WO2019150564A1

WO2019150564A1 - Dna replication method using oligonucleotide having sulfonamide skeleton as template

Info

Publication number: WO2019150564A1
Application number: PCT/JP2018/003693
Authority: WO
Inventors: 清尾　康志; 慶昭正木
Original assignee: 国立大学法人東京工業大学
Priority date: 2018-02-02
Filing date: 2018-02-02
Publication date: 2019-08-08
Also published as: JPWO2019150564A1

Abstract

The present invention pertains to a method for synthesizing an oligodeoxynucleotide (ODN), said method comprising synthesizing an ODN which has a sulfonamide bonded thereto via a non-natural internucleotide linkage and using the thus synthesized ODN as a template in a DNA synthetase reaction.

Description

DNA replication method using oligonucleotide with sulfonamide skeleton as template

The present invention relates to a method for synthesizing ODN by synthesizing oligodeoxynucleotide (ODN) having sulfonamide bonded with non-natural internucleotide and using this as a template.

A method of synthesizing an artificial gene by linking chemically synthesized oligodeoxynucleotides (ODN) using a DNA synthase, a restriction enzyme, or a ligase has attracted attention in the fields of synthetic biology and molecular biology. However, the upper limit of oligodeoxynucleotides that can be used for this purpose is about 150 bases, and longer oligonucleotides have low purity due to incomplete coupling and side reactions during oligonucleotide synthesis, and DNA synthase When it is replicated by PCR, a mixture of artificial genes containing undesired sequences is generated. Therefore, as a method for synthesizing longer ODNs, methods for linking short ODN fragments using enzymes such as DNA ligase and RNA ligase have been known for a long time, but these enzyme methods are scaled up to mass synthesis. Is difficult (Non-Patent Documents 1 and 2).

Thus, as an alternative to such an enzymatic method, a 3′-modified ODN having a reactive residue at the 3 ′ end and a 5′-modified ODN having a reactive residue at the 5 ′ end are linked without using an enzyme. A chemical ligation method has been reported. The modified ODN synthesized in this way contains a non-natural internucleotide bond that is different from the natural phosphodiester bond. If this modified ODN can be used as a template, a natural ODN can be synthesized by a DNA synthase. It is useful as a method for synthesizing natural ODN having a long chain length.

As such a modified ODN, for example, Brown et al., A modified ODN having a triazole bond instead of a phosphodiester bond by linking 3 ′ azido ODN and 5 ′ alkyne ODN in the presence of a copper catalyst in a click reaction. It has been reported that natural ODN is synthesized by synthesizing it and performing PCR reaction using it as a template (Non-patent Documents 1 and 2).

Further, instead of 3 ′ azido ODN and 5 ′ alkyne ODN, the same chemical ligation is performed using 3 ′ azido oligoribonucleotide (ORN) and 5 ′ alkyne ORN, and natural ODN is synthesized by reverse transcriptase. A method has also been reported (Patent Document 1). However, in the click reaction used in these methods, copper ions are used as a catalyst for the progress of the reaction. Therefore, when the synthesized natural ODN is used for biological applications, it is necessary to completely remove the copper ions. There is. Therefore, if there is a non-natural internucleotide bond that can be linked without using a catalyst such as copper ion and does not inhibit the function of DNA synthase or reverse transcriptase, synthesis of long-chain ODN using the chemical ligation method Useful for.

International Publication No. WO2015 / 177520

An object of the present invention is to provide a method for synthesizing an oligodeoxynucleotide (ODN) having a non-natural internucleotide bond that can be used in a chemical ligation method.

As a result of intensive studies to achieve this object, the present inventors have obtained the following sulfonamides:

It was found that oligodeoxynucleotide (ODN) having a non-natural internucleotide bond functions as a template in ODN synthesis by DNA synthase, and the present invention has been completed. So far, artificial nucleic acids having sulfonamide bonds have been reported in the past (EB McElroy, R. Bandaru, J. Huang, TS Widlanski, Bioorg. Med. Chem. 1994, 4, 1071-1076; RC Reynolds, PA Crooks, JA Maddry, MS Akhtar, JA Montgomery, JA Secrist III, J. Org. Chem. 1992, 57, 1983-1985; C. Glemarecl, RC Reynolds, PA Crooks, JA Maddryz, MS Akhtar, JA Montgomeryz, JA Secrist III, J. Chattopadhyayal, Tetrahedron 1993, 49, 2287-2298). However, there is no report that such artificial nucleic acid functions as a template for DNA synthase (A. Shivalingam, AES Tyburn, AH El-Sagheer, T. Brown, J. Am. Chem. Soc. 2017, 139, 1575). -1583).

