtgctc aggtagtg 18

<210> 4

<211> 32

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

aatttcacac aggaaatgac catgattacg cc 32

<210> 5

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

aatttcacac aggaaacagc t 21

<210> 6

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

acgacgttgt aaaacacacg 20

<210> 7

<211> 99

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acccggggat cctctagagt 60

cgacctgcag gcatgcaagc ttggcgtaat catggtcat 99

<210> 8

<211> 38

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

aatttcacac aggaaacagc tatgaccatg attacgcc 38

<210> 9

<211> 70

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acccggggat cctctagagt 60

cgacctgcag 70

<210> 10

<211> 69

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

ctctagagtc gacctgcagg catgcaagct tggcgtaatc atggtcatag ctgtttcctg 60

tgtgaaatt 69

Claims

1. a kind of α-selenium-ribonucleoside triphosphote synthetic method, which comprises the following steps:

1) monomer nucleosides, pyrophosphoric acid tributyl ammonium and 3H-1,2-benzothiaselenol-3-one are respectively placed in difference Flask in, and be respectively dried in vacuo；

2) DMF, tri-n-butylamine and the chloro- 4H-1,3,2- benzo dioxaphosphepin hexamethylene of anhydrous 2- are injected into pyrophosphoric acid tributyl ammonium Diene -4- ketone solution obtains mixed liquor；

4) 3H-1,2-benzothiaselenol-3-one solution is injected into reaction vessel and carries out oxidation reaction；

6) dithiothreitol (DTT) there are in the environment of sodium chloride and ethyl alcohol sequentially added into reaction solution, mixed liquor is freezed, is centrifuged；

2. synthetic method according to claim 1, which is characterized in that the monomer nucleosides, pyrophosphoric acid tributyl ammonium and The molar ratio of 3H-1,2-benzothiaselenol-3-one is 1:2:2.

3. synthetic method according to claim 1, which is characterized in that the monomer nucleosides is selected from desoxyadenossine, deoxidation One kind of cytidine, deoxyguanosine, thymidine, deoxidation modified nucleoside, adenosine, cytidine, guanosine, uridine or modified nucleoside.

4. the compound that synthetic method described in claim 1 obtains, which is characterized in that the α-selenium-ribonucleoside triphosphote, knot Structure formula is as follows:

Wherein, base includes A, C, G, T and U and modified base.

5. application of the α-selenium-ribonucleoside triphosphote described in claim 1 in enzymatic DNA polymerization or RNA polymerization reaction.

6. application according to claim 5, which is characterized in that the selenium DNA compound of enzyme' s catalysis is drawn by natural acid Object or modification of nucleic acids primer synthesize to obtain.

7. application according to claim 5, which is characterized in that substrate uses dNTP α Se.

8. application according to claim 6, which is characterized in that the selenium DNA compound be DNA cloning amplify template with And rna transcription template.

9. application according to claim 5, which is characterized in that α-selenium-ribonucleoside triphosphote enzymatic method synthesis Se modification DNA。

10. application according to claim 5, which is characterized in that the nucleic acid of selenium modification connects with hydrogen peroxide or hydrating solution Touching is to generate similar natural acid.

11. the application stated according to claim 5, which is characterized in that include archaeal dna polymerase, RNA polymerase or reverse transcriptase.

12. 1 application stated according to claim 1, which is characterized in that RNA polymerase participates in reaction, and substrate uses NTP α Se.

13. a kind of for generating the enzyme process method of nucleic acid, which is characterized in that there is non-specific nucleic acid production in products therefrom mixture Object, comprising: primer sequence or promoter sequence and template sequence are annealed；And core is being modified there are enzyme and comprising at least one Modification of nucleic acids is formed in the case where the mixture of ribonucleotides of thuja acid；Wherein, non-specific nucleic acid product in product mixture Amount is less than the amount of other same method using similar natural nucleotide.

14. according to the method for claim 13, characterized by comprising: separating modified nucleic acid；And make modified Nucleic acid is contacted with hydrogen peroxide or hydrating solution to generate similar natural acid.

15. according to the method for claim 13, which is characterized in that wherein method is cDNA synthesis, and PCR amplification, rolling ring expand Increasing or isothermal duplication process.

16. a kind of for carrying out the reagent mixture of nucleic acid extension, which is characterized in that the mixture includes: DNA primer Sequence, DNA template sequence, archaeal dna polymerase, α-selenium-ribonucleoside triphosphote dNTP α Se.

17. mixture according to claim 16, which is characterized in that include reaction buffer, which includes Tris HCl, (NH₄)₂SO₄,10mM KCl,2mM MgSO₄, 0.1%X-100 or any combination thereof.

18. a kind of reagent mixture characterized by comprising primer or promoter sequence, template sequence, polymerase, α-selenium- Ribonucleoside triphosphote.

19. a kind of for carrying out the reagent mixture of RNA synthesis, which is characterized in that the mixture includes: DNA promoter sequence Column, DNA template sequence, RNA polymerase, α-selenium-ribonucleoside triphosphote NTP α Se.

20. a kind of extend and the reagent mixture of synthetic reaction for carrying out nucleic acid, which is characterized in that the mixture includes: Nucleic acid primer sequence, RNA template sequence, reverse transcriptase, α-selenium-ribonucleoside triphosphote dNTP α Se.