CN110302199A - Application of the tipranavir in the drug that preparation inhibits toxoplasma growth - Google Patents
Application of the tipranavir in the drug that preparation inhibits toxoplasma growth Download PDFInfo
- Publication number
- CN110302199A CN110302199A CN201910743468.2A CN201910743468A CN110302199A CN 110302199 A CN110302199 A CN 110302199A CN 201910743468 A CN201910743468 A CN 201910743468A CN 110302199 A CN110302199 A CN 110302199A
- Authority
- CN
- China
- Prior art keywords
- tipranavir
- drug
- application
- preparation
- formula
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
- A61K31/4433—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a six-membered ring with oxygen as a ring hetero atom
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/63—Compounds containing para-N-benzenesulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonyl hydrazide
- A61K31/635—Compounds containing para-N-benzenesulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonyl hydrazide having a heterocyclic ring, e.g. sulfadiazine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
Landscapes
- Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates to application of the tipranavir in the drug that preparation inhibits toxoplasma growth, belong to field of medicine preparing technology.The present invention provides application of the tipranavir in the drug that preparation inhibits toxoplasma growth.Tipranavir is able to suppress toxoplasma growth.
Description
Technical field
The present invention relates to field of medicine preparing technology, and in particular to tipranavir inhibits the drug of toxoplasma growth in preparation
In application.
Background technique
Toxoplasma is a kind of cytozoicus protozoon, is the pathogen for causing Zoonosis toxoplasmosis, widely distributed
In China and all over the world.Toxoplasmosis is not only one of most common infectious diseases of the mankind, and be also immunosupress and
One of main lethal cause of disease of immune deficiency crowd.In recent years, Acquired Immunodeficiency Syndrome Complicating Toxoplasmosis has become a generation
Criticality, serious public health problem.
Arch insect infection is usually in subclinical infection, but when body's immunity is low, the bow in the subclinical infection stage
The activation of shape worm, constantly proliferation seriously endanger biological organs.It will appear differently clinical symptoms after AIDS patient's toxoplasma gondii infection,
It can lead to patient's death when serious.During HIV infection, there are 20~47% to will appear toxoplasma encephalopathy.AIDS patient's infection
Toxoplasma generallys use sulphadiazine class drug therapy, however as the HIV nineties inhibit class drug appearance, clinical discovery by
The lethal AIDS patient's quantity of arch insect infection is decreased obviously.But only seldom several antiretroviral drugs inhibit bow
The effect of shape worm proliferation is evaluated.It is several different classes of including protease inhibitors, integrase that HIV inhibits class drug mainly to have
Inhibitor, entry inhibitors, nucleoside reverse transcriptase inhibitors and non-nucleoside reverse transcriptase inhibitor.Select different types of HIV
Inhibit class drug that may influence the result of People living with HIV arch insect infection.However, up to the present for treating AIDS
The HIV of poison infection inhibits whether class drug has direct repression and they and conventional resisting toxoplasmosis to the growth of toxoplasma
The interaction of possible pharmacokinetics is unclear between drug (sulphadiazine and pyrimethamine).
Summary of the invention
The purpose of the present invention is to provide application of the tipranavir in the drug that preparation inhibits toxoplasma growth.For draw that
Wei is able to suppress toxoplasma growth.
The present invention provides compound tipranavir shown in formula I answering in the drug that preparation inhibits toxoplasma growth
With；
The present invention also provides the compositions comprising compound tipranavir and sulphadiazine shown in formula I to press down in preparation
Application in the drug of toxoplasma growth processed.
The present invention also provides the compositions comprising compound tipranavir and pyrimethamine shown in formula I to press down in preparation
Application in the drug of toxoplasma growth processed.
The present invention also provides the combinations comprising compound tipranavir, sulphadiazine and pyrimethamine shown in formula I
Application of the object in the drug that preparation inhibits toxoplasma growth.
The present invention also provides compound tipranavirs shown in formula I in preparation prevention or to treat arch insect infection disease
Application in drug.
It is pre- in preparation that the present invention also provides the compositions comprising compound tipranavir and sulphadiazine shown in formula I
Application in anti-or treatment arch insect infection disease drug.
