CN110295243A - A kind of primer sets for detecting pseudomonas aeruginosa, kit and method - Google Patents
A kind of primer sets for detecting pseudomonas aeruginosa, kit and method Download PDFInfo
- Publication number
- CN110295243A CN110295243A CN201910756956.7A CN201910756956A CN110295243A CN 110295243 A CN110295243 A CN 110295243A CN 201910756956 A CN201910756956 A CN 201910756956A CN 110295243 A CN110295243 A CN 110295243A
- Authority
- CN
- China
- Prior art keywords
- primer
- upstream
- downstream
- pseudomonas aeruginosa
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Primer sets, kit and the method that the invention discloses a kind of for detecting pseudomonas aeruginosa, belong to field of biotechnology.Provided by the invention detection method includes the following steps: firstly, extracting the DNA of sample to be tested using nucleic acid extracting reagent, obtaining DNA extracting solution；Then, DNA extracting solution, redissolution liquid, glycine betaine and primer sets are mixed, obtains reaction solution；Then, reaction solution is subjected to pcr amplification reaction, can judges whether contain pseudomonas aeruginosa in sample to be tested according to pcr amplification reaction result.Wherein, which includes upstream outer primer, downstream outer primer, upstream internal primer, downstream inner primer, upstream Loop primer and downstream Loop primer.In addition, LAMP primer group provided by the invention has good specificity, the pseudomonas aeruginosa in sputum can be fast and effeciently detected using the primer sets, and simple, convenient.
Description
Technical field
It is specifically a kind of for detecting primer sets, the kit of pseudomonas aeruginosa the present invention relates to field of biotechnology
And method.
Background technique
Pseudomonas aeruginosa is a kind of conditioned pathogen, is the common bacteria of respiratory tract infection, is widely distributed,
It can cause severe infections in the patient of immune function depression.
Ring mediated isothermal amplification method (Loop-mediated isothermal amplification, LAMP) is a kind of new
Nucleic acid amplification technologies, have many advantages, such as that short detection cycle, high sensitivity, equipment are simple and product detection is convenient.However,
Since the specificity of existing LAMP primer group is poor, the P. aeruginosa in food is presently mainly detected by LAMP technology
Bacterium is not easy to detect the pseudomonas aeruginosa in other samples such as sputum, therefore there is certain limitations.
Summary of the invention
Primer sets, kit and the method that the purpose of the present invention is to provide a kind of for detecting pseudomonas aeruginosa, with
Solve the problems mentioned above in the background art.
To achieve the above object, the embodiment of the present invention provides the following technical solutions:
It is a kind of for detecting the primer sets of pseudomonas aeruginosa, including upstream outer primer, downstream outer primer, in upstream
Portion's primer, downstream inner primer, upstream Loop primer and downstream Loop primer；
The nucleotide sequence of the upstream outer primer is as shown in sequence table SEQ ID NO:1: CGGSGCWGTCSAGAAC；
The nucleotide sequence of the downstream outer primer is as shown in sequence table SEQ ID NO:2:
TGSCGGAAAWGCCGWAAG；
The nucleotide sequence of the upstream internal primer is as shown in sequence table SEQ ID NO:3: ACCSTCGATACGSTTT
CCCGTWGTGAGGWGTSCGWGTGGTT；
The nucleotide sequence of the downstream inner primer is as shown in sequence table SEQ ID NO:4: TCSAATCCCTCSCTCA
CCGSGGTGCSGAAATGWAAAWGGC；
The nucleotide sequence of the upstream Loop primer is as shown in sequence table SEQ ID NO:5:
TCSAGSCGTGCWCCTTC；
The nucleotide sequence of the downstream Loop primer is as shown in sequence table SEQ ID NO:6:
AWGGCCSGGCTWATCWAGTT；
Wherein, the W in above-mentioned nucleotide sequence represents A or T, and S represents G or C.
The embodiment of the invention also provides a kind of for detecting the kit of pseudomonas aeruginosa comprising nucleic acid extraction examination
Liquid, glycine betaine and primer sets mixture are redissolved in agent, and the primer sets mixture includes that each in above-mentioned primer sets draws
Object.
Another kind preferred embodiment provided in an embodiment of the present invention, the primer sets mixture include below according to parts by volume
The component of meter: 4-6 parts of upstream outer primer, 4-6 parts of downstream outer primer, 3-5 parts of upstream internal primer, downstream inner primer 3-
5 parts, Loop primer 18-22 parts of upstream, Loop primer 18-22 parts of downstream.
Another kind preferred embodiment provided in an embodiment of the present invention, in the primer sets, outside upstream outer primer and downstream
The molar concentration of portion's primer is 4-6pmol/ μ L.
Another kind preferred embodiment provided in an embodiment of the present invention, in the primer sets, in upstream internal primer and downstream
The molar concentration of portion's primer is 30-50pmol/ μ L.