The present invention preferably includes the following aspects.
[1] Formula I:

[Where,
B ¹ and B ² represent the same or different nucleobases;
R ¹ is represented by formula II:

(Where
m represents an integer of 0 or more;
B ^m represents the same or different nucleobase corresponding to each integer of m; and X represents a hydrogen atom, a phosphate group, a pyrophosphate group, or a triphosphate group)
And R ² is a compound of formula III:

(Where
n represents an integer of 0 or more, provided that m and n cannot be 0 at the same time; and B ⁿ represents the same or different nucleobase corresponding to each integer of n)
It is a compound represented by
A method of synthesizing oligodeoxynucleotides with a DNA synthase using a compound having a sulfonamide skeleton represented by

[2] The method further includes a method of synthesizing the compound represented by Formula I, wherein Formula IV:

[Where,
B ¹ and R ¹ are as defined in Formula I)
And a compound of formula V:

[Where,
B ² and R ² are as defined in Formula I; and Y represents an azolyl group]
The method as described in said [1] including the step with which the compound represented by these is made to react.

[3] The method further includes a method of synthesizing the compound represented by Formula V, wherein Formula IV:

[Where,
Y represents an azolyl group;
Z represents a nucleobase which may have a protecting group;
R ³ represents a protecting group for phosphoric acid;
R ⁴ and R ⁵ are the same or different and represent a linear or branched alkyl group having 1 to 6 carbon atoms, or R ⁴ and R ⁵ are directly bonded to form a ring, or an oxygen atom, A ring may be formed by bonding via one or more atoms from the group consisting of a sulfur atom and a silicon atom)
The method according to the above [2], comprising a step of synthesizing using a nucleic acid solid phase synthesis method or a liquid phase synthesis method by a phosphoramidite method using a compound represented by the formula:

[4] Formula V:

[Where,
R ² and B ² are as defined in Formula I; and Y represents an azolyl group.
To produce a compound of formula VI:

[Where,
Y represents an azolyl group;
Z represents a nucleobase which may have a protecting group;
R ³ represents a protecting group for phosphoric acid;
R ⁴ and R ⁵ are the same or different and represent a linear or branched alkyl group having 1 to 6 carbon atoms, or R ⁴ and R ⁵ are directly bonded to form a ring, or an oxygen atom, A ring may be formed by bonding via one or more atoms from the group consisting of a sulfur atom and a silicon atom)
A compound represented by

According to the present invention, a long-chain natural oligodeoxynucleotide (ODN) can be synthesized by providing an oligodeoxynucleotide (ODN) having a sulfonamide bonded to a non-natural internucleotide.

FIG. 1 shows an anion exchange HPLC chart after purification of template (S). FIG. 2 shows the result of analyzing the reaction product after electrophoresis with 20% PAGE after the complete chain length extension reaction using the Klenow fragment exo ⁻ . Lane 1: primer DNA 1; lane 2: primer DNA 1 + template (P); lane 3: primer DNA 1 + template (S). FIG. 3 shows the result of analyzing the reaction product after electrophoresis with 20% PAGE after the complete chain length extension reaction using the Klenow fragment exo ⁻ . Lane 1: primer DNA 1; lane 2: primer DNA 1 + template (P); lane 3: primer DNA 1 + template (S). FIG. 4 shows the reaction product analyzed by 20% PAGE after a full chain length extension reaction using exTaq (Takara), KOD '(Toyobo), Deep vent (New England Bio Labs) as a thermostable DNA synthase. Results are shown. Lane 1: primer DNA 1; lane 2: primer DNA 1 + template (P) + exTaq; lane 3: primer DNA 1 + template (S) + exTaq; lane 4: primer DNA 1 + template (P) + KOD ′; lane 5: primer DNA 1 + template (S) + KOD '; Lane 6: Primer DNA1 + Template (P) + Deep vent; Lane 7: Primer DNA1 + Template (S) + Deep vent. FIG. 5 shows the result of analyzing the reaction product after electrophoresis with 20% PAGE after a single base extension reaction using the Klenow fragment exo ⁻ . Lane 1: Primer DNA2; Lane 2: Primer DNA2 + Template (S) + dATP, 1 minute; Lane 3: Primer DNA2 + Template (S) + dGTP, 1 minute; Lane 4: Primer DNA2 + Template (S) + dTTP, 1 minute; Lane 5 : Primer DNA2 + Template (S) + dCTP, 1 minute; Lane 6: Primer DNA2 + Template (S) + dATP, 2 minutes; Lane 7: Primer DNA2 + Template (S) + dGTP, 2 minutes; Lane 8: Primer DNA2 + Template (S) + dTTP 2 minutes; Lane 9: Primer DNA2 + Template (S) + dCTP, 2 minutes; Lane 10: Primer DNA2 + Template (S) + dATP, 5 minutes; Lane 11: Primer DNA2 + Template Preparative (S) + dGTP, 5 minutes; lane 12: Primer DNA 2 + template (S) + dTTP, 5 min; Lane 13: Primer DNA 2 + template (S) + dCTP, 5 minutes.