It is pre- in preparation that the present invention also provides the compositions comprising compound tipranavir and pyrimethamine shown in formula I
Application in anti-or treatment arch insect infection disease drug.
The present invention also provides the combinations comprising compound tipranavir, sulphadiazine and pyrimethamine shown in formula I
Application of the object in the drug of preparation prevention or treatment arch insect infection disease.
The present invention also provides a kind of prevention or the drugs for the treatment of arch insect infection disease, and the drug includes tipranavir
One or both of with following compound: sulphadiazine and pyrimethamine.
The present invention provides application of the tipranavir in the drug that preparation inhibits toxoplasma growth.Tipranavir can press down
Toxoplasma growth processed.Whether inhibit class drug to toxoplasma inhibiting effect, can be the Chinese mugwort for the treatment of arch insect infection in the future if illustrating HIV
It grows patient and Thoughts in rational therapy of drug scheme is provided.Test result does not influence HFF's when showing tipranavir on concentration lower than 30 μM
Form and growth；Tipranavir significantly inhibits toxoplasma, IC50It is 9.69 ± 0.91；Tipranavir is to sulphur
Amic metadiazine or pyrimethamine do not generate antagonism instead, and the two can play the role of addition, illustrate that tipranavir can be with sulfanilamide (SN)
Pyrimidine or pyrimethamine combination therapy toxoplasmosis.
Detailed description of the invention
Fig. 1 is the IC that tipranavir provided by the invention is proliferated toxoplasma50As a result.
Specific embodiment
The present invention provides compound tipranavir shown in formula I answering in the drug that preparation inhibits toxoplasma growth
With；
The chemical formula of compound tipranavir (Tipranavir) of the present invention is N- [3- [(1R) -1- [(6R) -2- hydroxyl
Base -4- oxo -6- phenethyl -6- propyl -5H- pyrans -3- base] propyl] phenyl] -5- (trifluoromethyl) pyridine-2-sulfuryl amine,
CAS No.:174484-41-4.The present invention is not particularly limited the source of the tipranavir, using those skilled in the art
Well known routine tipranavir commercial product.
The present invention also provides the compositions comprising compound tipranavir and sulphadiazine shown in formula I to press down in preparation
Application in the drug of toxoplasma growth processed.
The present invention also provides the compositions comprising compound tipranavir and pyrimethamine shown in formula I to press down in preparation
Application in the drug of toxoplasma growth processed.
The present invention also provides the combinations comprising compound tipranavir, sulphadiazine and pyrimethamine shown in formula I
Application of the object in the drug that preparation inhibits toxoplasma growth.
The present invention also provides compound tipranavirs shown in formula I in preparation prevention or to treat arch insect infection disease
Application in drug.
It is pre- in preparation that the present invention also provides the compositions comprising compound tipranavir and sulphadiazine shown in formula I
Application in anti-or treatment arch insect infection disease drug.
It is pre- in preparation that the present invention also provides the compositions comprising compound tipranavir and pyrimethamine shown in formula I
Application in anti-or treatment arch insect infection disease drug.
The present invention also provides the combinations comprising compound tipranavir, sulphadiazine and pyrimethamine shown in formula I
Application of the object in the drug of preparation prevention or treatment arch insect infection disease.
The present invention also provides a kind of prevention or the drugs for the treatment of arch insect infection disease, and the drug includes tipranavir
One or both of with following compound: sulphadiazine and pyrimethamine.
Combined with specific embodiments below to tipranavir of the present invention in the drug that preparation inhibits toxoplasma growth
Application be further described in detail, technical solution of the present invention includes but is not limited to following embodiment.
Embodiment 1
1. helminth and cell culture
RH strain of Toxoplasma gondii tachyzoite culture is connected to 25T 75T HFF in human foreskin fibroblasts, by RH tachyzoite
In cell bottle, when about 75% polypide evolution, HFF is swept from bottom of bottle with cell scraping, cell suspension is transferred to
In 15mL sterile centrifuge tube, after being crushed 3-5 times with 18G syringe needle, then it is 3-5 times broken with 27G syringe needle, so that host's HFF cell is existed
It is crushed under mechanism, the polypide in host cell is allowed to escape, filter polypide with 3 μm of filters, removed cell fragment and pass through
Blood counting chamber counts toxoplasma.