Another kind preferred embodiment provided in an embodiment of the present invention, in the primer sets, upstream Loop primer and lower lantern
The molar concentration of shape primer is 10-30pmol/ μ L.
A kind of preferred embodiment provided in an embodiment of the present invention, the molar concentration of the glycine betaine are 4-6mol/L.
The embodiment of the invention also provides a kind of method for detecting pseudomonas aeruginosa, this method is using above-mentioned examination
Agent box is detected comprising following steps:
(1) using nucleic acid extracting reagent extract sample to be tested DNA (Deoxyribonucleic acid,
DNA), DNA extracting solution is obtained；
(2) DNA extracting solution, redissolution liquid, glycine betaine and primer sets mixture are mixed, obtains reaction solution；
(3) reaction solution is subjected to polymerase chain (Polymerase Chain Reaction, PCR) amplified reaction, according to
Pcr amplification reaction result judges whether contain pseudomonas aeruginosa in sample to be tested.
Another kind preferred embodiment provided in an embodiment of the present invention, in the step (3), the temperature of pcr amplification reaction is
60-65℃。
Another kind preferred embodiment provided in an embodiment of the present invention, in the step (3), according to pcr amplification reaction result
CT value judge whether contain pseudomonas aeruginosa in sample to be tested；If CT value is not more than 55, contain verdigris in sample to be tested
Pseudomonad；If CT value is greater than 55, pseudomonas aeruginosa is not contained in sample to be tested.
Compared with prior art, the beneficial effect of the embodiment of the present invention is:
LAMP primer group provided in an embodiment of the present invention has good specificity, can be fast and effective using the primer sets
Ground detects the pseudomonas aeruginosa in sputum, and simple, convenient.
Detailed description of the invention
Fig. 1 is the real-time fluorescence amplification curve (A/B) that embodiment 5 obtains.
Fig. 2 is the real-time fluorescence amplification curve (A/C) that embodiment 5 obtains.
Fig. 3 is the real-time fluorescence amplification curve (A/D) that embodiment 5 obtains.
Fig. 4 is the real-time fluorescence amplification curve (A/E) that embodiment 5 obtains.
Fig. 5 is the real-time fluorescence amplification curve (A/F) that embodiment 5 obtains.
Fig. 6 is the real-time fluorescence amplification curve (A/G) that embodiment 5 obtains.
Fig. 7 is the real-time fluorescence amplification curve (A/H) that embodiment 5 obtains.
Fig. 8 is the real-time fluorescence solubility curve (A/B) that embodiment 5 obtains.
Fig. 9 is the real-time fluorescence solubility curve (A/C) that embodiment 5 obtains.
Figure 10 is the real-time fluorescence solubility curve (A/D) that embodiment 5 obtains.
Figure 11 is the real-time fluorescence solubility curve (A/E) that embodiment 5 obtains.
Figure 12 is the real-time fluorescence solubility curve (A/F) that embodiment 5 obtains.
Figure 13 is the real-time fluorescence solubility curve (A/G) that embodiment 5 obtains.
Figure 14 is the real-time fluorescence solubility curve (A/H) that embodiment 5 obtains.
Figure 15 is the real-time fluorescence amplification curve that embodiment 6 obtains.
Figure 16 is the real-time fluorescence amplification curve that embodiment 7 obtains.
Specific embodiment
Below in conjunction with the embodiment of the present invention, technical scheme in the embodiment of the invention is clearly and completely described,
Obviously, described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.Based in the present invention
Embodiment, every other embodiment obtained by those of ordinary skill in the art without making creative efforts, all
Belong to the scope of protection of the invention.In addition, equipment involved in following embodiments and reagent are without especially indicating
Using commercially available equipment and reagent.
Embodiment 1
The primer sets for detecting pseudomonas aeruginosa that this embodiment offers a kind of and contain the reagent of the primer sets
Box, specifically, the primer sets are the LAMP primer groups using Primer Explorer V5 design comprising upstream outer draws
Object, downstream outer primer, upstream internal primer, downstream inner primer, upstream Loop primer and downstream Loop primer；Wherein, institute
State the nucleotide sequence of upstream outer primer are as follows: CGGCGCTGTCCAGAAC；The nucleotide sequence of the downstream outer primer are as follows:
TGCCGGAAATGCCGTAAG；The nucleotide sequence of the upstream internal primer are as follows: ACCCTCGATACGCTTTCCCGTTGTGA
GGTGTCCGTGTGGTT；The nucleotide sequence of the downstream inner primer are as follows: TCCAATCCCTCCCTCACCGCGGTGCCGAA
ATGTAAATGGC；The nucleotide sequence of the upstream Loop primer are as follows: TCCAGCCGTGCTCCTTC；The downstream Loop primer
Nucleotide sequence are as follows: ATGGCCCGGCTTATCTAGTT.