According to the present invention, the following formula I:

[Wherein B ¹ and B ² represent the same or different nucleobases, and R ¹ and R ² represent nucleotides or nucleosides as described later]
An oligodeoxynucleotide (ODN) can be synthesized by a DNA synthase using a compound having a sulfonamide skeleton represented by

As used herein, the term “nucleobase” refers to a moiety in a deoxyribonucleotide other than a deoxyribose moiety and a 3′- or 5′-phosphate moiety, or a moiety in a deoxyribonucleoside other than a deoxyribose moiety. Say. Specifically, the nucleobase can be adenine, guanine, thymine, or cytosine.

R ^{1 in} formula I may be an oligodeoxynucleotide composed of zero or one or more nucleotide units. Typically R ¹ is of formula II:

(Where
m represents an integer of 0 or more, provided that m is not 0 when R is 0 in R ² in formula III described later;
B ^m represents the same or different nucleobase corresponding to each integer of m; and X represents a hydrogen atom, a phosphate group, a pyrophosphate group, or a triphosphate group)
The compound represented by these may be sufficient.

“M” is typically an integer from 0 to 1,000,000 and is not limited to 0 to 500,000, 0 to 300,000, 0 to 200,000, 0 to 150,000, 0 to 100,000, 0 to 50,000, 0 to 30,000, 0 to 20,000, 0 to 10,000, 0 to 5,000, 0 to 3,000, 0 to 1,000, 0 to It may be 500, 0 to 300, 0 to 100, or the like.

“B ^m ” represents a nucleobase, but shall conform to the definition for “nucleobase” in formula I. For “representing the same or different nucleobase corresponding to each integer of m”, for example, when m is “5”, B ¹ to B ⁵ (5) are the same nucleobase. Meaning that it may be a nucleobase or may be an independently selected nucleobase.

R ^{2 in} Formula I may be an oligodeoxy (ribo) nucleotide composed of zero or one or more nucleoside units. Typically R ² is of formula III:

(Where
n represents an integer of 0 or more, provided that when m is 0 in R ¹ in Formula II described above, n is not 0;
B ⁿ represents the same or different nucleobase corresponding to each integer of n)
The compound represented by these may be sufficient.

“N” is typically an integer from 0 to 1,000,000, and is not limited to 0 to 500,000, 0 to 300,000, 0 to 200,000, 0 to 150,000, 0 to 100,000, 0 to 50,000, 0 to 30,000, 0 to 20,000, 0 to 10,000, 0 to 5,000, 0 to 3,000, 0 to 1,000, 0 to It may be 500, 0 to 300, 0 to 100, or the like.

“B ⁿ ” represents a nucleobase, but shall follow the definition for “nucleobase” in formula I. For “representing the same or different nucleobase corresponding to each integer of n”, for example, when m is “5”, B ¹ to B ⁵ (5) are the same nucleobase. Meaning that it may be a nucleobase or may be an independently selected nucleobase.

The above R ¹ and R ² are typically oligodeoxynucleotides, but methods for the synthesis and chemical modification of oligodeoxynucleotides are known to those skilled in the art, eg, Uhlmann, E., et. al., (1990), Chem. Rev., 90: 543; “Protocols for Oligonucleotides and Analogs” Synthesis and Properties & Synthesis and Analytical Techniques. ”S. Agrawal ed., Humana Press, Totowa, USA, 1993; Crooke, ST, et al. (1996) Annu. Rev. Pharmacol. Toxicol., 36: 107-129; and Hunziker, J., et al., (1995), Mod. Synth. Methods, 7: 331-417. Has been.