2. drug and chemicals
The compound of antiretroviral is bought in Med Chem Express (Monmouth Junction, NJ, USA).
Pyrimethamine and sulphadiazine purchase are all dissolved in all compounds of Sigma Chemical Co. (St.Louis, MO)
100% dimethyl sulfoxide (DMSO), ultimate density 10mM.The ultimate density of DMSO is no more than 0.3% (V/V), the concentration
Cell viability is not influenced.Pyrimethamine and sulphadiazine also are soluble in DMSO respectively as positive control, and DMSO is individual
As negative control.
3. cell viability is analyzed
Utilize CellTiterAQueous One Solution Cell Proliferation Assay kit
Observing HIV inhibits class drug tipranavir to the toxicity of HFF cell.By HFF cell inoculation into 96 orifice plates, HFF cell is allowed to paste
Then the tipranavir of respective concentration is added in wall culture 4h, continue culture to 48h, tetrazolium is then added in cell culture medium
Component [3- (4,5-dimethylthiazol-2-yl) -5- (3-carboxymethoxyphenyl) -2- (4-
sulfophenyl)-2H-tetrazolium,inner salt；MTS (a)] and electronics coupled reagent (phenazine
ethosulfate；PES), 37 DEG C after being incubated for 3 hours, measure absorbance at 490nm with microplate reader.Pass through graphpad
Prism5 software calculates tipranavir to the IC of HFF cytotoxicity50(half maximal inhibitory
concentration)
4.HIV inhibits class vitro Drug resisting toxoplasmosis cultivation effect
Experiment is divided into: experimental group, negative control group, positive controls, blank group.It is wherein added in negative control group corresponding
The DMSO of volume；Positive controls are divided into pyrimethamine positive controls and sulphadiazine positive controls；Phase is added in blank group
Answer the DMEM solution of volume.
By the raw HFF access 5 × 10 in 24 orifice plates4The tachyzoite just escaped is placed in 37 DEG C, 5%CO2Under the conditions of train
It supports, is inhaled after 4h and abandon old culture solution and wash away not yet into intracellular polypide.The tipranavir of experimental group addition related concentrations
(1 μM, 5 μM, 10 μM, 15 μM, 20 μM, 30 μM).
5.HIV inhibits the interaction between class drug body and sulphadiazine or pyrimethamine
Whether whether observation tipranavir with pyrimethamine or sulphadiazine have certain cooperate with or antagonism.?
By the raw HFF access 5 × 10 in 24 orifice plates4The tachyzoite just escaped is placed in 37 DEG C, 5%CO2Under the conditions of cultivate, inhaled after 4h
It abandons old culture solution and washes away and not yet enter intracellular polypide, corresponding tipranavir, which is added, according to table 1 is and pyrimethamine
Or sulphadiazine.Then the growing state of toxoplasma is observed.
Table 1 probe into tipranavir whether the interaction between pyrimethamine or sulphadiazine
After cultivating 5 days in the incubator, collecting infecting cell extracts DNA, the specific steps are as follows:
(1) cell of adhere-wall culture should be handled first as cell suspension, and then 11,200 × g is centrifuged 1min, to the greatest extent supernatant, adds
200 μ l buffer GA, oscillation suspend to thorough
(2) 20 μ l Proteinase K solution are added, mix
(3) 200 μ l buffer GB are added, are sufficiently mixed by inversion, 70 DEG C of placement 10min, solution strains limpid, brief centrifugation
To remove the droplet of cap wall.
(4) plus 200 μ l dehydrated alcohol of people, sufficiently oscillation mixes 15sec, at this time it is possible that flocculent deposit, briefly from
The heart is to remove the droplet of cap wall.
(5) previous step acquired solution and flocculent deposit be all added in an adsorption column CB3 (adsorption column is put into collecting pipe
In), 13,400 × g is centrifuged 30sec, outwells waste liquid, adsorption column CB3 is put back in collecting pipe.