In addition, the kit includes the glycine betaine and primer sets mixture of nucleic acid extracting reagent, redissolution liquid, 4mol/L,
Wherein, primer sets mixture includes following components: 4 μ L of upstream outer primer, 4 μ L of downstream outer primer, 3 μ of upstream internal primer
L, 3 μ L of downstream inner primer, 18 μ L of upstream Loop primer, 18 μ L of downstream Loop primer.In addition, outside upstream outer primer and downstream
The molar concentration of portion's primer is 4pmol/ μ L；The molar concentration of upstream internal primer and downstream inner primer is 30pmol/ μ
L；The molar concentration of upstream Loop primer and downstream Loop primer is 10pmol/ μ L；Nucleic acid extracting reagent can be according to difference
Sample to be tested is selected, and " the pseudomonas aeruginosa detection of nucleic acids of Guangzhou Huafeng Biotech Co., Ltd. can be for example selected
Nucleic acid extracting reagent in kit ", redissolving liquid can be selected the commercially available product of Guangzhou Huafeng Biotech Co., Ltd..
Embodiment 2
The primer sets for detecting pseudomonas aeruginosa that this embodiment offers a kind of and contain the reagent of the primer sets
Box, specifically, the primer sets are the LAMP primer groups using Primer Explorer V5 design comprising upstream outer draws
Object, downstream outer primer, upstream internal primer, downstream inner primer, upstream Loop primer and downstream Loop primer；Wherein, institute
State the nucleotide sequence of upstream outer primer are as follows: CGGGGCAGTCGAGAAC；The nucleotide sequence of the downstream outer primer are as follows:
TGCCGGAAAAGCCGAAAG；The nucleotide sequence of the upstream internal primer are as follows: ACCCTCGATACGCTTTCCCGTTGTGA
GGTGTCCGTGTGGTT；The nucleotide sequence of the downstream inner primer are as follows: TCGAATCCCTCGCTCACCGGGGTGCGGAA
ATGTAAATGGC；The nucleotide sequence of the upstream Loop primer are as follows: TCGAGGCGTGCACCTTC；The downstream Loop primer
Nucleotide sequence are as follows: AAGGCCCGGCTAATCAAGTT.
In addition, the kit includes the glycine betaine and primer sets mixture of nucleic acid extracting reagent, redissolution liquid, 6mol/L,
Wherein, primer sets mixture includes following components: 6 μ L of upstream outer primer, 6 μ L of downstream outer primer, 5 μ of upstream internal primer
L, 5 μ L of downstream inner primer, 22 μ L of upstream Loop primer, 22 μ L of downstream Loop primer.In addition, outside upstream outer primer and downstream
The molar concentration of portion's primer is 6pmol/ μ L；The molar concentration of upstream internal primer and downstream inner primer is 50pmol/ μ
L；The molar concentration of upstream Loop primer and downstream Loop primer is 30pmol/ μ L；Nucleic acid extracting reagent can be according to difference
Sample to be tested is selected, and " the pseudomonas aeruginosa detection of nucleic acids of Guangzhou Huafeng Biotech Co., Ltd. can be for example selected
Nucleic acid extracting reagent in kit ", redissolving liquid can be selected commercially available " the general detection of nucleic acids of Guangzhou Huafeng Biotech Co., Ltd.
The product of kit ".
Embodiment 3
The primer sets for detecting pseudomonas aeruginosa that this embodiment offers a kind of and contain the reagent of the primer sets
Box, specifically, the primer sets are the LAMP primer groups using Primer Explorer V5 design comprising upstream outer draws
Object, downstream outer primer, upstream internal primer, downstream inner primer, upstream Loop primer and downstream Loop primer；Wherein, institute
State the nucleotide sequence of upstream outer primer are as follows: CGGCGCTGTCGAGAAC；The nucleotide sequence of the downstream outer primer are as follows:
TGCCGGAAATGCCGTAAG；The nucleotide sequence of the upstream internal primer are as follows: ACCCTCGATACGGTTTCCCGTAGTGA
GGTGTCCGAGTGGTT；The nucleotide sequence of the downstream inner primer are as follows: TCGAATCCCTCCCTCACCGCGGTGCGGAA
ATGAAAAAGGC；The nucleotide sequence of the upstream Loop primer are as follows: TCCAGGCGTGCTCCTTC；The downstream Loop primer
Nucleotide sequence are as follows: AAGGCCCGGCTAATCAAGTT.
In addition, the kit includes the glycine betaine and primer sets mixture of nucleic acid extracting reagent, redissolution liquid, 5mol/L,
Wherein, primer sets mixture includes following components: 5 μ L of upstream outer primer, 5 μ L of downstream outer primer, 4 μ of upstream internal primer
L, 4 μ L of downstream inner primer, 20 μ L of upstream Loop primer, 20 μ L of downstream Loop primer.In addition, outside upstream outer primer and downstream
The molar concentration of portion's primer is 5pmol/ μ L；The molar concentration of upstream internal primer and downstream inner primer is 40pmol/ μ
L；The molar concentration of upstream Loop primer and downstream Loop primer is 20pmol/ μ L；Nucleic acid extracting reagent can select Changzhou
The commercial product of hundred generation Biotechnology Co., Ltd comprising lysate, digestive juice, precipitation liquid, cleaning solution and eluent etc., it is multiple
The product of Guangzhou Huafeng Biotech Co., Ltd. commercially available " general kit for detecting nucleic acid " can be selected in solution.