Furthermore, a template strand for oligodeoxynucleotide synthesized by DNA synthase can be prepared by linking R ¹ and R ² . According to the present invention, such a template chain is characterized by having a sulfonamide skeleton in the chain. For example, the following formula IV:

[Wherein B ¹ and R ¹ are as defined herein for Formula I, provided that m is not 0 when n is 0 in R ² in Formula V described below]
And the following formula V:

[Wherein B ² and R ² are as defined herein for formula I, except that when m is 0 in R ¹ in formula IV above, n is not 0; Represents an azolyl group)
In the compound represented by the formula, it can be provided by substituting an amine group and an azolyl group. The substitution reaction can be carried out by those skilled in the art by a well-known method. As used herein, an “azolyl group” is a saturated or unsaturated heterocyclic group having a hetero atom selected from the group consisting of a nitrogen atom, a sulfur atom, and an oxygen atom as a ring member atom. , One in which at least one of the different atoms is a nitrogen atom. Azolyl groups include, but are not limited to, imidazolyl, pyrazolyl, 1,2,3-triazolyl, 1,2,4-triazolyl, tetrazolyl, benzoimidazolyl, benzotriazolyl, and the like, and any carbon atom in the ring Those having a substituent are also included.

The method of the present invention synthesizes an oligodeoxynucleotide (ODN) with a nucleic acid synthase (eg, DNA synthase) and an appropriate primer using a compound having a sulfonamide skeleton represented by Formula I as a template strand (or Elongate). As used herein, “nucleic acid synthase” refers to any enzyme that has the ability to synthesize nucleic acids. A generic term for enzymes that catalyze the reaction of condensing nucleotides into polynucleotides. Examples of such nucleic acid synthase include, but are not limited to, DNA synthase (for example, DNA-dependent DNA synthase, RNA-dependent DNA synthase), RNA synthase, and the like. It should be understood that both DNA-dependent DNA synthase and RNA-dependent DNA synthase may be detected regardless of DNA or RNA. Examples of such DNA synthetase include, but are not limited to, Escherichia coli-derived DNA polymerase I, DNA polymerase I Klenow fragment, Taq polymerase, KLA-Taq polymerase, KOD polymerase, Vent polymerase, Pfu polymerase, T4 DNA polymerase, and the like. be able to. In addition, according to the present invention, a thermostable DNA synthase may be used in the extension reaction, and examples thereof include exTaq, Q5, KOD, KOD ', Deep vent and the like.

As used herein, “synthesizing” or “extending” an oligodeoxynucleotide refers to any reaction in which the nucleic acid extends at least one nucleotide when referring to the nucleic acid. When the extension reaction is performed using the polymerase as described above, since a nucleotide is usually introduced based on a template, a specific sequence is extended in a nucleic acid to be extended such as a nucleic acid to be labeled. The extension reaction consists of (i) hybridization (annealing) reaction between the target nucleic acid and its complementary strand and the nucleic acid primer and nucleic acid probe, and (ii) primer strand extension reaction and probe degradation reaction by nucleic acid synthase. Reactions (i) and (ii) can be carried out in an aqueous solution containing a suitable buffer such as, for example, Tris-HCl buffer. This hybridization reaction can typically be performed at 55-75 ° C, but is not limited. Enzymatic reactions can typically be performed at 37 ° C, but are not limited. The denaturation of the primer extension product can be carried out by, for example, subjecting the solution containing the primer chain extension product obtained by the extension reaction to a heat treatment at 94 to 95 ° C. for 0.5 to 1 minute. In the amplification of the target nucleic acid, for example, the above-described extension reaction and denaturation may be repeated a plurality of times under the same conditions as described above until the target nucleic acid (labeled nucleic acid) reaches a desired amount. If the above steps are performed n times, the target nucleic acid amount is theoretically amplified to 2n-1 times the original.

Extension reactions as described above are well known to those skilled in the art, such as Sambrook, J., E Fritsch, E. and T Maniatis, Molecular Cloning: A Laboratory Manual 3rd. ColdSpring Harbor Laboratory Press: Please refer to. Such an extension reaction can be carried out simply and efficiently by using a commercially available apparatus for PCR (polymerase chain reaction) (for example, sold by Applied Biosystems).

According to the present invention, the formula VI for synthesizing the above formula V:

[Where,
Y represents an azolyl group (as defined in formula V);
Z represents a nucleobase which may have a protecting group;
R ³ represents a protecting group for phosphoric acid;
R ⁴ and R ⁵ are the same or different and represent a linear or branched alkyl group having 1 to 6 carbon atoms, or R ⁴ and R ⁵ are directly bonded to form a ring, or an oxygen atom, A ring may be formed by bonding through one or more atoms from the group consisting of sulfur atom and silicon atom)
Is provided. In addition, the method of synthesizing the compound represented by the formula V using the compound represented by the compound VI is specifically described in Example 5 as described later.

With respect to “R ³ ” in Formula VI above, R ³ can be a protecting group for phosphoric acid, for example, a substituent that is eliminated by hydrogenolysis, elimination reaction, nucleophilic substitution reaction, or hydrolysis. Is preferred. Examples of such a protecting group may be a general protecting group for phosphoric acid as described in Greenes' Protective Groups in Organic Chemistry, Fifth edition (John Wiley & Sons, 2014), etc. Substituted on a benzene ring such as a methyl group, a trimethylsilylethyl group, an ethyl group having a substituent such as a 2-cyanoethyl group, a benzene ring such as a 2-nitrobenzyl group, or a naphthyl ring A substituent on a benzene ring such as a phenylethyl group and a 2-chlorophenyl group which may have a substituent on a benzene ring such as a naphthylmethyl group and a 4-nitrophenylethyl group which may have a group. The phenyl group which may have is mentioned. Also included are groups that have a nucleophilic group in the protecting group, such as a 4-methylthiobutyl group or N-formyl-N-methylaminoethyl group, and are deprotected while cyclizing.

Referring to “Z” in Formula VI above, Z represents a nucleobase that may have a protecting group. The protecting group herein is not limited as long as it is a protecting group that can be used for nucleic acid synthesis described in Current Protocols in Nucleic Acid Chemistry Unit2.1 “Nucleobase Protection of Deoxyribo- and Ribonucleosides” Iyer, R. P. Examples of such protection include acyl groups such as benzoyl group, acetyl group and isobutyryl group, and amidine type protecting groups such as N, N-dimethylaminomethylene group for the amino group of adenine, cytosine and guanine. It is done. Further, an acyl group such as a benzoyl group or a benzyl group may be introduced at the O4 position of thymine with respect to the imino group of thymine.

R ⁴ and R ⁵ may represent the same or different “linear or branched alkyl group having 1 to 6 carbon atoms”, for example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl Tert-butyl, pentyl, isopentyl, neopentyl, hexyl and the like.

R ⁴ and R ⁵ may be directly bonded to form a ring, and examples thereof include a pyrrolidine ring and a piperidine ring. On the other hand, when R ⁴ and R ⁵ form a ring, they may be bonded via one or more of an oxygen atom, a sulfur atom or a silicon atom, and examples thereof include a morpholine ring and a thiamorpholine ring. It is done.

Hereinafter, the present invention will be described more specifically based on examples. The present invention is not limited to these examples. Those skilled in the art can easily modify or modify the present invention based on the description in this specification.
Changes can be made and are within the scope of the invention.

The synthetic reagents and organic solvents used in this example were those purchased from Tokyo Chemical Industry, Wako Pure Chemical Industries, Kanto Chemical, and Sigma Aldrich unless otherwise specified.

[Raw Material Synthesis Example 1] Template (S): Synthesis of 3′-d (GTACCCGCCGTACCCGAA TT CCTCGCTCTT) -5 ′ (SEQ ID NO: 1) McElroy et al. (McElroy, EB; Bandaru, R .; Huang, J .; Widlanski , TS, Bioorg. Med. Chem. Lett. 1994, 4, 1071). “S” shown in the template name indicates sulfonamide, and “TT” underlined in the sequence indicates a thymidine dimer linked by sulfonamide.

X

Next, a template (S) was synthesized by an automatic DNA synthesizer (nS-8II; Gene Design) using a commercially available deoxynucleotide phosphoramidite (Glen Rsearch Inc.). After completion of the synthesis, deprotection and cleaving from the solid support were carried out in a tritylon state using 28% aqueous ammonia at 55 ° C. for 12 hours. Subsequently, the target product was fractionated by reverse phase HPLC. After separation, the mixture was charged into a reverse phase cartridge column (Sep-Pak C18 Plus Cartridge; Waters), DMTr group was removed on the cartridge with 2% aqueous trifluoroacetic acid solution, and then eluted with 25% acetonitrile / water. The eluted oligonucleotide was once again subjected to anion exchange HPLC (Gen-Pak ™ FAX (Waters, 4.6 × 150 mm) at a column temperature of 50 ° C. in 25 mM sodium phosphate buffer (pH 6.0) as an elution solvent, After purifying with 25 mM sodium phosphate buffer (pH 6.0 and flushed with a concentration gradient), desalting was performed. An anion exchange HPLC chart after purification of the template (S) is shown in FIG. MALDI—TOF-MS calcd. [M + H] ⁺ 9066.552, found 9067.649.

[Raw Material Synthesis Example 2]: Synthesis of 3'-O- (tert-butyldimethylsilyl) -5'-deoxy-5 '-(imidazolylsulfonylmethyl) thymidine (Compound XX)

XX

3'-O- (tert-butyldimethylsilyl) -5'-deoxy synthesized by the method of McElroy et al. (Huang, J .; McElroy, EB; Widlanski, TS, J. Org. Chem. 1994, 59, 3520) The sodium salt of -5′-sulfomethylthymidine (700 mg, 1.54 mmol) was dissolved in acetone (15 mL). 18-Crown-6-ether (20 mg, 0.077 mmol) and cyanuric chloride (424 mg, 2.31 mmol) were added thereto and reacted at 68 ° C. for 6 hours. Thereafter, imidazole (7.2 g, 133 mmol) was added and reacted at room temperature for 1 hour. The reaction system was filtered through celite, and the filtrate was concentrated under reduced pressure. After adding 5 g of silica gel to the residue, the mixture was allowed to stand on 30 g of silica gel, and the target product was eluted with 80% ethyl acetate-20% hexane. Fractions containing the desired product were concentrated to obtain 700 mg (94%) of compound XX.
¹ H NMR (500 MHz, CDCl3) δ 10.08 (s, 1H), 7.96 (s, 1H), 7.26 (s, 1H), 7.15 (s, 1H), 6.92 (s, 1H), 5.95 (t, J = 1.5 Hz, 1H), 4.14 (dd, J = 6.0, 5.0 Hz, 1H), 3.72-3.65 (m, 1H), 3.61-3.52 (m, 1H), 3.47-3.36 (m, 1H), 2.37- 2.27 (m, 1H), 2.24-2.13 (m, 1H), 2.13-2.03 (m, 1H), 2.00-1.87 (m, 1H), 1.90 (s, 3H), 0.83 (s, 9H), 0.03 ( s, 6H); 13C NMR (101 MHz, CDCl3) δ 163.99, 150.48, 137.07, 136.45, 131.46, 117.79, 111.60, 86.60, 83.19, 74.47, 52.68, 39.61, 26.70, 25.71, 17.91, 12.59, -4.55,- 4.80; ESI-TOF mass: calcd for C ₂₀ H ₃₂ N ₄ O ₆ SSi [M + Na] ⁺ 507.1704, found 507.1693.

[Raw Material Synthesis Example 3]: Synthesis of 5'-deoxy-5 '-(imidazolylsulfonylmethyl) thymidine (Compound XXX)

XXX

Compound XX (30 mg, 0.062 mmol) was dissolved in tetrahydrofuran (620 μL), 1M tetrabutylammonium fluoride tetrahydrofuran solution (68 μL, 0.068 mmol) was added, and the mixture was reacted at room temperature for 25 minutes. Acetic acid (3.9 μL 0.06 mmol) and trimethylethoxysilane (280 μL, 1.86 mmol) were added to the reaction system to stop the reaction. After 1 hour, 10 mL of ethyl acetate was added, and the mixture was washed 3 times with 2 mL of saturated aqueous sodium bicarbonate and once with 2 mL of saturated brine. The aqueous layer was extracted 3 times with 10 mL of ethyl acetate, and then the organic layers were collected and dried over anhydrous sodium sulfate. Sodium sulfate was removed by filtration, and the filtrate was concentrated under reduced pressure. The residue was charged onto 8 g of silica gel and eluted with 7% methanol / methylene chloride. Fractions containing the desired product were concentrated to give compound XXX (16 mg, 70%).
¹ H NMR (500 MHz, DMSO-d6) δ 11.32 (s, 1H), 8.19 (s, 1H), 7.68 (s, 1H), 7.37 (s, 1H), 7.18 (s, 1H), 6.09 (t , J = 7.0 Hz, 1H), 5.44-5.32 (br, 1H), 4.12-4.05 (m, 1H), 3.95-3.77 (m, 2H), 3.66-3.60 (m, 1H), 2.26-2.18 (m , 1H), 2.06-1.93 (m, 2H), 1.90-1.80 (m, 1H), 1.79 (s, 3H); 13C NMR (126 MHz, DMSO-d6) δ 163.67, 150.40, 137.26, 136.29, 130.60, 118.52, 109.94, 83.48, 82.98, 72.50, 51.43, 38.00, 26.49, 12.09; ESI-TOF mass: calcd for C ₁₄ H ₁₈ N ₄ O ₆ S [M + Na] ⁺ 393.0839, found 393.0832.

Example 1: Klenow fragment exo ^- with full length extension reaction the following primers and template were performed using complete chain extension reaction.
Primer DNA1: FAM-5′-d (CATGGGGCGCATGGGG) (SEQ ID NO: 2)
Template (P): 3′-d (GTACCCGCCGTACCCGAGATCTCCTCGCTTT) -5 ′ (SEQ ID NO: 1) (“P” refers to phosphodiester)
Template (S): 3′-d (GTACCCGCCGTACCCGAA TT CCTGCTGCTT) -5 ′ (SEQ ID NO: 1)
(" TT " in sequence indicates thymidine dimer linked by sulfonamide)

Primer DNA1, template (P) or template (S), dNTP (N = A, T, G, C) are dissolved in 10 μL of Klenow fragment exo ⁻ buffer attached to a commercially available enzyme, and Klenow fragment exo ⁻ ( (New England Bio Labs) was added, and the reaction was performed at 37 ° C. for 30 minutes. The final concentration of the added material is as follows.
Primer DNA 0.1 μM
Template (P) or Template (S) 0.1 μM
dNTP (N = A, T, G, C) 10 μM each
Klenow fragment exo ^- 0.025 U / μL

After completion of the reaction, the reaction solution was electrophoresed with 20% PAGE containing 7M urea to analyze the reaction product. The results are shown in FIG. As shown in FIG. 2, it can be seen that the extension reaction was successfully performed by using template (P) (lane 2) and template (S) (lane 3). Looking at lane 3, the phosphodiester and -1mer bands were also detected, but a completely extended band was detected as in lane 2.

Example 2: Full length extension reaction using Klenow fragment exo ⁺ Primer DNA1, template (P) or template (S), dNTP (N = A, T, G, C) used in Example 1 are commercially available It melt | dissolved in 10 microliters of Klenow fragment | piece exo ⁺ buffer attached to the enzyme, Klenow fragment | piece exo ⁺ (Takara) was added, and reaction was performed at 37 degreeC for 30 minutes. The final concentration of the added material is as follows.
Primer DNA 0.1 μM
Template (P) or Template (S) 0.1 μM
dNTP (N = A, T, G, C) 10 μM each
Klenow fragment exo ⁺ 0.025 U / μL

After completion of the reaction, the reaction solution was electrophoresed on 20% PAGE containing 7M urea, and the reaction product was analyzed. The results are shown in FIG. As shown in FIG. 3, it can be seen that the extension reaction was successfully performed by using template (P) (lane 2) and template (S) (lane 3). Since exo ⁺ with proofreading activity was able to synthesize the full length, the nucleotide synthesis introduced at the position of the sulfonamide template was not mistaken for misincorporation and cut out, and DNA synthesis was extended to the end I understand.

Example 3: Full chain length extension reaction using thermostable DNA synthase The primer DNA, template (P) or template (S), and dNTP (N = A, T, G, C) used in Example 1 are commercially available. Was dissolved in 10 μL of the recommended buffer attached to the enzyme, and a thermostable enzyme was added, followed by reaction at 50 ° C. for 30 minutes. The final concentration of the added material is as follows.
Plate DNA 0.1 μM
Template (P) or Template (S) 0.1 μM
dNTP (N = A, T, G, C) 10 μM each
Enzyme 0.025 U / μL

For exTaq (lane 3), KOD '(lane 5), and vent (lane 7), the same product was obtained in template (P) and template (S).

Example 4 Single Base Extension Reaction Using Klenow Fragment exo ^{− A} single base extension reaction was performed using the following primers and template.
Primer DNA2: FAM-5′-d (CATGGGGCGCATGGGCTT) (SEQ ID NO: 3)
Template (P): 3′-d (GTACCCGCCGTACCCCGAATTCCTGTCGCTT) -5 ′ (SEQ ID NO: 1)
Template (S): 3′-d (GTACCCGCCGTACCCGAA TT CCTGCTGCTT) -5 ′ (SEQ ID NO: 1)

Primer DNA2, template (P) or template (S), and dNTP (N = A, T, G, or C) are dissolved in 10 μL of Klenow fragment exo-buffer attached to a commercially available enzyme. , Klenow fragment exo ⁻ was added, and the reaction was carried out at 37 ° C. for 1 to 5 minutes. The final concentration of the added material is as follows.
Primer DNA 0.1 μM
Template (P) or Template (S) 0.1 μM
dNTP (N = A, T, G, or C) 1 μM
Klenow fragment exo ^- 0.01 U / μL

After completion of the reaction, the reaction solution was electrophoresed on 20% PAGE containing 7M urea, and the reaction product was analyzed. The results are shown in FIG. As shown in FIG. 5, chain extension was confirmed only when dATP capable of forming Watson-Crick base pairing with thymine in TT of template (S) was added.

Example 5: Synthesis of 5'-deoxy-5 '-(imidazolylsulfonylmethyl) thymidine 3'-(2-cyanoethyl N, N-diisopropyl phosphoramidite) (Compound XXXX)

XXXX

Compound XXX (30 mg, 0.062 mmol) was dissolved in tetrahydrofuran (620 μL), 1M tetrabutylammonium fluoride tetrahydrofuran solution (68 μL, 0.068 mmol) was added, and the mixture was reacted at room temperature for 25 minutes. Acetic acid (3.9 μL, 0.06 mmol) and trimethylethoxysilane (280 μL, 1.86 mmol) were added to the reaction system to stop the reaction. After 1 hour, 10 mL of ethyl acetate was added, and the mixture was washed 3 times with 2 mL of saturated aqueous sodium bicarbonate and once with 2 mL of saturated brine. The aqueous layer was extracted 3 times with 10 mL of ethyl acetate, and then the organic layers were collected and dried over anhydrous sodium sulfate. Sodium sulfate was removed by filtration, and the filtrate was concentrated under reduced pressure. The residue was charged with 8 g of silica gel and eluted with 7% methanol / methylene chloride. Fractions containing the desired product were concentrated to give compound XXX (16 mg, 70%).
¹ H NMR (500 MHz, CDCl3) δ 9.95-9.65 (br, 1H), 8.00-7.93 (m, 1H), 7.35-7.27 (m, 1H), 7.15 (s, 1H), 6.96 (s, 1H) , 6.10-6.01 (m, 1H), 4.36-4.26 (m, 1H), 3.94-3.76 (m, 3H), 3.71-3.63 (m, 1H), 3.61-3.38 (m, 4H), 2.77-2.54 ( m, 2H), 2.46-2.29 (m, 2H), 2.27-2.10 (m, 1H), 2.07-1.96 (m, 1H), 1.95-1.81 (m, 3H), 1.18-1.08 (m, 12H); 13C NMR (101 MHz, CDCl3) δ 163.87, 150.51, 150.46, 137.12, 137.04, 136.28, 135.95, 131.44, 131.35, 118.01, 117.90, 117.87, 117.80, 111.83, 111.81, 85.96, 85.84, 82.30, 82.26, 81.96, 81.89 , 75.79, 75.64, 75.58, 75.43, 58.01, 57.92, 57.81, 57.73, 52.65, 52.60, 43.45, 43.41, 43.33, 43.29, 38.26, 38.20, 26.85, 26.82, 24.67, 24.61, 24.54, 20.57, 20.53, 20.50, 20.45 , 12.51, 12.49; 31P NMR (203 MHz, CDCl3): δ 149.4, -148.7; ESI-TOF mass: calcd for C ₂₃ H ₃₅ N ₆ O ₇ PS [M + Na] ⁺ 593.1918, found 593.1905

Claims

Formula I:

[Where,
B 1 and B 2 represent the same or different nucleobases;
R 1 is represented by formula II:

(Where
m represents an integer of 0 or more;
B m represents the same or different nucleobase corresponding to each integer of m; and X represents a hydrogen atom, a phosphate group, a pyrophosphate group, or a triphosphate group)
And R 2 is a compound of formula III:

(Where
n represents an integer of 0 or more, provided that m and n cannot be 0 at the same time; and B n represents the same or different nucleobase corresponding to each integer of n)
It is a compound represented by
A method of synthesizing oligodeoxynucleotides with a DNA synthase using a compound having a sulfonamide skeleton represented by
The method further includes a method of synthesizing the compound represented by Formula I, wherein Formula IV:

[Where,
B 1 and R 1 are as defined in Formula I)
And a compound of formula V:

[Where,
B 2 and R 2 are as defined in Formula I; and Y represents an azolyl group]
The method of Claim 1 including the process with the compound represented by these.
The method further includes a method of synthesizing the compound represented by Formula V, wherein Formula VI:

[Where,
Y represents an azolyl group;
Z represents a nucleobase which may have a protecting group;
R 3 represents a protecting group for phosphoric acid;
R 4 and R 5 are the same or different and represent a linear or branched alkyl group having 1 to 6 carbon atoms, or R 4 and R 5 are directly bonded to form a ring, or an oxygen atom, A ring may be formed by bonding via one or more atoms from the group consisting of a sulfur atom and a silicon atom)
The method of Claim 2 including the step of synthesize | combining using the nucleic acid solid-phase synthesis method or liquid phase synthesis method by the phosphoramidite method using the compound represented by these as a starting material.
Formula V:

[Where,
R 2 and B 2 are as defined in Formula I; and Y represents an azolyl group.
To produce a compound of formula VI:

[Where,
Y represents an azolyl group;
Z represents a nucleobase which may have a protecting group;
R 3 represents a protecting group for phosphoric acid;
R 4 and R 5 are the same or different and represent a linear or branched alkyl group having 1 to 6 carbon atoms, or R 4 and R 5 are directly bonded to form a ring, or an oxygen atom, A ring may be formed by bonding via one or more atoms from the group consisting of a sulfur atom and a silicon atom)
A compound represented by