(6) 500 μ l buffer GD (please first check whether before use and dehydrated alcohol has been added) are added into adsorption column CB3,
13,400 × g is centrifuged 30sec, outwells waste liquid, adsorption column CB3 is put into collecting pipe
(7) 600 μ l rinsing liquid PW (please first check whether before use and dehydrated alcohol has been added) are added into adsorption column CB3,
13,400 × g is centrifuged 30sec, outwells waste liquid, adsorption column CB3 is put into collecting pipe.
(8) repetitive operation step 7
(9) adsorption column CB3 is put back in collecting pipe, 13,400 × g is centrifuged 2min, outwells waste liquid.Adsorption column CB3 is placed in
It is placed at room temperature for several minutes, thoroughly to dry rinsing liquid remaining in adsorbent material
(10) adsorption column CB3 is transferred in a clean centrifuge tube, 50- is vacantly added dropwise to the intermediate position of adsorbed film
200 μ l elution buffer TE, are placed at room temperature for 2-5min, and 13,400 × g is centrifuged 2min, solution is collected into centrifuge tube.
It carries out polypide using RT-PCR to quantify, target gene is toxoplasma B1 gene: sequence are as follows:
B1-QPCR-F:GGAGGACTGGCAACCTGGTGTCG(SEQ ID NO.1)；
B1-QPCR-R:TTGTTTCACCCGGACCGTTTAGCAG (SEQ ID NO.2).
Using Applied Blosystems 7500Fast Real-Time PCR system and StepOnePlusTM
Real-Time PCR System is operated.
1, the configuration of PCR reaction solution component is (reaction solution is prepared to carry out on ice) as shown in table 2
2 PCR reaction solution component allocation list of table
2, Real Time PCR reaction is carried out.Response procedures are as follows: 1,95 degree initial denaturation 30 seconds；2,95 degree are denaturalized 5 seconds；
60 degree extend 30 seconds；Step 2-3 repeats 40 circulations；Solubility curve: 95 degree 15 seconds；60 degree 1 minute；95 degree 15 seconds.
Then 10 are utilized5, 104, 103, 102, 101, the DNA that insect is extracted is used to position the number of insect as standard curve
Amount, each group at least there are three biology to repeat.
The IC that related tipranavir is proliferated toxoplasma is calculated by 5 software of graphpadprism50, test result is as schemed
1 and table 3 shown in.
The growth percentage result of table 3 various concentration tipranavir and blank control
1. tipranavir does not influence HFF form and growth when being lower than 30 μM to concentration.
2. tipranavir significantly inhibits toxoplasma, IC50It is 9.69 ± 0.91, it is specific that situation is inhibited to see
Fig. 1.
3. tipranavir does not generate antagonism instead to sulphadiazine or pyrimethamine, the two can play addition and make
With.Specific effect is shown in Table 4.
Inhibiting effect of the tipranavir to toxoplasma associated with table 4 and sulphadiazine or pyrimethamine
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered
It is considered as protection scope of the present invention.
Sequence table
<110>Shandong University
<120>application of the tipranavir in the drug that preparation inhibits toxoplasma growth
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
ggaggactgg caacctggtg tcg 23
<210> 2
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ttgtttcacc cggaccgttt agcag 25
Claims (9)
1. the application of compound tipranavir shown in formula I in the drug that preparation inhibits toxoplasma growth；
2. the medicine that the composition comprising compound tipranavir and sulphadiazine shown in formula I inhibits toxoplasma growth in preparation
Application in object.
3. the medicine that the composition comprising compound tipranavir and pyrimethamine shown in formula I inhibits toxoplasma growth in preparation
Application in object.
4. the composition comprising compound tipranavir shown in formula I, sulphadiazine and pyrimethamine inhibits arch in preparation
Application in the drug of worm growth.
5. application of the compound tipranavir shown in formula I in the drug of preparation prevention or treatment arch insect infection disease.
6. the composition comprising compound tipranavir and sulphadiazine shown in formula I is in preparation prevention or treatment toxoplasma sense
Contaminate the application in the drug of disease.