Embodiment 4
This embodiment offers a kind of method for detecting pseudomonas aeruginosa, this method is using above-described embodiment 3
Kit detected, specifically includes the following steps:
(1) NaOH of 4 times of volume 1mol/L is added into the sputum of collection, places 20-30min at room temperature, often
10min oscillation mixes once, after being then centrifuged 5min under the revolving speed of 12000rpm, abandons supernatant, adds the physiology salt of 0.5mL
Water mixes, and then proceedes to be centrifuged 5min under the revolving speed of 12000rpm, abandons 400 μ L supernatants, remaining 100 μ L supernatants, and sufficiently shake
Mixing 15 seconds is swung, crude extract is obtained.
(2) 200 μ L lysates and 20 μ L digestive juices are added into above-mentioned crude extract, oscillation mixes, and carries out 56 DEG C of water-baths
After 10min, adds 500 μ L and liquid is precipitated, and be gently mixed by inversion, obtain mixed liquor.
(3) first adsorption column is put into collecting pipe, and above-mentioned solution is transferred in adsorption column, after standing 3min, then be placed in
12000rpm, it is centrifuged 1min under conditions of 4 DEG C, abandons the waste liquid in collecting pipe；Then, adsorption column is put back in collecting pipe, adds 500
In μ L cleaning solution to adsorption column, equally it is placed in 12000rpm, is centrifuged 1min under conditions of 4 DEG C, abandon the waste liquid in collecting pipe；So
Afterwards, adsorption column is put back in collecting pipe, is equally placed in 12000rpm, is centrifuged 1min under conditions of 4 DEG C, remaining washing of leaving away
Liquid.
(4) adsorption column is taken out, is put into new 1.5mL centrifuge tube, and the eluent of 40 μ L is added, after standing 3min, then
It is placed in 12000rpm, is centrifuged 2min under conditions of 4 DEG C, collect DNA solution, DNA extracting solution can be obtained.
(5) the DNA extracting solution of 2 μ L, the redissolution liquid, the glycine betaine of 3 μ L, 5.8 μ L primer sets mixtures of 10 μ L are taken, and is supplemented
Ultrapure water is mixed to 25 μ L, obtains reaction solution.
(6) Suzhou Yarui Biotechnology Co., Ltd. 1620Q series portable real-time fluorescence quantitative PCR is placed reaction liquid into
Pcr amplification reaction is carried out in instrument；Wherein, the temperature of PCR instrument top cover is 104 DEG C, channel FAM, recurring number 60, reaction temperature
65℃。
(7) judge whether contain pseudomonas aeruginosa in sample to be tested according to the CT value of pcr amplification reaction result；Specifically
, if CT value is not more than 55, contain pseudomonas aeruginosa in sample to be tested sputum；If CT value is greater than 55, sample to be tested phlegm
Pseudomonas aeruginosa is not contained in liquid.
Embodiment 5
The embodiment is tested the specificity of the primer sets of above-described embodiment 3, the test method specifically include with
Lower step:
(1) under conditions of 25 DEG C, after carrying out culture 14h to pseudomonas aeruginosa using enriched medium, then DNA is carried out
It extracts, obtains DNA extracting solution.
(2) the DNA extracting solution of 2 μ L, the redissolution liquid, the glycine betaine of 3 μ L, 5.8 μ L primer sets mixtures of 10 μ L are taken, and is supplemented
Ultrapure water is mixed to 25 μ L, obtains reaction solution.
(3) Suzhou Yarui Biotechnology Co., Ltd. 1620Q series portable real-time fluorescence quantitative PCR is placed reaction liquid into
Pcr amplification reaction is carried out in instrument, is denoted as A；Wherein, the temperature of PCR instrument top cover is 104 DEG C, channel FAM, recurring number 60, instead
Answer temperature 60 C.
(4) with step (1)-(3) identical method respectively to staphylococcus aureus, escherichia coli, withered grass bud
Spore bacillus, Candida albicans, clostridium sporogenes, aspergillus niger and deionized water (negative control group) carry out pcr amplification reaction, and divide
It is not denoted as B, C, D, E, F, G, H, the comparison diagram of corresponding real-time fluorescence amplification curve and A are corresponding as shown in attached drawing 1-7
The comparison diagram of real-time fluorescence solubility curve and A are respectively as shown in attached drawing 8-14.
There is amplified signal from the DNA extracting solution that can be seen that only pseudomonas aeruginosa in Fig. 1-14, and it is dissolved
Curve is simple spike, illustrates that the specificity of primer sets provided in an embodiment of the present invention is good, can only detect verdigris vacation monospore
Bacterium.
Embodiment 6
This embodiment offers the reaction solutions of different volumes to carry out pcr amplification reaction experiment to pseudomonas aeruginosa, specifically
The following steps are included:
(1) under conditions of 25 DEG C, after carrying out culture 14h to pseudomonas aeruginosa using enriched medium, then DNA is carried out
It extracts, obtains DNA extracting solution.
(2) the DNA extracting solution of 3 μ L, redissolution liquid, the glycine betaine of 2 μ L, the upstream outer primer of 0.5 μ L, 0.5 μ of 10 μ L are taken
The downstream outer primer of L, the upstream internal primer of 0.4 μ L, the downstream inner primer of 0.4 μ L, 2 μ L upstream Loop primer and 2 μ
The downstream Loop primer of L, and ultrapure water is supplemented to 25 μ L, it is mixed, obtains reaction solution.
(3) Suzhou Yarui Biotechnology Co., Ltd. 1620Q series portable real-time fluorescence quantitative PCR is placed reaction liquid into
Pcr amplification reaction is carried out in instrument, is denoted as I, and the real-time fluorescence amplification curve of obtained pseudomonas aeruginosa is as shown in Fig. 15；
Wherein, the temperature of PCR instrument top cover is 103 DEG C, channel FAM, recurring number 60,65 DEG C of reaction temperature.
(4) the DNA extracting solution of 1 μ L, redissolution liquid, the glycine betaine of 1 μ L, the upstream outer primer of 0.3 μ L, 0.3 μ L of 5 μ L are taken
Downstream outer primer, the upstream internal primer of 0.24 μ L, the downstream inner primer of 0.24 μ L, 1.2 μ L upstream Loop primer
With the downstream Loop primer of 1.2 μ L, and ultrapure water is supplemented to 15 μ L, mixed, obtain reaction solution.
(5) Suzhou Yarui Biotechnology Co., Ltd. 1620Q series portable real-time fluorescence quantitative PCR is placed reaction liquid into
Pcr amplification reaction is carried out in instrument, is denoted as J, and the real-time fluorescence amplification curve of obtained pseudomonas aeruginosa is as shown in Fig. 15；
Wherein, the temperature of PCR instrument top cover is 104 DEG C, channel FAM, recurring number 60,65 DEG C of reaction temperature.
(6) take the DNA extracting solution of 0.5 μ L, 1 μ L redissolve liquid, the glycine betaine of 0.5 μ L, 0.1 μ L upstream outer primer,
The downstream outer primer of 0.1 μ L, the upstream internal primer of 0.08 μ L, the downstream inner primer of 0.08 μ L, the upstream of 0.4 μ L are cyclic annular
The downstream Loop primer of primer and 0.4 μ L, and ultrapure water is supplemented to 5 μ L, it is mixed, obtains reaction solution.
(7) Suzhou Yarui Biotechnology Co., Ltd. 1620Q series portable real-time fluorescence quantitative PCR is placed reaction liquid into
Pcr amplification reaction is carried out in instrument, is denoted as K, and the real-time fluorescence amplification curve of obtained pseudomonas aeruginosa is as shown in Fig. 15；
Wherein, the temperature of PCR instrument top cover is 104 DEG C, channel FAM, recurring number 60,65 DEG C of reaction temperature.
(8) upstream outer of the DNA extracting solution of 0.2 μ L, the redissolution liquid of 0.5 μ L, the glycine betaine of 0.2 μ L, 0.05 μ L is taken to draw
Object, the downstream outer primer of 0.05 μ L, the upstream internal primer of 0.03 μ L, the downstream inner primer of 0.03 μ L, 0.15 μ L it is upper
The downstream Loop primer of Loop primer and 0.15 μ L is swum, and supplements ultrapure water to 2 μ L, is mixed, obtains reaction solution.
(9) Suzhou Yarui Biotechnology Co., Ltd. 1620Q series portable real-time fluorescence quantitative PCR is placed reaction liquid into
Pcr amplification reaction is carried out in instrument, is denoted as L, and the real-time fluorescence amplification curve of obtained pseudomonas aeruginosa is as shown in Fig. 15；
Wherein, the temperature of PCR instrument top cover is 104 DEG C, channel FAM, recurring number 60,65 DEG C of reaction temperature.
As can be seen from Figure 15, detection institute is carried out to pseudomonas aeruginosa using primer sets provided in an embodiment of the present invention
The reaction solution minimum volume needed is 5 μ L.
Embodiment 7
This embodiment offers the redissolution liquid of different volumes and glycine betaine to carry out pcr amplification reaction reality to pseudomonas aeruginosa
It tests, specifically includes the following steps:
(1) under conditions of 25 DEG C, after carrying out culture 14h to pseudomonas aeruginosa using enriched medium, then DNA is carried out
It extracts, obtains DNA extracting solution.
(2) the DNA extracting solution of 0.44 μ L, the redissolution liquid, the glycine betaine of 0.4 μ L, 0.2 μ L ultrapure water, 0.1 μ L of 1.8 μ L are taken
Upstream outer primer, the downstream outer primer of 0.1 μ L, the upstream internal primer of 0.08 μ L, 0.08 μ L downstream inner primer,
The downstream Loop primer of the upstream Loop primer of 0.4 μ L and 0.4 μ L, is mixed, and M reaction solution is obtained；
Take the DNA extracting solution of 0.44 μ L, 1.8 μ L redissolve liquid, the glycine betaine of 0.4 μ L, 0.4 μ L ultrapure water, 0.1 μ L it is upper
Swim external primers, the downstream outer primer of 0.1 μ L, the upstream internal primer of 0.08 μ L, the downstream inner primer of 0.08 μ L, 0.4 μ
The downstream Loop primer of the upstream Loop primer of L and 0.4 μ L, is mixed, and N reaction solution is obtained；
Take the DNA extracting solution of 0.44 μ L, 1.8 μ L redissolve liquid, the glycine betaine of 0.4 μ L, 0.6 μ L ultrapure water, 0.1 μ L it is upper
Swim external primers, the downstream outer primer of 0.1 μ L, the upstream internal primer of 0.08 μ L, the downstream inner primer of 0.08 μ L, 0.4 μ
The downstream Loop primer of the upstream Loop primer of L and 0.4 μ L, is mixed, and O reaction solution is obtained；
Take the DNA extracting solution of 0.44 μ L, 1.8 μ L redissolve liquid, the glycine betaine of 0.4 μ L, 0.8 μ L ultrapure water, 0.1 μ L it is upper
Swim external primers, the downstream outer primer of 0.1 μ L, the upstream internal primer of 0.08 μ L, the downstream inner primer of 0.08 μ L, 0.4 μ
The downstream Loop primer of the upstream Loop primer of L and 0.4 μ L, is mixed, and P reaction solution is obtained；
Take the DNA extracting solution of 0.44 μ L, the upstream for redissolving liquid, the glycine betaine of 0.4 μ L, 1 μ L ultrapure water, 0.1 μ L of 1.8 μ L
External primers, the downstream outer primer of 0.1 μ L, the upstream internal primer of 0.08 μ L, the downstream inner primer of 0.08 μ L, 0.4 μ L
Upstream Loop primer and 0.4 μ L downstream Loop primer, mixed, obtain Q reaction solution；
Take the DNA extracting solution of 0.44 μ L, 1.8 μ L redissolve liquid, the glycine betaine of 0.4 μ L, 1.2 μ L ultrapure waters, 0.1 μ L it is upper
Swim external primers, the downstream outer primer of 0.1 μ L, the upstream internal primer of 0.08 μ L, the downstream inner primer of 0.08 μ L, 0.4 μ
The downstream Loop primer of the upstream Loop primer of L and 0.4 μ L, is mixed, and R reaction solution is obtained；
Take the DNA extracting solution of 0.44 μ L, 1.8 μ L redissolve liquid, the glycine betaine of 0.4 μ L, 1.4 μ L ultrapure waters, 0.1 μ L it is upper
Swim external primers, the downstream outer primer of 0.1 μ L, the upstream internal primer of 0.08 μ L, the downstream inner primer of 0.08 μ L, 0.4 μ
The downstream Loop primer of the upstream Loop primer of L and 0.4 μ L, is mixed, and S reaction solution is obtained；
Take the DNA extracting solution of 0.44 μ L, 1.8 μ L redissolve liquid, the glycine betaine of 0.4 μ L, 1.6 μ L ultrapure waters, 0.1 μ L it is upper
Swim external primers, the downstream outer primer of 0.1 μ L, the upstream internal primer of 0.08 μ L, the downstream inner primer of 0.08 μ L, 0.4 μ
The downstream Loop primer of the upstream Loop primer of L and 0.4 μ L, is mixed, and T reaction solution is obtained；
Take the DNA extracting solution of 0.44 μ L, the upstream for redissolving liquid, the glycine betaine of 0.4 μ L, 2 μ L ultrapure waters, 0.1 μ L of 1.8 μ L
External primers, the downstream outer primer of 0.1 μ L, the upstream internal primer of 0.08 μ L, the downstream inner primer of 0.08 μ L, 0.4 μ L
Upstream Loop primer and 0.4 μ L downstream Loop primer, mixed, obtain U reaction solution.
(3) that above-mentioned M-U reaction solution is respectively placed in Suzhou Yarui Biotechnology Co., Ltd.'s 1620Q series portable is real-time
Pcr amplification reaction is carried out in fluorescence quantitative PCR instrument, the real-time fluorescence amplification curve for corresponding to obtained pseudomonas aeruginosa is for example attached
Shown in Figure 16；Wherein, the temperature of PCR instrument top cover is 103 DEG C, channel FAM, recurring number 50,63 DEG C of reaction temperature.
As can be seen from Figure 16, when the total dosage for redissolving the public reagents such as liquid, glycine betaine and ultrapure water is 2.4 μ L,
Real-time fluorescence no signal, when total dosage of public reagent is 4.2 and 4.4, real-time fluorescent signals are unstable, wherein best tolerance
Total dosage of the public reagent of error range is 3.4 ± 0.8.
Taking the above-mentioned ideal embodiment according to the present invention as inspiration, through the above description, relevant staff is complete
Various changes and amendments can be carried out without departing from the scope of the technological thought of the present invention' entirely.The technology of this invention
Property range is not limited to the contents of the specification, it is necessary to which the technical scope thereof is determined according to the scope of the claim.
Sequence table
<110>Guizhou Jinjiu Bio-Tech. Co., Ltd.
<120>a kind of primer sets for detecting pseudomonas aeruginosa, kit and method
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
cggsgcwgtc sagaac 16
<210> 2
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
tgscggaaaw gccgwaag 18
<210> 3
<211> 41
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
accstcgata cgstttcccg twgtgaggwg tscgwgtggt t 41
<210> 4
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
tcsaatccct csctcaccgs ggtgcsgaaa tgwaaawggc 40
<210> 5
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
tcsagscgtg cwccttc 17
<210> 6
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
awggccsggc twatcwagtt 20
Claims (10)
1. a kind of for detecting the primer sets of pseudomonas aeruginosa, which is characterized in that the primer sets include that upstream outer draws
Object, downstream outer primer, upstream internal primer, downstream inner primer, upstream Loop primer and downstream Loop primer；The upstream
The nucleotide sequence of external primers is as shown in sequence table SEQ ID No:1, the nucleotide sequence such as sequence of the downstream outer primer
Shown in list SEQ ID No:2, the nucleotide sequence of the upstream internal primer is described as shown in sequence table SEQ ID No:3
The nucleotide sequence of downstream inner primer is as shown in sequence table SEQ ID No:4, the nucleotide sequence of the upstream Loop primer
As shown in sequence table SEQ ID No:5, the nucleotide sequence of the downstream Loop primer is as shown in sequence table SEQ ID No:6.
2. a kind of for detecting the kit of pseudomonas aeruginosa, including nucleic acid extracting reagent, redissolution liquid and glycine betaine, feature
It is, the kit further includes primer sets mixture, and the primer sets mixture includes drawing as described in claim 1
Object group.
3. according to claim 2 a kind of for detecting the kit of pseudomonas aeruginosa, which is characterized in that described draws
Object group mixture includes the following component according to parts by volume meter: 4-6 parts of upstream outer primer, 4-6 parts of downstream outer primer, upstream
3-5 parts of internal primer, 3-5 parts of downstream inner primer, Loop primer 18-22 parts of upstream, Loop primer 18-22 parts of downstream.
4. according to claim 3 a kind of for detecting the kit of pseudomonas aeruginosa, which is characterized in that described draws
In object group, the molar concentration of upstream outer primer and downstream outer primer is 4-6pmol/ μ L.
5. according to claim 3 a kind of for detecting the kit of pseudomonas aeruginosa, which is characterized in that described draws
In object group, the molar concentration of upstream internal primer and downstream inner primer is 30-50pmol/ μ L.
6. according to claim 3 a kind of for detecting the kit of pseudomonas aeruginosa, which is characterized in that described draws
In object group, the molar concentration of upstream Loop primer and downstream Loop primer is 10-30pmol/ μ L.
7. according to claim 2 a kind of for detecting the kit of pseudomonas aeruginosa, which is characterized in that the beet
The molar concentration of alkali is 4-6mol/L.
8. a kind of method for detecting pseudomonas aeruginosa, which is characterized in that the method is using such as claim 2-6
Any one of described in kit detected comprising following steps:
The DNA that sample to be tested is extracted using nucleic acid extracting reagent, obtains DNA extracting solution；
DNA extracting solution, redissolution liquid, glycine betaine and primer sets mixture are mixed, reaction solution is obtained；
Reaction solution is subjected to pcr amplification reaction, is judged according to pcr amplification reaction result whether false single containing verdigris in sample to be tested
Born of the same parents bacterium.
9. a kind of method for detecting pseudomonas aeruginosa according to claim 8, which is characterized in that the step
(3) in, the temperature of pcr amplification reaction is 60-65 DEG C.
10. a kind of method for detecting pseudomonas aeruginosa according to claim 9, which is characterized in that the step
Suddenly in (3), judge whether contain pseudomonas aeruginosa in sample to be tested according to the CT value of pcr amplification reaction result；If CT value is not
Greater than 55, then contain pseudomonas aeruginosa in sample to be tested；If CT value is greater than 55, P. aeruginosa is not contained in sample to be tested
Bacterium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910756956.7A CN110295243A (en) | 2019-08-16 | 2019-08-16 | A kind of primer sets for detecting pseudomonas aeruginosa, kit and method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910756956.7A CN110295243A (en) | 2019-08-16 | 2019-08-16 | A kind of primer sets for detecting pseudomonas aeruginosa, kit and method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110295243A true CN110295243A (en) | 2019-10-01 |
Family
ID=68032935
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910756956.7A Pending CN110295243A (en) | 2019-08-16 | 2019-08-16 | A kind of primer sets for detecting pseudomonas aeruginosa, kit and method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110295243A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102134601A (en) * | 2010-12-30 | 2011-07-27 | 广东省微生物研究所 | Loop-mediated isothermal amplification detection primer pair of Pseudomonas aeruginosa, detection method and detection kit |
| CN103911459A (en) * | 2014-04-29 | 2014-07-09 | 西南大学 | LAMP rapid detection kit for toxin genes of pseudomonas aeruginosa type III secretion system and application and method thereof |
| CN106544443A (en) * | 2016-12-30 | 2017-03-29 | 广东环凯生物科技有限公司 | The dry powdered LAMP quick detection kit of Pseudomonas aeruginosa and its using method |
-
2019
- 2019-08-16 CN CN201910756956.7A patent/CN110295243A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102134601A (en) * | 2010-12-30 | 2011-07-27 | 广东省微生物研究所 | Loop-mediated isothermal amplification detection primer pair of Pseudomonas aeruginosa, detection method and detection kit |
| CN103911459A (en) * | 2014-04-29 | 2014-07-09 | 西南大学 | LAMP rapid detection kit for toxin genes of pseudomonas aeruginosa type III secretion system and application and method thereof |
| CN106544443A (en) * | 2016-12-30 | 2017-03-29 | 广东环凯生物科技有限公司 | The dry powdered LAMP quick detection kit of Pseudomonas aeruginosa and its using method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kocamemi et al. | First data-set on SARS-CoV-2 detection for Istanbul wastewaters in Turkey | |
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN102154451B (en) | Loop-mediated isothermal amplification detection primer group, detection method and detection kit for enterobacter sakazakii | |
| CN106399486B (en) | The primer sets and kit for causing diarrhea helminth are detected for multiplex PCR | |
| CN102816847B (en) | LAMP primer for detecting Brucella and kit containing the same | |
| CN104263838B (en) | Listeria monocytogenes LAMP-LFD detection kit and detection method thereof | |
| Yagupsky | Diagnosing Kingella kingae infections in infants and young children | |
| CN103320435B (en) | Listeria monocytogenes LAMP (loop-mediated isothermal amplification) detection kit containing internal standard | |
| CN102925548B (en) | Actinobacillus pleuropneumoniae LAMP kit and application method thereof | |
| Tilburg et al. | Contamination of commercial PCR master mix with DNA from Coxiella burnetii | |
| Hata et al. | Identification of SARS-Cov-2 in wastewater in japan by multiple molecular assays-implication for wastewater-based epidemiology (wbe) | |
| Ahmadzadeh et al. | Different respiratory samples for COVID-19 detection by standard and direct quantitative RT-PCR: a literature review | |
| CN105821133A (en) | Kit for simultaneously detecting Vibrio parahaemolyticus, Escherichia coli O157:H7, Salmonella and Shigella | |
| CN107236812B (en) | Detection kit for bacillus cereus, detection method and application | |
| CN101570798B (en) | Detection kit and detection method for 3 species of food-borne viruses in marine products | |
| CN110295243A (en) | A kind of primer sets for detecting pseudomonas aeruginosa, kit and method | |
| CN105695624A (en) | Rapid identification method for different species of crude heparin sodium | |
| Yakubovna et al. | Aspects of Clinical and Laboratory Diagnostics of Enteroviral Infection without CMS Damage | |
| CN102978282A (en) | Typhoid fever salmonella and salmonella paratyphi fluorescent quantitative polymerase chain reaction (PCR) detection kit and application thereof | |
| CN106119383A (en) | Meninges deteriorated blood Elizabethan's collarium mediated constant temperature gene amplification fast detecting kit and detection method | |
| CN102134588B (en) | Legionella pneumophilia test kit and application thereof | |
| CN109750114A (en) | The constant-temperature amplification detection method and its primer special and kit of the sour klebsiella spp of production | |
| CN104278024A (en) | Primer composition for identification of human adenovirus type 55 and application thereof | |
| CN105177157B (en) | For detecting the LAMP kit and its primer special of VanB gene | |
| Saidin et al. | Prevalence and associated risk factors of Entamoeba histolytica, E. dispar and E. moshkovskii infection among Orang Asli communities in Slim River, Perak |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191001 |