CN110305827B - Recombinant bacterium for high-yield hyaluronic acid and construction method and application thereof - Google Patents
Recombinant bacterium for high-yield hyaluronic acid and construction method and application thereof Download PDFInfo
- Publication number
- CN110305827B CN110305827B CN201910495504.8A CN201910495504A CN110305827B CN 110305827 B CN110305827 B CN 110305827B CN 201910495504 A CN201910495504 A CN 201910495504A CN 110305827 B CN110305827 B CN 110305827B
- Authority
- CN
- China
- Prior art keywords
- gene
- recombinant bacterium
- hyaluronic acid
- recombinant
- pdapb
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01022—UDP-glucose 6-dehydrogenase (1.1.1.22)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/01212—Hyaluronan synthase (2.4.1.212)
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a recombinant bacterium for high-yield hyaluronic acid and a construction method and application thereof in the technical field of genetic engineering. The recombinant strain is constructed by enhancing expression of UDP-glucose dehydrogenase gene in a hyaluronic acid synthesis way and weakening a competition way. The corynebacterium glutamicum host disclosed by the invention is nonpathogenic to human and animals and is a food-grade safe microorganism; the recombinant corynebacterium glutamicum for high-yield hyaluronic acid has high hyaluronic acid yield of over 28g/L, and the new strain has good industrial application prospect.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a recombinant bacterium for high-yield hyaluronic acid, a construction method and application thereof.
Background
Hyaluronic Acid (HA) is a glycosaminoglycan widely present in human and animal bodies, and its molecules are linear, and its repeating unit is composed of D-glucuronic acid (GlcA) and N-acetyl-glucosamine (N-acetyl-D-glucosamine, GlcNAc) disaccharide unit, and its molecular weight can be up to 104～107Da. HA plays a role in lubrication of soft tissues, promotion of wound healing, participation in immune response and the like in a human body. HA is also widely available commercially. High molecular weight HA can be used as a bulking agent in clinical surgery; the HA with medium molecular weight is used in the fields of cosmetics and skin care products; the small molecular HA can be made into oral health products to supplement sugar amine and sugar acid required by human body, enhance metabolism and delay aging.
With the rapid development of biotechnology, the production method of hyaluronic acid has gradually changed from animal tissue extraction to microbial fermentation. At present, HA production strains in China are mainly streptococcus zooepidemicus, and the yield of the HA production strains can reach 10 g/L. Technology for producing HA by streptococci is also continuously studied abroad (Pourzardosht, N., Rasae, M.J.,2017.Improved Yield of High Molecular Weight Hyaluronic Acid Production in a Stable Strain of Streptococcus zoepidemicus virus a the infection of the Hyaluronic Acid-Encoding Gene. mol. Biotechnol.59, 192-199.) but streptococci themselves are potentially pathogenic, which limits their development to some extent. On the other hand, the culture medium for culturing streptococcus contains expensive raw materials such as serum and brain heart extract, and the production cost is increased accordingly. The development of safer, more economical and practical recombinant strains has been increasingly appreciated
Chinese patent ZL 98812773.3 discloses a hyaluronic acid synthetase gene and application thereof in 2001, and the hyaluronic acid synthetase gene is introduced into recombinant bacteria, so that the heterologous synthesis of hyaluronic acid can be realized. Novozyme of Denmark reforms the HA synthesis pathway in Bacillus subtilis and applied for the Chinese patent "production of low molecular weight hyaluronic acid" (CN 101384724). The university in south of the Yangtze river further utilizes a metabolic engineering means to construct recombinant bacillus subtilis (CN105087456A) producing hyaluronic acid with different molecular weights. Kaur et al achieved HA synthesis in Lactococcus lactis with yields of 3.03g/L (Kaur, m., Jayaraman, g.,2016. hydralonan production and molecular weight is engineered in path-engineered strains of lactate dehydrogenase-specific Lactococcus lactis. metal. eng. com.3, 15-23).
Corynebacterium glutamicum (Corynebacterium glutamicum) is a type of aerobic bacteria, with cells in the form of short rods or small rods, gram-positive, and GRAS (generally recognized as safe) strains recognized by the U.S. video drug administration. The corynebacterium glutamicum does not produce any endotoxin and exotoxin per se, and is very suitable for producing products with food safety level and medical safety level. The recombinant corynebacterium glutamicum for producing HA is successfully constructed in 2014 by Huimin et al, and the yield reaches more than 6.0g/L (CN 103937734A); in 2017, the synthesis pathway of the byproduct lactic acid is knocked out in the recombinant Corynebacterium glutamicum for producing HA, so that the yield is increased to over 22g/L (CN 107354119A). Chenzhen et al constructed a recombinant strain that produced small HA molecules by knocking out pentose phosphate pathway in recombinant Corynebacterium glutamicum to achieve a medium hyaluronic acid yield of 9.6g/L (CN 106190939A).
Disclosure of Invention
The invention aims to provide a recombinant bacterium (or a genetic engineering bacterium) for high-yield hyaluronic acid, which is obtained by transferring a gene containing hyaluronic acid synthase and UDP-glucose dehydrogenase into corynebacterium glutamicum and enhancing the expression of the UDP-glucose dehydrogenase.
In the recombinant bacteria, the hyaluronic acid synthase gene can be shasA, the UDP-glucose dehydrogenase can be CgHasB, and the gene can be Cg10360 (or CgHasB), as shown in chinese patent CN 103937734A.
In the recombinant bacterium, the expression level of the fructose bisphosphate aldolase gene can be optionally reduced.
In the recombinant bacterium, the expression level of the pyruvate dehydrogenase gene can be optionally reduced.
In the recombinant bacteria, the method for reducing the expression quantity is gene knockout, mutation or introduction of antisense RNA.
In the recombinant bacteria, the UDP-glucose dehydrogenase gene is enhanced to be expressed by placing the UDP-glucose dehydrogenase gene under the control of two promoters, for example, one of the two promoters is PdapB, PdapA, Psod or Ptac.
In the recombinant bacterium, the lactate dehydrogenase gene of the recombinant bacterium is inactivated.
In the recombinant bacteria, the method for inactivating the lactate dehydrogenase gene can be selected from gene knockout, and the method for knocking out can be selected from the method in Chinese patent CN 107354119A.
Among the above recombinant bacteria, Corynebacterium glutamicum ATCC13032 can be selected.
The invention also aims to provide application of the recombinant bacterium in preparing hyaluronic acid.
The invention also aims to provide a construction method of the recombinant bacterium for high-yield hyaluronic acid, which comprises the following steps:
(1) transferring a gene containing hyaluronic acid synthase and UDP-glucose dehydrogenase into corynebacterium glutamicum, for example, transferring the gene by using a recombinant vector method in Chinese patent CN103937734A, putting the UDP-glucose dehydrogenase gene under the control of two promoters for expression, and inactivating the recombinant lactic dehydrogenase gene;
or a further alternative to the above-described method,
(2) the expression level of fructose diphosphate aldolase gene is reduced;
or a further alternative to the above-described method,
(3) the expression level of pyruvate dehydrogenase gene is reduced.
In the above construction method, the method for down-regulating the expression level of the fructose bisphosphate aldolase gene or the pyruvate dehydrogenase gene comprises: introducing antisense RNA expression cassette fragments and/or gene mutations; the method for inactivating the lactic acid dehydrogenase gene of the bacteria is gene knockout, for example, the method selected from Chinese patent CN 107354119A.
The method of gene mutation may select the start codon mutation.
A construction method of a recombinant bacterium for high-yield hyaluronic acid is specifically characterized by comprising the following steps:
a method for enhancing the expression level of UDP-glucose dehydrogenase gene (CghasB) of Corynebacterium glutamicum, which comprises the following steps: that is, CghasB gene is put under two promoters to express on the basis of the expression plasmid described in Chinese patent CN 103937734A. For example, one promoter is the Ptac promoter contained in plasmid PXMJ19, and the other promoter can be derived from the genome of Corynebacterium glutamicum, such as the promoter of the 4-hydroxytetrahydropyridine reductase gene (dapB), or the Ptac promoter can be used. The specific construction method comprises the following steps:
and (3) carrying out PCR reaction and purification by taking the genome of corynebacterium glutamicum as a template and PdapB-F and PdapB-R as primers, and amplifying a promoter fragment of the dapB gene. Plasmid PXMJ19-AB (Chinese patent CN103937734A) was digested with KpnI in a single enzyme. And carrying out Gibson ligation reaction on the enzyme digestion product and the dapB promoter fragment to obtain the recombinant plasmid PXMJ 19-A-PdapB-B. In this plasmid, the gene shasA is transcribed by the Ptac promoter, and the gene CghasB is transcribed by both the Ptac promoter and the PdapB promoter. The primer sequences used were as follows:
PdapB-F：CTGTAAGGATCCCCGGGTACCCGCGTGAACGTTTCGTGC；
PdapB-R：TATGTGTCCTCCTTTGGTACCTATGCTCCTTCATTTTCGTGG。
further, the recombinant plasmid PXMJ19-A-PdapB-B was transformed into Corynebacterium glutamicum C.glu- Δ LDH inactivated by Lactate Dehydrogenase (LDH) using an electrotransformation method (Chinese patent CN107354119A), an LB plate (containing chloramphenicol) was coated, resistant clones were selected for culture, and PCR was performed to verify, and a recombinant strain C.glu- Δ LDH/A-PdapB-B transformed with the plasmid PXMJ19-A-PdapB-B was obtained.
The method for preparing hyaluronic acid by recombinant bacteria can select:
(1) inoculating C.glu-delta ldh/AB and C.glu-delta ldh/A-PdapB-B into an LB liquid culture medium for culture to obtain a genetic engineering bacteria liquid;
(2) inoculating the obtained genetically engineered bacterium liquid into a fermentation culture medium according to the volume percentage of 1-20%, culturing for 1-5h, adding an inducer, and continuously culturing to obtain fermentation liquid containing hyaluronic acid.
The fermentation medium comprises the following components: 20-100g/L of saccharide, 10-50g/L of inorganic nitrogen source, 2-40g/L of organic nitrogen source and KH2PO4 0.1-5g/L，K2HPO4·12H2O 0.5-5g/L，MgSO4·7H2O 0.1-8g/L，MnSO4·H2O 0.002-0.1g/L，FeSO4·7H2O 0.002-0.1g/L g/L，pH 6.0-8.0。
The culture conditions in the step (1) are as follows: the temperature is 25-40 ℃, the rotating speed is 100-; the culture conditions in the step (2) are as follows: the temperature is 25-40 ℃, the rotation speed is 100-.
In the step (2), the inducer is isopropyl thiogalactoside or lactose, and the addition amount is 0.05-5.0 g/L.
The saccharide in the fermentation culture medium is glucose, sucrose, fructose, maltose, starch or starch hydrolysate; the inorganic nitrogen source is ammonium sulfate, ammonium chloride, ammonium nitrate, sodium nitrate or potassium nitrate; the organic nitrogen source is peptone, yeast extract, yeast powder, beef extract, corn steep liquor powder or soybean powder.
Furthermore, a method for down-regulating the expression level of fructose bisphosphate aldolase gene (fba) in Corynebacterium glutamicum can be selected to attenuate the glycolytic pathway and enhance HA synthesis.
The method is to introduce an antisense RNA (aF) expression cassette fragment of the gene fba into the recombinant plasmid PXMJ 19-A-PdapB-B.
The specific construction method comprises the following steps:
and (2) carrying out PCR reaction and purification by taking the genome of Corynebacterium glutamicum as a template and aF-F and aF-R as primers, and amplifying an antisense RNA fragment of fba gene (shown as SEQ ID NO.1 in a sequence table). Plasmid PXMJ19 was double digested with SalI/Ecori. The digested product and the antisense RNA fragment of fba gene were subjected to Gibson ligation reaction to obtain an expression cassette plasmid containing fba gene antisense RNA transcribed from Ptac promoter. And carrying out PCR reaction by taking the plasmid as a template and taking PaFT-F and PaFT-R as primers, purifying, and amplifying the expression cassette of fba gene antisense RNA. Plasmid PXMJ19-A-PdapB-B was digested with MauBI alone. And carrying out Gibson ligation reaction on the enzyme digestion product and an expression cassette of fba gene antisense RNA to obtain a plasmid PXMJ 19-A-PdapB-B-aF. The primer sequences used were as follows:
aF-F：CTTGCATGCCTGCAGGTCGACATTTCGAGGTTCTCGTCGATTGG；
aF-R：AAAACAGCCAAGCTGAATTCCTCCACCGGTGGTGCAGA；
PaFT-F：CGCTTCGCCTTCGCGCGCGTAAATCACTGCATAATTCGTGTCGC；
PaFT-R：TCAGCTTGCAATTCGCGCGCGTGTAGAAACGCAAAAAGGCCA。
further, the recombinant plasmid PXMJ19-A-PdapB-B-aF is transferred into C.glu-delta ldh by using an electrotransformation method, an LB plate (containing chloramphenicol) is coated, resistant clones are selected for culturing, and PCR verification is carried out to obtain the genetically engineered bacterium C.glu-delta ldh/A-PdapB-B-aF transformed with the PXMJ19-A-PdapB-B-aF plasmid.
Furthermore, a method for reducing the expression level of the pyruvate dehydrogenase gene (aceE) can be selected to weaken the tricarboxylic acid cycle and strengthen the HA synthesis.
The method is to introduce an antisense RNA (aE) expression cassette fragment of gene aceE on a recombinant plasmid PXMJ19-A-PdapB-B-aF, or further mutate the initiation codon ATG of aceE on a genome to GTG.
The specific construction method comprises the following steps:
the genome of Corynebacterium glutamicum is used as a template, aE-F and aE-R are used as primers to carry out PCR reaction and purification, and the antisense RNA fragment of aceE gene is amplified (shown as SEQ ID NO.2 in a sequence table). Plasmid PXMJ19 was double digested with SalI/Ecori. The enzyme digestion product and the antisense RNA fragment of the aceE gene are subjected to Gibson ligation reaction to obtain an expression cassette plasmid containing the aceE gene antisense RNA transcribed by the Ptac promoter. And carrying out PCR reaction and purification by taking the plasmid as a template and the PaET-F and PaET-R as primers to amplify the expression cassette of aceE gene antisense RNA.
Plasmid PXMJ19-A-PdapB-B-aF was digested with XhoI in a single enzyme. And carrying out Gibson ligation reaction on the enzyme digestion product and an expression cassette of aceE gene antisense RNA to obtain a plasmid PXMJ 19-A-PdapB-B-aF-aE. The primer sequences used were as follows:
aE-F：CTTGCATGCCTGCAGGTCGACAGACCCATGGACACAGTTGGG；
aE-R：AAAACAGCCAAGCTGAATTCGCGTTACCGTCGTTGGATTCG；
PaET-F：TTCCCTTTTTTGCGGCATTTAAATCACTGCATAATTCGTGTCGC；
PaET-R：GAGCAAAAACAGGAAGGCAATGTAGAAACGCAAAAAGGCCA。
on the other hand, the genome of Corynebacterium glutamicum is used as a template, aEG-up-F and aEG-up-R are used as primers to carry out PCR reaction and purification, and the upstream fragment of aceE gene is amplified; and (3) carrying out PCR reaction by using aEG-down-F and aEG-down-R as primers, purifying, and amplifying the aceE gene downstream segment. Plasmid PK18mobsacB was double digested with XbaI/Ecori. And carrying out Gibson ligation reaction on the enzyme digestion product and upstream and downstream fragments of the aceE gene to obtain PK 18-aEG. Recombinant plasmid PK18-aEG was transformed into C.glu-. DELTA.ldh using an electrotransformation method, LB plate (containing kanamycin) was spread, resistant clones were picked up and cultured, and PCR was performed for verification. The positive clones were plated on LB plates containing 150g/L for secondary screening. And (4) screening out a strain with the initiation codon mutated into GTG through sequencing to obtain C.glu-delta ldh-aEG. The primer sequences used were as follows:
aEG-up-F：CTATGACCATGATTACGAATTCATCACATCTCGCGGGAAACT；
aEG-up-R：GATCGGCCACTTCCACACCT；
aEG-down-F：AGGTGTGGAAgTGGCCGATC；
aEG-down-R：TGCCTGCAGGTCGACTCTAGATGATGGCTGCGTTCCAGC。
further, the recombinant plasmid PXMJ19-A-PdapB-B-aF-aE was transferred into C.glu- Δ ldh-aEG using an electrotransformation method, an LB plate (containing chloramphenicol) was coated, resistant clones were selected for culture, and PCR was performed to verify, thereby obtaining genetically engineered bacteria C.glu- Δ ldh-aEG/A-PdapB-B-aF-aE transformed with the plasmid PXMJ 19-A-PdapB-B-aF-aE.
The invention has the beneficial effects that: the invention adopts molecular biology method and technology, and through metabolic engineering regulation strategy, on the basis of knocking out byproduct lactic acid synthesis pathway, HA synthesis pathway is strengthened, glycolysis pathway and tricarboxylic acid cycle are weakened, and the recombinant corynebacterium glutamicum with high hyaluronic acid yield is constructed. The corynebacterium glutamicum host disclosed by the invention is nonpathogenic to human and animals, is a food-grade safe microorganism, has high hyaluronic acid yield, is fed for fermentation culture in a fermentation tank, has the yield of over 28g/L, and is the highest level of the existing industrial production; the new strain has good industrial application prospect.
Drawings
FIG. 1 shows PCR validation of additional promoters used to enhance CghasB: wherein, lane M is a DNA molecular weight standard; lane 1 is a control without additional promoter; lane 2 is the PdapA promoter; lane 3 is the PdapB promoter; lane 4 is the Psod promoter; lane 5 is the Ptac promoter.
FIG. 2 shows HA production and CghasB relative expression in shake flask fermentations for C.glu- Δ ldh/AB, C.glu- Δ ldh/A-PdapA-B, C.glu- Δ ldh/A-PdapB-B, C.glu- Δ ldh/A-Psod-B, and C.glu- Δ ldh/A-Ptac-B.
FIG. 3 shows HA production and fba relative expression in shake flask fermentations for C.glu- Δ ldh/A-Ptac-B and C.glu- Δ ldh/A-Ptac-B-aF.
FIG. 4 shows the sequencing result of the aceE initiation codon ATG mutated to GTG.
FIG. 5 shows the HA production and pyruvate dehydrogenase relative enzyme activity in shake flask fermentations for C.glu- Δ ldh/A-Ptac-B-aF, C.glu- Δ ldh-aEG/A-Ptac-B-aF, C.glu- Δ ldh/A-Ptac-B-aF, and C.glu- Δ ldh-aEG/A-Ptac-B-aF-aE.
FIG. 6 shows the time-dependent changes in HA production and dry weight of cells during HA production by feeding culture of recombinant strain C. glu- Δ ldh-aEG/A-PdapB-B-aF-aE in 5L fermentation.
FIG. 7 shows the HA yields of recombinant C.glu-. DELTA.ldh/AB, C.glu-. DELTA.ldh/A-PdapB-B-aF and C.glu-. DELTA.ldh-aEG/A-PdapB-B-aF-aE in shake flask fermentation, and C.glu-. DELTA.ldh-aEG/A-PdapB-B-aF-aE in fermenter fed fermentation.
Detailed Description
The invention is further described with reference to the following figures and specific examples. The biochemical reagents used in the examples are all commercially available reagents, and the technical means used in the examples are conventional means in the books of those skilled in the art, unless otherwise specified.
Example 1 construction of CghasB-enhanced expression strains and comparison of HA-producing capacities thereof
In order to enhance the expression of the key enzyme gene CghasB in the synthesis of Corynebacterium glutamicum HA, the embodiment is modified on the basis of the recombinant plasmid PXMJ19-AB (see Chinese patent CN103937734A), that is, an additional promoter is inserted between the genes shasA and CghasB, so that CghasB can be transcribed by the Ptac promoter and the additional promoter simultaneously. In this example, the additional promoters were selected from PdapB (promoter of 4-hydroxytetrahydropyridine reductase gene), PdapA (promoter of dihydropicoline synthase gene), Psod (promoter of superoxide dismutase gene) and Ptac promoters. Taking PdapB as an example, the construction method of the recombinant plasmid is as follows:
and (3) carrying out PCR reaction and purification by taking the genome of corynebacterium glutamicum as a template and PdapB-F and PdapB-R as primers, and amplifying a promoter fragment of the dapB gene. The primers were synthesized by Tianyihui Limited, dissolved in sterile water and diluted to 10. mu.M for use. The pre-prepared buffer used for PCR amplification was purchased from Vazayme. The amplification reaction system is as follows:
the thermal cycling condition was 94 ℃ for 3 min; 15s at 94 ℃,15 s at 60 ℃, 150s at 72 ℃ and 35 cycles; 72 ℃ for 10 min. The plasmid PXMJ19-AB was digested with KpnI (TaKaRa) for 30 min; the resulting enzyme-cleaved product and PCR product were purified by DNA purification kit (Biomega Co.), followed by ligation and circularization of both fragments using Gibson ligation kit (Vazayme Co.); transformation of E.coli host bacterium TOP10 competent cells (Solebao Co.), plating of LB medium (peptone 10g/L, yeast powder 5g/L, NaCl 10g/L, pH 7.0) solid plates (containing 5mg/L chloramphenicol); selecting resistant clones, and extracting plasmids in small quantity to obtain a recombinant plasmid PXMJ 19-A-PdapB-B. Similarly, recombinant plasmids PXMJ19-A-PdapA-B, PXMJ19-A-Psod-B and PXMJ19-A-Ptac-B can be prepared. The fragments of the additional promoter were verified using primers B-F on shasA and A-R on CghasB, the results of which are shown in FIG. 1. Wherein the primer sequences are as follows:
B-F：CTGAGCTTCCTGCTGAGCCC
A-R：CTAGTTTCACTCGTTCTTCATCAATG
4 recombinant plasmids are transferred into C.glu-delta ldh (see Chinese patent CN107354119A specifically), and the transformation method comprises the following steps: adding 5 μ L of recombinant plasmid and 100 μ L of competent cells into a 1.5mL centrifuge tube, mixing, adding 0.1cm electric rotating cup, and ice-cooling for 30 min; adjusting the voltage of the electroporator to 1.8kV, loading the electric rotating cup into the electroporator, and pressing down the shock key; after the electric shock is finished, adding 1mL of recovery culture medium into the electric rotating cup, resuspending the cells, transferring the cells into a 1.5mL centrifuge tube, thermally shocking for 6min at 46 ℃, and carrying out shake culture at 30 ℃ and 200rpm for 2 h; 300 mu L of bacterial liquid is taken and coated on LB solid culture medium (containing 5 mu g/mL chloramphenicol), placed in a 30 ℃ incubator for inverted culture for 40 hours, and single colony is picked for PCR verification. Thus obtaining the recombinant corynebacterium glutamicum C.glu-delta ldh/A-PdapB-B, C.glu-delta ldh/A-PdapA-B, C.glu-delta ldh/A-Psod-B and C.glu-delta ldh/A-Ptac-B.
And carrying out shake flask culture on the constructed 4 recombinant strains and C.glu-delta ldh/AB to produce HA. The culture method comprises the following steps: the recombinant strain was inoculated into LB liquid medium (containing 5. mu.g/mL chloramphenicol), cultured at 30 ℃ and 200rpm for 16 hours, inoculated into a fermentation medium at a ratio of 5%, and cultured at 28 ℃ and 200rpm for 48 hours. IPTG (final concentration 1mM) was added at 3 h. And centrifuging at room temperature of 8000rpm after the culture is finished to obtain fermentation liquor containing hyaluronic acid.
The formula of the fermentation medium is as follows: glucose 40g/L, (NH)4)2SO430g/L, 20g/L corn flour, KH2PO4 1g/L，K2HPO4 0.5g/L，MnSO4·7H2O 10mg/L，FeSO4·7H2O 10mg/L，MgSO4·7H2O 0.5g/L。
1mL of the obtained fermentation liquor is added into 1mL of 0.1% w/v SDS solution and mixed evenly, and the mixture is subjected to warm bath at room temperature for 20 minutes; centrifuging at 12000rpm for 10min, transferring the supernatant into a new 10mL EP tube, adding 2 times of volume of glacial ethanol, and standing at 4 ℃ for 1 h; then centrifuging at 12000rpm for 10min, removing supernatant, standing at room temperature, and resuspending with deionized water after ethanol is completely volatilized. mu.L of the resuspended solution was taken, and 700. mu.L of an acetic acid buffer (0.2mol/L sodium acetate, 0.15mol/L sodium chloride, pH adjusted to 6.0 with acetic acid) and 2mL of a 2.5g/L CTAB solution (0.5mol NaOH dissolved) were added to the solution, and after 5 minutes of reaction, OD was measured400。
As shown in FIG. 2, the introduction of the additional promoter can improve the expression level of CghasB and the yield of HA. Wherein, the HA yield of the C.glu-delta ldh/A-PdapB-B is highest in the shake flask fermentation and is increased from 6.9g/L to 7.6 g/L.
Example 2 construction of fba-attenuated strains and comparison of HA production capacity
In addition to example 1, this example further utilizes antisense RNA technology to attenuate the enzyme-catalyzed reaction of fba gene expression in glycolysis. And (3) carrying out PCR reaction by taking the genome of Corynebacterium glutamicum as a template and aF-F and aF-R as primers, purifying, and amplifying the antisense RNA fragment of the fba gene. The PCR was carried out under the same conditions as in example 1.
Plasmid PXMJ19 was double digested with SalI/Ecori. The enzyme-cleaved product and the antisense RNA fragment of fba gene were subjected to Gibson ligation to obtain an expression cassette plasmid containing fba gene antisense RNA transcribed from Ptac promoter, and E.coli host bacterium TOP10 competent cells were transformed in the same manner as in example 1. And carrying out PCR reaction by taking the plasmid as a template and taking PaFT-F and PaFT-R as primers, purifying, and amplifying the expression cassette of fba gene antisense RNA. Plasmid PXMJ19-A-PdapB-B was digested with MauBI alone. Carrying out Gibson ligation reaction on the enzyme digestion product and an expression cassette of fba gene antisense RNA to obtain a plasmid PXMJ19-A-PdapB-B-aF and transforming E.coli host bacteria TOP10 competent cells.
The plasmid PXMJ19-A-PdapB-B-aF was electrically transformed into C.glu-. DELTA.ldh by the method of example 1, and positive clones were picked up and verified by PCR. Thus obtaining the recombinant corynebacterium glutamicum C.glu-delta ldh/A-PdapB-B-aF. C.glu-. DELTA.ldh/A-PdapB-B and C.glu-. DELTA.ldh/A-PdapB-B-aF were shake-cultured in the same manner as in example 1. As shown in FIG. 3, the introduction of fba gene antisense RNA can attenuate its expression, and the HA production is increased to 8.1 g/L.
Example 3 construction of aceE-attenuated strains and comparison of HA-producing ability thereof
On the basis of example 2, this example further utilizes antisense RNA technology and initiation codon mutation to weaken the expression level of pyruvate dehydrogenase gene aceE, down-regulate tricarboxylic acid cycle, and enhance HA synthesis. And (3) carrying out PCR reaction and purification by taking the genome of Corynebacterium glutamicum as a template and aE-F and aE-R as primers to amplify the antisense RNA fragment of aceE gene. Then, the expression cassette of aceE gene antisense RNA was amplified by PCR reaction using PaET-F and PaET-R as primers and purified as described in example 2. Plasmid PXMJ19-A-PdapB-B-aF was digested with XhoI in a single enzyme. Carrying out Gibson ligation reaction on the enzyme digestion product and an expression cassette of aceE gene antisense RNA to obtain a plasmid PXMJ19-A-PdapB-B-aF-aE and transforming E.coli host bacteria TOP10 competent cells.
Meanwhile, homologous recombination double exchange is utilized to construct aceE initiation codon mutant strains. Selecting wild corynebacterium glutamicum as a template, respectively amplifying sequences of about 500bp upstream and downstream of an aceE gene initiation codon in a genome of the wild corynebacterium glutamicum by using aEG-up-F/aEG-up-R and aEG-down-F/aEG-down-R as primers, and purifying the products; plasmid PK18mobsacB was digested with EcorI/XbaI and the product was purified. And carrying out Gibson ligation on the digested plasmid, the upstream fragment and the downstream fragment to obtain a recombinant plasmid pK 18-aEG. pK18-aEG was electroporated into C.glu-. DELTA.ldh as in example 1, first screened with kanamycin, the resulting positive recombinants were cultured in LB liquid medium for 16h, then spread on LB plates containing 150g/L sucrose for secondary screening, and positive clones were picked up and PCR amplified with two primers, aEG-up-F and aEG-down-R, and sequenced. As shown in FIG. 4, the initiation codon of aceE gene was changed from ATG to GTG to obtain recombinant strain C.glu-. DELTA.ldh-aEG
Further, the recombinant plasmid PXMJ19-A-PdapB-B-aF was electrically transformed into C.glu-. DELTA.ldh-aEG by the method in example 1, and positive clones were picked up and verified by PCR. Thus obtaining the recombinant corynebacterium glutamicum C.glu-delta ldh-aEG/A-PdapB-B-aF. The recombinant plasmid PXMJ19-A-PdapB-B-aF-aE was transformed into C.glu- Δ ldh and C.glu- Δ ldh-aEG in the same manner to obtain C.glu- Δ ldh/A-PdapB-B-aF-aE and C.glu- Δ ldh-aEG/A-PdapB-B-aF-aE. These 3 strains were shake-cultured with C.glu-. DELTA.ldh/A-PdapB-B-aF to produce HA as described in example 1. As shown in FIG. 5, the HA production was improved by all three methods, including C.glu-. DELTA.ldh-aEG/A-PdapB-B-aF-aE, to a maximum of 9.0 g/L.
Example 4 production of HA by fed fermentation Using C.glu- Δ ldh-aEG/A-PdapB-B-aF-aE
The recombinant strain C.glu-. DELTA.ldh-aEG/A-PdapB-B-aF-aE constructed in example 3 was inoculated into LB liquid medium (containing 5. mu.g/mL chloramphenicol), cultured at 30 ℃ for 16 hours at 200rpm, and inoculated into a fermentation medium at a ratio of 5% (5L fermenter, working volume 2L). Culturing at 30 deg.C under stirring paddle at 600rpm, ventilating at 1vvm, and pH 7.2 for 3h, adding IPTG (final concentration of 0.1mM), culturing for 48h while adding carbon source, maintaining sugar concentration at 5-10g/L, and centrifuging at room temperature 8000rpm to obtain fermentation liquid containing hyaluronic acid. The fermentation medium composition was the same as in example 1.
The HA extraction method and measurement method were the same as in example 1. The measurement result shows that the recombinant strain C.glu-delta ldh-aEG/A-PdapB-B-aF-aE HAs the HA yield of more than 28g/L under fed-batch fermentation (figure 6), which is the highest level reported at present. The product molecular weight was determined by HPLC using Shodex SB-806M Ohpak (8X 300mm) as column, 0.2M NaCl as mobile phase, and 1.0mL/min as flow rate. Molecular weight standards are available from Lifecore Biomedical inc, USA. The results show that the weight average molecular weight can reach 0.2-0.3 MDa.
The HA production of recombinant C.glu-. DELTA.ldh/AB, C.glu-. DELTA.ldh/A-PdapB-B-aF and C.glu-. DELTA.ldh-aEG/A-PdapB-B-aF-aE in shake flask fermentation (experimental methods same as in examples 1-3) and the HA production of C.glu-. DELTA.ldh-aEG/A-PdapB-B-aF-aE in fermenter feeding fermentation (experimental methods same as in example 4) were shown in FIG. 7.
Sequence listing
<110> Qinghua university
<120> recombinant bacterium for high-yield hyaluronic acid, construction method and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 273
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atttcgaggt tctcgtcgat tgggacagcg gaaccatccc acatgtggga ctggaacagt 60
ggaagctcgc cgcggtcgac gcgctcctgg gagatagcca gcagtgggcg gacgtactcg 120
tccaggactt ccttctggca gtggtcagtg tgcagagcaa cgttgatgcc gtagctcttt 180
gctgcctcgt gggcgaaggc tgcaagcgca actgcgccct tgaccttgtt ctttactgcc 240
aggccggaac cgaactctgc accaccggtg gag 273
<210> 2
<211> 357
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
agacccatgg acacagttgg gaactcccag aagtccttca taccgtgtgg gtgagggtag 60
gacggaatgc caccctgctc acgggaaact tcctgacgga agccatcgag atcgtcttca 120
gaaaggcgac cctccatgaa tgcacgtgcg tacatacctg gtgatgcgtg gccctggaag 180
aagatctggt cgccgccgcc tgggtgatcc ttgccgcgga agaagtggtt gaagccaact 240
tcgtacagag gggctgcgcc tgcgtaagtg gaaatgtgtc cgccgacgcc gatgcctggt 300
cgctgagcgc ggtgaaccat gatggctgcg ttccagcgaa tccaacgacg gtaacgc 357
Claims (10)
1. A recombinant bacterium for high-yield hyaluronic acid is obtained by transferring a gene containing hyaluronic acid synthase and UDP-glucose dehydrogenase into Corynebacterium glutamicum and performing enhanced expression on the UDP-glucose dehydrogenase; the recombinant bacterium can regulate the expression level of fructose diphosphate aldolase gene.
2. The recombinant bacterium according to claim 1, wherein the recombinant bacterium down-regulates an expression level of a pyruvate dehydrogenase gene.
3. The recombinant bacterium according to claim 1, wherein the expression level is down-regulated by gene knockout, mutation or introduction of antisense RNA.
4. The recombinant bacterium according to claim 1, wherein the UDP-glucose dehydrogenase gene is expressed under the control of two promoters,
5. the recombinant bacterium of claim 1, wherein one of the promoters is a PdapB, PdapA, Psod or Ptac promoter.
6. The recombinant bacterium according to any one of claims 1 to 5, wherein the lactate dehydrogenase gene of the recombinant bacterium is inactivated.
7. The recombinant bacterium of claim 6, wherein the Corynebacterium glutamicum is Corynebacterium glutamicum ATCC 13032.
8. Use of the recombinant bacterium of any one of claims 1-7 for the preparation of hyaluronic acid.
9. A construction method of a recombinant bacterium for high-yield hyaluronic acid is characterized by comprising the following steps:
(1) transferring a gene containing hyaluronic acid synthase and UDP-glucose dehydrogenase into corynebacterium glutamicum, simultaneously placing the UDP-glucose dehydrogenase gene under the control of two promoters for expression, and inactivating the recombinant bacterium lactate dehydrogenase gene;
(2) the expression level of fructose diphosphate aldolase gene is reduced;
or a further alternative to the above-described method,
(3) the expression level of pyruvate dehydrogenase gene is reduced.
10. The method of constructing according to claim 9, wherein the method of downregulating the expression level of fructose bisphosphate aldolase gene or pyruvate dehydrogenase gene comprises: introducing antisense RNA expression cassette segments and/or gene mutation, wherein the method for inactivating the lactic acid dehydrogenase gene of the bacteria is gene knockout.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910495504.8A CN110305827B (en) | 2019-06-10 | 2019-06-10 | Recombinant bacterium for high-yield hyaluronic acid and construction method and application thereof |
| PCT/CN2019/101569 WO2020248359A1 (en) | 2019-06-10 | 2019-08-20 | Recombinant bacterium with high production of hyaluronic acid, construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910495504.8A CN110305827B (en) | 2019-06-10 | 2019-06-10 | Recombinant bacterium for high-yield hyaluronic acid and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110305827A CN110305827A (en) | 2019-10-08 |
| CN110305827B true CN110305827B (en) | 2021-01-05 |
Family
ID=68075883
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910495504.8A Active CN110305827B (en) | 2019-06-10 | 2019-06-10 | Recombinant bacterium for high-yield hyaluronic acid and construction method and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN110305827B (en) |
| WO (1) | WO2020248359A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114107148B (en) * | 2021-11-12 | 2023-12-29 | 清华大学 | Genetically engineered strain for high-yield hyaluronic acid and application thereof |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110305827B (en) * | 2019-06-10 | 2021-01-05 | 清华大学 | Recombinant bacterium for high-yield hyaluronic acid and construction method and application thereof |
| CN111518736B (en) * | 2019-10-24 | 2022-04-15 | 华熙生物科技股份有限公司 | Recombinant corynebacterium glutamicum for efficiently synthesizing high-purity hyaluronic acid and oligosaccharide thereof |
| CN112831452A (en) * | 2019-11-25 | 2021-05-25 | 南京理工大学 | Recombinant corynebacterium glutamicum capable of producing hyaluronic acid and construction method and application thereof |
| CN114107149B (en) * | 2021-11-12 | 2023-11-28 | 清华大学 | Method for high-yield hyaluronic acid, recombinant bacterium construction and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107354119A (en) * | 2017-07-19 | 2017-11-17 | 清华大学 | A kind of genetic engineering bacterium of high yield hyaluronic acid and its construction method and application |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103937734B (en) * | 2014-04-23 | 2016-05-11 | 清华大学 | The hyaluronic genetic engineering bacterium of a kind of production and application thereof |
| CN106636170B (en) * | 2016-09-21 | 2019-10-15 | 齐鲁工业大学 | The construction method of double-promoter self-induction type recombined bacillus subtilis and application |
| CN109777820A (en) * | 2019-02-12 | 2019-05-21 | 中国环境科学研究院 | Double-promoter Cascade Regulation expression vector and its construction method and application |
| CN110305827B (en) * | 2019-06-10 | 2021-01-05 | 清华大学 | Recombinant bacterium for high-yield hyaluronic acid and construction method and application thereof |
-
2019
- 2019-06-10 CN CN201910495504.8A patent/CN110305827B/en active Active
- 2019-08-20 WO PCT/CN2019/101569 patent/WO2020248359A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107354119A (en) * | 2017-07-19 | 2017-11-17 | 清华大学 | A kind of genetic engineering bacterium of high yield hyaluronic acid and its construction method and application |
Non-Patent Citations (2)
| Title |
|---|
| Engineering Corynebacterium glutamicum for high-titer biosynthesis of hyaluronic acid;Fangyu Cheng等;《Metabolic Engineering》;20190710;第55卷;276-289 * |
| 重组大肠杆菌合成透明质酸的代谢工程改造及放大工艺研究;褚鑫;《万方数据知识服务平台》;20161231;摘要 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114107148B (en) * | 2021-11-12 | 2023-12-29 | 清华大学 | Genetically engineered strain for high-yield hyaluronic acid and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2020248359A1 (en) | 2020-12-17 |
| CN110305827A (en) | 2019-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110305827B (en) | Recombinant bacterium for high-yield hyaluronic acid and construction method and application thereof | |
| Cheng et al. | High‐titer biosynthesis of hyaluronic acid by recombinant Corynebacterium glutamicum | |
| CN109486734B (en) | Genetically engineered bacterium for producing chondroitin and construction method and application thereof | |
| CN107354119A (en) | A kind of genetic engineering bacterium of high yield hyaluronic acid and its construction method and application | |
| JP2023511522A (en) | HMO production | |
| CN114480240A (en) | Genetic engineering bacterium for producing fucosyllactose and production method thereof | |
| CN110195036A (en) | A kind of recombination Corynebacterium glutamicum of high yield acetylglucosamine and its application | |
| WO2022242637A1 (en) | Genetically engineered bacterium for realizing high yield of l-isoleucine and method for producing l-isoleucine by means of fermentation method | |
| CN113073074B (en) | Genetically engineered bacterium for efficiently synthesizing riboflavin and application thereof | |
| CN108192899B (en) | Streptococcus zooepidemicus lactate dehydrogenase gene mutant and application thereof | |
| KR20230004466A (en) | Process for producing sulfated polysaccharide and process for producing PAPS | |
| CN110835621B (en) | Genetically engineered bacterium and application thereof in producing xylitol | |
| CN110387344B (en) | Recombinant bacterium for producing L-leucine, construction method thereof and production method of L-leucine | |
| CN106754555A (en) | One plant of Leuconostoc mesenteroides mutant strain for producing mannitol and its application process | |
| CN114250188B (en) | Genetically engineered bacterium for synthesizing N-acetylglucosamine and application thereof | |
| CN116769808A (en) | Strain for specifically producing 2' -fucosyllactose and application thereof | |
| CN111549045B (en) | Vitamin K improvement by utilizing recombinant bacillus natto 2 Method for producing yield | |
| JP7350994B2 (en) | Novel promoter and target substance production method using the same | |
| CN115612694A (en) | Construction method and application of recombinant strain for producing tetrahydropyrimidine by efficiently converting glucose | |
| CN114107148B (en) | Genetically engineered strain for high-yield hyaluronic acid and application thereof | |
| CN114107149B (en) | Method for high-yield hyaluronic acid, recombinant bacterium construction and application thereof | |
| CN116286575B (en) | Method for efficiently expressing raw starch alpha-amylase by using bacillus subtilis | |
| KR102462125B1 (en) | Biological production method of human milk oligosaccharide by cofactor engineering | |
| CN117363553B (en) | Genetically engineered bacterium for producing 2' -deoxyadenosine, construction method and application thereof | |
| CN117568433B (en) | Method for improving production of riboflavin by fermenting bacillus subtilis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |