CN110302206A - Application of the tenofovir tenofovir disoproxil fumarate in the drug that preparation inhibits toxoplasma growth - Google Patents
Application of the tenofovir tenofovir disoproxil fumarate in the drug that preparation inhibits toxoplasma growth Download PDFInfo
- Publication number
- CN110302206A CN110302206A CN201910743471.4A CN201910743471A CN110302206A CN 110302206 A CN110302206 A CN 110302206A CN 201910743471 A CN201910743471 A CN 201910743471A CN 110302206 A CN110302206 A CN 110302206A
- Authority
- CN
- China
- Prior art keywords
- tenofovir
- drug
- disoproxil fumarate
- application
- tenofovir disoproxil
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/63—Compounds containing para-N-benzenesulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonyl hydrazide
- A61K31/635—Compounds containing para-N-benzenesulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonyl hydrazide having a heterocyclic ring, e.g. sulfadiazine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/66—Phosphorus compounds
- A61K31/675—Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
Landscapes
- Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates to application of the tenofovir tenofovir disoproxil fumarate in the drug that preparation inhibits toxoplasma growth, belong to field of medicine preparing technology.The present invention provides application of the tenofovir tenofovir disoproxil fumarate in the drug that preparation inhibits toxoplasma growth.Tenofovir tenofovir disoproxil fumarate is able to suppress toxoplasma growth.
Description
Technical field
The present invention relates to field of medicine preparing technology, and in particular to tenofovir tenofovir disoproxil fumarate is being made
Application in the standby drug for inhibiting toxoplasma growth.
Background technique
Toxoplasma is a kind of cytozoicus protozoon, is the pathogen for causing Zoonosis toxoplasmosis, widely distributed
In China and all over the world.Toxoplasmosis is not only one of most common infectious diseases of the mankind, and be also immunosupress and
One of main lethal cause of disease of immune deficiency crowd.In recent years, Acquired Immunodeficiency Syndrome Complicating Toxoplasmosis has become a generation
Criticality, serious public health problem.
Arch insect infection is usually in subclinical infection, but when body's immunity is low, the bow in the subclinical infection stage
The activation of shape worm, constantly proliferation seriously endanger biological organs.It will appear differently clinical symptoms after AIDS patient's toxoplasma gondii infection,
It can lead to patient's death when serious.During HIV infection, there are 20~47% to will appear toxoplasma encephalopathy.AIDS patient's infection
Toxoplasma generallys use sulphadiazine class drug therapy, however as the HIV nineties inhibit class drug appearance, clinical discovery by
The lethal AIDS patient's quantity of arch insect infection is decreased obviously.But only seldom several antiretroviral drugs inhibit bow
The effect of shape worm proliferation is evaluated.It is several different classes of including protease inhibitors, integrase that HIV inhibits class drug mainly to have
Inhibitor, entry inhibitors, nucleoside reverse transcriptase inhibitors and non-nucleoside reverse transcriptase inhibitor.Select different types of HIV
Inhibit class drug that may influence the result of People living with HIV arch insect infection.However, up to the present for treating AIDS
The HIV of poison infection inhibits whether class drug has direct repression and they and conventional resisting toxoplasmosis to the growth of toxoplasma
The interaction of possible pharmacokinetics is unclear between drug (sulphadiazine and pyrimethamine).
Summary of the invention
The purpose of the present invention is to provide tenofovir tenofovir disoproxil fumarates to inhibit toxoplasma raw in preparation
Application in long drug.Tenofovir tenofovir disoproxil fumarate is able to suppress toxoplasma growth.
The present invention provides compound tenofovir tenofovir disoproxil fumarates shown in formula I to inhibit in preparation
Application in the drug of toxoplasma growth；
The present invention also provides include compound tenofovir tenofovir disoproxil fumarate shown in formula I and sulphur
Application of the composition of amic metadiazine in the drug that preparation inhibits toxoplasma growth.
The present invention also provides include compound tenofovir tenofovir disoproxil fumarate shown in formula I and second
Application of the composition of amic metadiazine in the drug that preparation inhibits toxoplasma growth.
The present invention also provides include compound tenofovir tenofovir disoproxil fumarate shown in formula I, sulphur
Application of the composition of amic metadiazine and pyrimethamine in the drug that preparation inhibits toxoplasma growth.
The present invention also provides compound tenofovir tenofovir disoproxil fumarates shown in formula I to prevent in preparation
Or the application in the drug for the treatment of arch insect infection disease.
The present invention also provides include compound tenofovir tenofovir disoproxil fumarate shown in formula I and sulphur
Application of the composition of amic metadiazine in the drug of preparation prevention or treatment arch insect infection disease.
The present invention also provides include compound tenofovir tenofovir disoproxil fumarate shown in formula I and second
Application of the composition of amic metadiazine in the drug of preparation prevention or treatment arch insect infection disease.
The present invention also provides include compound tenofovir tenofovir disoproxil fumarate shown in formula I, sulphur
Application of the composition of amic metadiazine and pyrimethamine in the drug of preparation prevention or treatment arch insect infection disease.
The present invention also provides a kind of prevention or the drugs for the treatment of arch insect infection disease, and the drug includes tenofovir
One or both of tenofovir disoproxil fumarate and following compound: sulphadiazine and pyrimethamine.
The present invention provides the present invention provides tenofovir tenofovir disoproxil fumarates in preparation inhibition arch
Application in the drug of worm growth.Tenofovir tenofovir disoproxil fumarate is able to suppress toxoplasma growth.Illustrate HIV
Inhibit class drug whether to toxoplasma inhibiting effect, rational drug can be provided for the AIDS patient for the treatment of in future arch insect infection
Therapeutic scheme.Test result does not influence HFF when showing tenofovir tenofovir disoproxil fumarate on concentration lower than 30 μM
Form and growth；Tenofovir tenofovir disoproxil fumarate significantly inhibits toxoplasma, IC50For
5.10±1.01；It is anti-that tenofovir tenofovir disoproxil fumarate does not generate antagonism to sulphadiazine or pyrimethamine
And the two can play the role of addition, illustrate that tenofovir tenofovir disoproxil fumarate can be with sulphadiazine or ethamine
Pyrimidine combination therapy toxoplasmosis.
Detailed description of the invention
Fig. 1 is the IC that tenofovir tenofovir disoproxil fumarate provided by the invention is proliferated toxoplasma50Knot
Fruit.
Specific embodiment
The present invention provides compound tenofovir tenofovir disoproxil fumarates shown in formula I to inhibit in preparation
Application in the drug of toxoplasma growth；
Compound tenofovir tenofovir disoproxil fumarate (Tenofovir disoproxil of the present invention
Fumarate) shown in formula I.The present invention does not have special limit to the source of the tenofovir tenofovir disoproxil fumarate
It is fixed, using conventional commercial product well known to those skilled in the art.Tenofovir fumaric acid tenofovir of the present invention
The drug that dipivoxil is prepared is able to suppress toxoplasma growth.
The present invention also provides include compound tenofovir tenofovir disoproxil fumarate shown in formula I and sulphur
Application of the composition of amic metadiazine in the drug that preparation inhibits toxoplasma growth.
The present invention also provides include compound tenofovir tenofovir disoproxil fumarate shown in formula I and second
Application of the composition of amic metadiazine in the drug that preparation inhibits toxoplasma growth.
The present invention also provides include compound tenofovir tenofovir disoproxil fumarate shown in formula I, sulphur
Application of the composition of amic metadiazine and pyrimethamine in the drug that preparation inhibits toxoplasma growth.
The present invention also provides compound tenofovir tenofovir disoproxil fumarates shown in formula I to prevent in preparation
Or the application in the drug for the treatment of arch insect infection disease.
The present invention also provides include compound tenofovir tenofovir disoproxil fumarate shown in formula I and sulphur
Application of the composition of amic metadiazine in the drug of preparation prevention or treatment arch insect infection disease.
The present invention also provides include compound tenofovir tenofovir disoproxil fumarate shown in formula I and second
Application of the composition of amic metadiazine in the drug of preparation prevention or treatment arch insect infection disease.
The present invention also provides include compound tenofovir tenofovir disoproxil fumarate shown in formula I, sulphur
Application of the composition of amic metadiazine and pyrimethamine in the drug of preparation prevention or treatment arch insect infection disease.
The present invention also provides a kind of prevention or the drugs for the treatment of arch insect infection disease, and the drug includes tenofovir
One or both of tenofovir disoproxil fumarate and following compound: sulphadiazine and pyrimethamine.
Combined with specific embodiments below prepared by tenofovir tenofovir disoproxil fumarate of the present invention
Inhibit toxoplasma growth drug in application be further described in detail, technical solution of the present invention include but is not limited to
Lower embodiment.
Embodiment 1
1. helminth and cell culture
RH strain of Toxoplasma gondii tachyzoite culture is connected to 25T or 75T in human foreskin fibroblasts, by RH tachyzoite
In HFF cell bottle, when about 75% polypide evolution, HFF is swept from bottom of bottle with cell scraping, cell suspension is turned
It moves on in the sterile centrifuge tube of 15mL, after being crushed 3-5 times with 18G syringe needle, then it is 3-5 times broken with 27G syringe needle, keep host HFF thin
Born of the same parents are crushed under mechanical action, and the polypide in host cell is allowed to escape, and filter polypide with 3 μm of filters, remove cell fragment simultaneously
Toxoplasma is counted by blood counting chamber.
2. drug and chemicals
Antiretroviral compound purchase in Med Chem Express (Monmouth Junction, NJ,
USA).Pyrimethamine and sulphadiazine are bought in Sigma Chemical Co. (St.Louis, MO) all compounds all
It is dissolved in 100% dimethyl sulfoxide (DMSO), ultimate density 10mM.The ultimate density of DMSO is no more than 0.3% (V/V),
The concentration versus cell vigor does not influence.Pyrimethamine and sulphadiazine also are soluble in DMSO respectively as positive control, DMSO
Individually it is used as negative control.
3. cell viability is analyzed
Utilize CellTiterAQueous One Solution Cell Proliferation Assay kit
Observing HIV inhibits class drug tenofovir tenofovir disoproxil fumarate to the toxicity of HFF cell.By HFF cell inoculation
Into 96 orifice plates, HFF cell adhere-wall culture 4h is allowed, the two pyrrole furan of tenofovir fumaric acid tenofovir of respective concentration is then added
Ester continues culture to 48h, tetrazolium component [3- (4,5-dimethylthiazol-2- is then added in cell culture medium
yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H -tetrazolium,inner salt；
MTS (a)] and electronics coupled reagent (phenazine ethosulfate；PES), 37 DEG C after being incubated for 3 hours, surveyed with microplate reader
The absorbance being scheduled at 490nm.Tenofovir tenofovir disoproxil fumarate is calculated by 5 software of graphpadprism
To the IC of HFF cytotoxicity50(half maximal inhibitory concentration)
4.HIV inhibits class vitro Drug resisting toxoplasmosis cultivation effect
Experiment is divided into: experimental group, negative control group, positive controls, blank group.It is wherein added in negative control group corresponding
The DMSO of volume；Positive controls are divided into pyrimethamine positive controls and sulphadiazine positive controls；Phase is added in blank group
Answer the DMEM solution of volume.
By the raw HFF access 5 × 10 in 24 orifice plates4The tachyzoite just escaped is placed in 37 DEG C, 5%CO2Under the conditions of train
It supports, is inhaled after 4h and abandon old culture solution and wash away not yet into intracellular polypide.The tenofovir of experimental group addition related concentrations
Tenofovir disoproxil fumarate (1 μM, 5 μM, 10 μM, 15 μM, 20 μM, 30 μM).
5.HIV inhibits the interaction between class drug body and sulphadiazine or pyrimethamine
Whether whether observation tenofovir tenofovir disoproxil fumarate with pyrimethamine or sulphadiazine have one
Fixed collaboration or antagonism.The HFF access 5 × 10 in 24 orifice plates will given birth to4The tachyzoite just escaped, is placed in 37
DEG C, 5%CO2Under the conditions of cultivate, inhale to abandon old culture solution and wash away after 4h and not yet enter intracellular polypide, be added according to table 1
Tenofovir tenofovir disoproxil fumarate is and pyrimethamine or sulphadiazine accordingly.Then toxoplasma is observed
Growing state.
Table 1 probes into tenofovir tenofovir disoproxil fumarate whether between pyrimethamine or sulphadiazine
Interaction
After cultivating 5 days in the incubator, collecting infecting cell extracts DNA, the specific steps are as follows:
(1) cell of adhere-wall culture should be handled first as cell suspension, and then 11,200 × g is centrifuged 1min, to the greatest extent supernatant,
Add 200 μ l buffer GA, oscillation suspends to thorough
(2) 20 μ l Proteinase K solution are added, mix
(3) 200 μ l buffer GB are added, are sufficiently mixed by inversion, 70 DEG C of placement 10min, solution strains limpid, brief centrifugation
To remove the droplet of cap wall.
(4) plus 200 μ l dehydrated alcohol of people, sufficiently oscillation mixes 15sec, at this time it is possible that flocculent deposit, briefly from
The heart is to remove the droplet of cap wall.
(5) previous step acquired solution and flocculent deposit be all added in an adsorption column CB3 (adsorption column is put into collecting pipe
In), 13,400 × g is centrifuged 30sec, outwells waste liquid, adsorption column CB3 is put back in collecting pipe.
(6) 500 μ l buffer GD (please first check whether before use and dehydrated alcohol has been added) are added into adsorption column CB3,
13,400 × g is centrifuged 30sec, outwells waste liquid, adsorption column CB3 is put into collecting pipe
(7) 600 μ l rinsing liquid PW (please first check whether before use and dehydrated alcohol has been added) are added into adsorption column CB3,
13,400 × g is centrifuged 30sec, outwells waste liquid, adsorption column CB3 is put into collecting pipe.
(8) repetitive operation step 7
(9) adsorption column CB3 is put back in collecting pipe, 13,400 × g is centrifuged 2min, outwells waste liquid.Adsorption column CB3 is placed in
It is placed at room temperature for several minutes, thoroughly to dry rinsing liquid remaining in adsorbent material
(10) adsorption column CB3 is transferred in a clean centrifuge tube, 50- is vacantly added dropwise to the intermediate position of adsorbed film
200 μ l elution buffer TE, are placed at room temperature for 2-5min, and 13,400 × g is centrifuged 2min, solution is collected into centrifuge tube.
It carries out polypide using RT-PCR to quantify, target gene is toxoplasma B1 gene: sequence are as follows:
B1-QPCR-F:GGAGGACTGGCAACCTGGTGTCG(SEQ ID NO.1)；
B1-QPCR-R:TTGTTTCACCCGGACCGTTTAGCAG (SEQ ID NO.2).
Using Applied Blosystems 7500Fast Real-Time PCR system and StepOnePlusTM
Real-Time PCR System is operated.
1, the configuration of PCR reaction solution component is (reaction solution is prepared to carry out on ice) as shown in table 2
2 PCR reaction solution component allocation list of table
2, Real Time PCR reaction is carried out.Response procedures are as follows: 1,95 degree initial denaturation 30 seconds；2,95 degree are denaturalized 5 seconds；
60 degree extend 30 seconds；Step 2-3 repeats 40 circulations；Solubility curve: 95 degree 15 seconds；60 degree 1 minute；95 degree 15 seconds.
Then 10 are utilized5, 104, 103, 102, 101, the DNA that insect is extracted is used to position the number of insect as standard curve
Amount, each group at least there are three biology to repeat.
Related tenofovir tenofovir disoproxil fumarate is calculated to toxoplasma by 5 software of graphpadprism
The IC of proliferation50, test result is as shown in Fig. 1 and table 3.
The growth percentage result of table 3 various concentration tenofovir tenofovir disoproxil fumarate and blank control
1. tenofovir tenofovir disoproxil fumarate does not influence HFF form and life when being lower than 30 μM to concentration
It is long.
2. tenofovir tenofovir disoproxil fumarate significantly inhibits toxoplasma, IC50For
5.10 ± 1.01, it is specific that situation is inhibited to see Fig. 1.
3. it is anti-that tenofovir tenofovir disoproxil fumarate does not generate antagonism to sulphadiazine or pyrimethamine
And the two can play the role of addition.Specific effect is shown in Table 4.
Tenofovir tenofovir disoproxil fumarate is to toxoplasma associated with table 4 and sulphadiazine or pyrimethamine
Inhibiting effect
Tenofovir tenofovir disoproxil fumarate
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered
It is considered as protection scope of the present invention.
Sequence table
<110>Shandong University
<120>application of the tenofovir tenofovir disoproxil fumarate in the drug that preparation inhibits toxoplasma growth
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
ggaggactgg caacctggtg tcg 23
<210> 2
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ttgtttcacc cggaccgttt agcag 25
Claims (9)
1. the medicine that compound tenofovir tenofovir disoproxil fumarate shown in formula I inhibits toxoplasma growth in preparation
Application in object；
2. the composition comprising compound tenofovir tenofovir disoproxil fumarate and sulphadiazine shown in formula I exists
Preparation inhibits the application in the drug of toxoplasma growth.
3. the composition comprising compound tenofovir tenofovir disoproxil fumarate and pyrimethamine shown in formula I exists
Preparation inhibits the application in the drug of toxoplasma growth.
4. including compound tenofovir tenofovir disoproxil fumarate, sulphadiazine and pyrimethamine shown in formula I
Composition preparation inhibit toxoplasma growth drug in application.
5. compound tenofovir tenofovir disoproxil fumarate shown in formula I is in preparation prevention or treatment arch insect infection
Application in the drug of disease.
6. the composition comprising compound tenofovir tenofovir disoproxil fumarate and sulphadiazine shown in formula I exists
Application in the drug of preparation prevention or treatment arch insect infection disease.
7. the composition comprising compound tenofovir tenofovir disoproxil fumarate and pyrimethamine shown in formula I exists
Application in the drug of preparation prevention or treatment arch insect infection disease.
8. including compound tenofovir tenofovir disoproxil fumarate, sulphadiazine and pyrimethamine shown in formula I
Composition preparation prevention or treatment arch insect infection disease drug in application.
9. the drug of a kind of prevention or treatment arch insect infection disease, the drug includes tenofovir fumaric acid tenofovir two
One or both of pyrrole furan ester and following compound: sulphadiazine and pyrimethamine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910743471.4A CN110302206A (en) | 2019-08-13 | 2019-08-13 | Application of the tenofovir tenofovir disoproxil fumarate in the drug that preparation inhibits toxoplasma growth |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910743471.4A CN110302206A (en) | 2019-08-13 | 2019-08-13 | Application of the tenofovir tenofovir disoproxil fumarate in the drug that preparation inhibits toxoplasma growth |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110302206A true CN110302206A (en) | 2019-10-08 |
Family
ID=68083436
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910743471.4A Pending CN110302206A (en) | 2019-08-13 | 2019-08-13 | Application of the tenofovir tenofovir disoproxil fumarate in the drug that preparation inhibits toxoplasma growth |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110302206A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104254526A (en) * | 2012-03-31 | 2014-12-31 | 乔治亚大学研究基金公司 | New anti-mycobacterial drugs against tuberculosis |
-
2019
- 2019-08-13 CN CN201910743471.4A patent/CN110302206A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104254526A (en) * | 2012-03-31 | 2014-12-31 | 乔治亚大学研究基金公司 | New anti-mycobacterial drugs against tuberculosis |
Non-Patent Citations (4)
| Title |
|---|
| AURAS R ATREYA ET AL.,: "Toxoplasma encephalitis in an HIV-infected patient on highly active antiretroviral therapy despite sustained immune response", 《INTERNATIONAL JOURNAL OF STD & AIDS》 * |
| MONZOTE LET AL.: "Antiretroviral activity of protease inhibitors against Toxoplasma gondii", 《REVISTA DO INSTITUTO DE MEDICINA TROPICAL DE SAO PAULO》 * |
| 李艳等: "脑弓形虫病一例", 《中国神经免疫学和神经病学杂志》 * |
| 杨铁军主编: "《产业专利分析报告，第27册，通用名化学药》", 31 May 2014, 知识产权出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7662840B2 (en) | Use of 4-[(4-thiazolyl)phenoxy]alkoxy-benzamidine derivatives for treatment of osteoporosis | |
| WO2017161594A1 (en) | Applications of neuraminidase and inhibitor thereof in myocardial ischemia and myocardial infarction | |
| CN107648248A (en) | Lamp-dish flower acetic is preparing the application in treating NLRP3 relevant disease medicines | |
| CN110302200A (en) | Angstrom for lattice Wei preparation inhibit toxoplasma growth drug in application | |
| CN110302206A (en) | Application of the tenofovir tenofovir disoproxil fumarate in the drug that preparation inhibits toxoplasma growth | |
| CN110840882A (en) | Composition for treating osteoporosis | |
| Fowler | Viral infections | |
| CN110302199A (en) | Application of the tipranavir in the drug that preparation inhibits toxoplasma growth | |
| CN110327351A (en) | The application that Bei Wei pulls up a horse in the drug that preparation inhibits toxoplasma growth | |
| CN106176700A (en) | Niclosamide application in preparing anti-tumorigenesis herpesvirus medicament | |
| KR100646593B1 (en) | Composition comprising the extract of phellinus mushroom and lactic acid for protecting and treating vaginal viral diseases and uterine cancer | |
| CN104922106B (en) | Application of the Artesunate in anti-osteoclast differentiation class medicine is prepared | |
| CN106074564B (en) | Ursolic acid is preparing the application in anti-hydatid drugs | |
| CN117883439A (en) | Application of indole-3-propionic acid in preparation of medicines for inhibiting osteoclast differentiation | |
| CN108782587A (en) | Broad spectrum antimicrobial preparation, preparation method and application | |
| CN106727495B (en) | A kind of flavanone compound is preparing the application in myocardial preservation drug | |
| CN104189020B (en) | Construction method of post-transplantant candida albicans pulmonary infection mouse model | |
| CN114533726B (en) | Small molecule drug for inhibiting fibrosis and application thereof | |
| CN107898785A (en) | Application of the oxymatrine in the bone loss medicine of anti-Osteoclasts mediate is prepared | |
| KR101977622B1 (en) | Antiviral composition comprising of fermented Isatis indigotica root extract and its therof | |
| CN114015651A (en) | Hpv specific t cell therapeutic agent | |
| Saghafi et al. | Antiviral Activity of Arnebia Euchroma and Amniotic Membrane against HSV-1, Rotavirus, and Influenza Virus | |
| CN104398514B (en) | Application of chloroquine to preparing anti-herpesvirus medicines | |
| CN117883475A (en) | Application of glycyrrhizic acid assisted zinc ion in preparation of anti-respiratory syncytial virus medicine | |
| JP2004518716A (en) | Pharmaceutical composition for prevention and treatment of osteoporosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191008 |
|
| RJ01 | Rejection of invention patent application after publication |