7. the composition comprising compound tipranavir and pyrimethamine shown in formula I is in preparation prevention or treatment toxoplasma sense
Contaminate the application in the drug of disease.
8. the composition comprising compound tipranavir shown in formula I, sulphadiazine and pyrimethamine is in preparation prevention or controls
Treat the application in the drug of arch insect infection disease.
9. the drug of a kind of prevention or treatment arch insect infection disease, the drug includes in tipranavir and following compound
It is one or two kinds of: sulphadiazine and pyrimethamine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910743468.2A CN110302199B (en) | 2019-08-13 | 2019-08-13 | Application of tipranavir in preparation of medicine for inhibiting growth of toxoplasma gondii |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910743468.2A CN110302199B (en) | 2019-08-13 | 2019-08-13 | Application of tipranavir in preparation of medicine for inhibiting growth of toxoplasma gondii |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110302199A true CN110302199A (en) | 2019-10-08 |
| CN110302199B CN110302199B (en) | 2021-01-19 |
Family
ID=68083400
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910743468.2A Active CN110302199B (en) | 2019-08-13 | 2019-08-13 | Application of tipranavir in preparation of medicine for inhibiting growth of toxoplasma gondii |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110302199B (en) |
-
2019
- 2019-08-13 CN CN201910743468.2A patent/CN110302199B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN110302199B (en) | 2021-01-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU737038B2 (en) | Anti-viral pharmaceutical compositions containing saturated 1,2-dithiaheterocyclic compounds and uses thereof | |
| WO2017161594A1 (en) | Applications of neuraminidase and inhibitor thereof in myocardial ischemia and myocardial infarction | |
| CN107648248A (en) | Lamp-dish flower acetic is preparing the application in treating NLRP3 relevant disease medicines | |
| CN110840882A (en) | Composition for treating osteoporosis | |
| CN110302200A (en) | Angstrom for lattice Wei preparation inhibit toxoplasma growth drug in application | |
| Fowler | Viral infections | |
| CN110302199A (en) | Application of the tipranavir in the drug that preparation inhibits toxoplasma growth | |
| CN110327351A (en) | The application that Bei Wei pulls up a horse in the drug that preparation inhibits toxoplasma growth | |
| CN110302206A (en) | Application of the tenofovir tenofovir disoproxil fumarate in the drug that preparation inhibits toxoplasma growth | |
| CN106176700B (en) | Application of the niclosamidum in preparing anti-tumorigenesis herpesvirus medicament | |
| KR100646593B1 (en) | Composition comprising the extract of phellinus mushroom and lactic acid for protecting and treating vaginal viral diseases and uterine cancer | |
| CN105395538B (en) | A kind of pharmaceutical composition treating acute upper respiratory tract infection | |
| CN108782587A (en) | Broad spectrum antimicrobial preparation, preparation method and application | |
| TW202033229A (en) | Use of bone protein extracts of poultry for bone graft | |
| Rohdenburg et al. | Growth stimulating and inhibiting substances in human urine | |
| CN104189020B (en) | Construction method of post-transplantant candida albicans pulmonary infection mouse model | |
| US20230310533A1 (en) | Active pharmaceutical ingredient | |
| CN114948941B (en) | New application of artemisinin and pharmaceutical composition | |
| KR101977622B1 (en) | Antiviral composition comprising of fermented Isatis indigotica root extract and its therof | |
| CN117883439A (en) | Application of indole-3-propionic acid in preparation of medicines for inhibiting osteoclast differentiation | |
| Chang | In vitro antibacterial action of extracts from coptis root | |
| Mohammed et al. | Scolicidal Effect of Ethanolic Extract for Cydonia oblonga Seeds in the Viability of the Protoscolices of the Echinococcus granulosus Parasite In Vitro | |
| CN105250313B (en) | A kind of pharmaceutical composition treating cervical cancer | |
| CN105267211A (en) | Application of Aspochalasin compounds to preparation of anti-HIV (human immunodeficiency virus)-latency drugs and acquired immune deficiency syndrome treating drugs | |
| CN117883475A (en) | Application of glycyrrhizic acid assisted zinc ion in preparation of anti-respiratory syncytial virus medicine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |