CN110295166A - One group for detecting the LAMP primer and application of Epstein-Barr virus in intraocular liquid - Google Patents
One group for detecting the LAMP primer and application of Epstein-Barr virus in intraocular liquid Download PDFInfo
- Publication number
- CN110295166A CN110295166A CN201810235386.2A CN201810235386A CN110295166A CN 110295166 A CN110295166 A CN 110295166A CN 201810235386 A CN201810235386 A CN 201810235386A CN 110295166 A CN110295166 A CN 110295166A
- Authority
- CN
- China
- Prior art keywords
- sequence
- epstein
- barr virus
- primer
- tested
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
Abstract
The invention discloses one group for detecting the LAMP primer and application of Epstein-Barr virus in intraocular liquid.LAMP primer of the invention, 6 single strand dnas shown in sequence 1 to 6 form.The application and the kit containing LAMP primer that the present invention also protects LAMP primer.It is demonstrated experimentally that when detecting Epstein-Barr virus there is high specific and high sensitivity can fast and accurately detect Epstein-Barr virus using LAMP primer group of the invention and method using LAMP primer of the invention.
Description
Technical field
The present invention relates in field of biotechnology, one group for detecting the LAMP primer and application of Epstein-Barr virus in intraocular liquid.
Background technique
Epstein-Barr virus (Epstein-Barr virus, EBV), also known as ebb virus (Human herpesvirus
4, HHV-4), it is a kind of DNA Causative virus that the thermophilic lymphocyte virus of γ subfamily belongs to, and has the infection of specificity in vivo and in vitro
The biological characteristics of the mankind and certain primate B cells.Main to be propagated by saliva, symptomless infection mostly occurs in child, 3~
90% or more child once infected Epstein-Barr virus within 5 years old, had antiviral antibody in 90% or more adult body.With antibiotic and steroids
One of the extensive use of drug, viral endophthalmitis disease is increasingly common in clinical ophthalmology, and rise to main blinding eye illness.
The clinical primarily discrete culture of detection method and serodiagnosis for virus at present.These detection methods are numerous
Trivial, detection time is long, and sensitivity is low, is easy to happen missing inspection and false retrieval, is unable to satisfy the requirement quickly detected.Developed in recent years
The molecular detection technology come, especially round pcr, in the application of microorganism Rapid identification and context of detection, for the quick of virus
Detection opens new approach.But PCR haves the shortcomings that detection time is long, easy to pollute, false positive rate is high, make its application by
To limitation.Loop-mediated isothermal amplification technique (loop-mediated isothermal amplification, LAMP) is in recent years
Come a kind of sensitive, special, the simple, fast nucleic acid amplification technologies developed, principle is that have strand-displacement activity in one kind
Archaeal dna polymerase under the action of, identify 6-8 region 4-6 primer, under isothermal conditions quickly, specifically expand purpose
Gene can be applied to fast and accurately detection virus.
Summary of the invention
The object of the present invention is to provide one group for detecting the LAMP primer group and application of Epstein-Barr virus in intraocular liquid.
LAMP primer group provided by the invention, by primers F 3-1, primer B3-1, primers F IP-1, primer BIP-1, primer
LF-1 and primer LB-1 composition；
The primers F 3-1 is following (a1) or (a2):
(a1) single strand dna shown in the sequence 1 of sequence table；
(a2) sequence 1 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 1
The single strand dna of identical function；
The primer B3-1 is following (a3) or (a4):
(a3) single strand dna shown in the sequence 2 of sequence table；
(a4) sequence 2 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 2
The single strand dna of identical function；
The primers F IP-1 is following (a5) or (a6):
(a5) single strand dna shown in the sequence 3 of sequence table；
(a6) sequence 3 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 3
The single strand dna of identical function；
The primer BIP-1 is following (a7) or (a8):
(a7) single strand dna shown in the sequence 4 of sequence table；
(a8) sequence 4 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 4
The single strand dna of identical function；
The primer LF-1 is following (a9) or (a10):
(a9) single strand dna shown in the sequence 5 of sequence table；
(a10) sequence 5 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 5
The single strand dna of identical function；
The primer LB-1 is following (a11) or (a12):
(a11) single strand dna shown in the sequence 6 of sequence table；
(a12) sequence 6 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 6
The single strand dna of identical function.
In the primer sets, the primers F 3-1, the primer B3-1, the primers F IP-1, the primer BIP-1, institute
The molar ratio for stating the primer LF-1 and primer LB-1 can be 0.5:0.5:2:2:1:1.
The present invention also protects the application of the primer sets, and the application is any one following of (b1) into (b6):
(b1) identifying the application in Epstein-Barr virus；
(b2) application in the kit for identifying Epstein-Barr virus is being prepared；
(b3) identifying whether tested bacteria is application in Epstein-Barr virus；
(b4) preparation for identify tested bacteria whether the application in the kit for being Epstein-Barr virus；
(b5) whether contain the application in Epstein-Barr virus in identification sample to be tested；
(b6) preparation for identify sample to be tested whether the application in the kit containing Epstein-Barr virus.
Above-mentioned application, the sample to be tested can be eye clinical sample culture, ocular fluid body or aspirate.
The present invention also protects the kit containing the primer sets；The purposes of the kit be following (c1) or (c2) or
(c3):
(c1) identify Epstein-Barr virus；
(c2) identify whether tested bacteria is Epstein-Barr virus；
(c3) whether identification sample to be tested contains Epstein-Barr virus.
The kit may also include other reagents in LAMP reaction system outside non-primer.
In mentioned reagent box, the sample to be tested can be eye clinical sample culture, ocular fluid body or aspirate.
The present invention also protects application of the kit in following (c1) or (c2) or (c3):
(c1) identify Epstein-Barr virus；
(c2) identify whether tested bacteria is Epstein-Barr virus；
(c3) whether identification sample to be tested contains Epstein-Barr virus.
Above-mentioned application, the sample to be tested can be eye clinical sample culture, ocular fluid body or aspirate.
The present invention also protects the preparation method of the primer sets, and the method includes independently packing each primer.
The present invention also protects the preparation method of the kit, and the method includes by each primer of the primer sets
Independently pack.
It, can be according to including the following steps when identifying Epstein-Barr virus using the primer sets or the kit in the present invention
Method carry out:
(1) genomic DNA of sample to be tested is extracted；
(2) genomic DNA obtained using step (1) carries out LAMP using the primer sets or the kit as template
Then amplified reaction makes the following judgment:
If may be implemented using the genomic DNA as the specific amplification of template, the sample to be tested is or candidate is
Epstein-Barr virus；
If cannot realize that, using the genomic DNA as the specific amplification of template, the sample to be tested is not or waits
Choosing is not Epstein-Barr virus.
It, can be according to including as follows when identifying whether tested bacteria is Epstein-Barr virus using the primer sets or the kit
The method of step carries out:
(1) genomic DNA of tested bacteria is extracted；
(2) genomic DNA obtained using step (1) carries out LAMP using the primer sets or the kit as template
Then amplified reaction makes the following judgment:
If may be implemented using the genomic DNA as the specific amplification of template, the tested bacteria is or candidate is
Epstein-Barr virus；
If cannot realize that, using the genomic DNA as the specific amplification of template, the tested bacteria is not or waits
Choosing is not Epstein-Barr virus.
It, can be according to including such as when whether containing Epstein-Barr virus using the primer sets or kit identification sample to be tested
The method of lower step carries out:
(1) genomic DNA of sample to be tested is extracted；
(2) genomic DNA obtained using step (1) carries out LAMP using the primer sets or the kit as template
Then amplified reaction makes the following judgment:
If may be implemented using the genomic DNA as the specific amplification of template, the sample to be tested contains or candidate
Contain Epstein-Barr virus；
If cannot realize using the genomic DNA as the specific amplification of template, the sample to be tested do not contain or
Candidate does not contain Epstein-Barr virus.
Above, " positive amplification " can be specifically judged by the following method: detecting fluorescence signal with fluorescent PCR instrument, if
Positive amplification curve occur then is positive amplification.The positive amplification curve concretely S type amplification curve.
Any description above is carried out using primer sets in the reaction system of LAMP amplification, and each primer is dense in the primer sets
Degree are as follows: 0.5 μM of primers F 3-1,0.5 μM of primer B3-1,2 μM of primers F IP-1,2 μM of the primer BIP-1,1 μ
Primer LF-1 described in M, 1 μM of primer LB-1.
Any description above can contain 1 μ L in the 10 μ L reaction systems using the reaction system of primer sets progress LAMP amplification
10 × ThermoPol Buffer, 0.8M glycine betaine, 0.5mg/ml BSA, 4mM MgSO4, 0.3 μ 20 × EvaGreen of L,
1.5mM dNTPs, 0.32U/ml Bst archaeal dna polymerase large fragment, primer sets solution described in 1 μ L, 50pg-50ng template DNA,
Surplus is water.Wherein, 10 × ThermoPol Buffer can be Thermo product, and 20 × EvaGreen can be the rich U.S. biology in Hefei
Science and technology limited Company product.
Any description above LAMP amplification response procedures concretely: 65 DEG C of constant temperature 50min.In reaction process, use
Fluorescent PCR instrument detects fluorescence signal.
The present invention provides one group for detecting the LAMP primer group and application of Epstein-Barr virus in intraocular liquid.It is of the present invention
LAMP primer group includes outer primer F3 and B3, inner primer FIP and BIP and ring primer LF and LB, is had when detecting Epstein-Barr virus
High specific and high sensitivity.Using LAMP primer group of the invention and method, Epstein-Barr virus can be fast and accurately detected.
Detailed description of the invention
Fig. 1 is the LAMP amplification curve diagram of embodiment 3.
Fig. 2 is the LAMP amplification curve diagram of embodiment 5.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly
What routine biochemistry reagent shop was commercially available.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result makes even
Mean value.
PGEM-T Easy Vector carrier: promega company, product article No. A1360.
Embodiment 1, the primer sets preparation for identifying Epstein-Barr virus
It carries out a large amount of sequence analyses, compare several primers obtained for identifying Epstein-Barr virus.Each primer is carried out pre-
Experiment, compares the performances such as sensitivity, specificity, finally obtains the LAMP primer group for identifying Epstein-Barr virus.
For identifying the primer sets of Epstein-Barr virus, including 2 outer primers (F3-1, B3-1), 2 inner primers (FIP-1, BIP-
1) and 2 ring primers (LF-1, LB-1), each primer sequence are (5 ' → 3 ') as follows:
Primers F 3-1 (sequence 1 of sequence table): GTTCGCGTTGCTAGGCC；
Primer B3-1 (sequence 2 of sequence table): AAGGGGAAAAGTTAGAAACTG；
Primers F IP-1 (sequence 3 of sequence table): ATACCAGGGGCAGTGGTCCCTCTCAGTCCAGCGCGTTTA；
Primer BIP-1 (sequence 4 of sequence table): GTCCTGCAGCTATTTCTGGTCGCTAGGGAGAGGTAGAAGAC；
Primer LF-1 (sequence 5 of sequence table): GGCTGCTGTCTGGCTTACG；
Primer LB-1 (sequence 6 of sequence table): ATCAGAGCGCCAGGAGTC.
In the primer sets, primers F 3-1, primer B3-1, primers F IP-1, primer BIP-1, primer LF-1 and primer LB-1
Molar ratio is 0.5:0.5:2:2:1:1, each equal independent packaging of primer.
Embodiment 2, detection method are established
Include: using the method that the primer sets of the identification Epstein-Barr virus of embodiment 1 detect Epstein-Barr virus
1, it extracts the genomic DNA of virus to be measured or extracts the total DNA of biological sample to be measured.
2, the total DNA for taking step 1 to obtain carries out LAMP amplification using the primer sets prepared in embodiment 1 as template.
The reaction system of 10 μ L LAMP amplification includes: 1 μ 10 × ThermoPol of L Buffer (Thermo), 0.8M beet
Alkali, 0.5mg/ml BSA, 4mM MgSO4, 0.3 20 × EvaGreen of μ L (Hefei Bo Mei biotechnology Co., Ltd),
1.5mM dNTPs, 0.32U/ml Bst archaeal dna polymerase large fragment, primer mixture (F3-1, B3-1, FIP-1, BIP-1, LF-
The mixture of 1 and LB-1), 2ng template DNA, surplus ddH2O.The concentration of each primer is as follows in reaction system: 0.5 μM of F3-
1、0.5μM B3-1、2μM FIP-1、2μM BIP-1、1μM LF-1、1μM LB-1。
The response procedures of LAMP amplification: 65 DEG C of constant temperature 50min.In reaction process, using fluorescent PCR instrument detection fluorescence letter
Number.
If showing that virus to be measured is that Epstein-Barr virus or sample to be tested infect using the available positive amplification curve of primer sets
Epstein-Barr virus.
If showing that virus to be measured is that Epstein-Barr virus or sample to be tested contain using the available positive amplification curve of primer sets
Epstein-Barr virus shows that virus to be measured is that Epstein-Barr virus or sample to be tested contain Epstein-Barr virus if positive amplification curve cannot be obtained.
The specificity of embodiment 3, the primer sets of identification Epstein-Barr virus
Epstein-Barr virus reference material plasmid construction: the DNA fragmentation of Epstein-Barr virus shown in the sequence 7 by sequence table is inserted into pGEM-T
Between ApaI the and SacI restriction enzyme site of Easy Vector carrier, reference material plasmid is obtained.
Sample to be tested is respectively as follows: Epstein-Barr virus reference material Plasmid DNA, herpes simplex virus I-form genomic DNA, herpe simplex
Virus type II genomic DNA, varicella virus genomic DNA, cytomegalovirus gene group DNA.Wherein, simple blister
I type of exanthema virus, herpes simplex virus type II, varicella virus and cytomegalovirus reference material Plasmid DNA are recorded
In document, " Zhu Yanmin, Wu Yidong, Shang Shiqiang detect the gene chips and its inspection of Preliminary Applications [J] clinic of 7 kinds of herpesvirals
Magazine is tested, 2009 (5): in 363-365. ", extracting the genomic DNA of each virus to get sample to be tested is arrived.
It using sample to be tested as template, is detected using the detection method of embodiment 2, and using sterile water as negative right
According to.
The result is shown in Figure 1.In Fig. 1, abscissa is recurring number, and ordinate is fluorescence signal intensity.As seen from Figure 1, Epstein-Barr virus
Reference material Plasmid DNA obtains S type amplification curve, and amplification is the positive, herpes simplex virus I-form reference material Plasmid DNA, simple
HerpesvirusⅡtype reference material Plasmid DNA, varicella virus reference material Plasmid DNA and cytomegalovirus refer to quality
Grain DNA does not obtain S type amplification curve, and amplification is feminine gender.The result shows that the primer sets of identification Epstein-Barr virus of the invention
With very high specificity.
The sensitivity of embodiment 4, the primer sets of identification Epstein-Barr virus
Sample to be tested are as follows: the Epstein-Barr virus reference material Plasmid DNA of embodiment 3.
1, with 10 times of gradient dilution reference material Plasmid DNA of sterile water, each dilution is obtained.
2, each dilution for taking step 1 to obtain respectively is detected as template using the detection method of embodiment 2, and
Using sterile water as negative control.
Since the dilution of use is different, following different reaction system is formed:
In reaction system 1, the content of reference material Plasmid DNA are as follows: 10000 copies；
In reaction system 2, the content of reference material Plasmid DNA are as follows: 1000 copies；
In reaction system 3, the content of reference material Plasmid DNA are as follows: 500 copies；
In reaction system 4, the content of reference material Plasmid DNA are as follows: 100 copies.
Reference material plasmid is detected by above-mentioned system.
The result shows that the DNA content of Epstein-Barr virus reference material plasmid obtains S type amplification song when being 500-10000 copy
Line, when content is 100 copies and negative control does not obtain S type amplification curve.This is the result shows that identification EB of the invention is sick
The Epstein-Barr virus that 500 copies can be detected of the primer sets of poison, sensitivity with higher.
Embodiment 5, clinical sample detection
Sample to be tested are as follows: by the eye aspirate sample (Epstein-Barr virus positive sample) and process that clinical identification is Epstein-Barr virus
There is no the eye aspirate samples of the healthy person of Epstein-Barr virus for clinical identification.
It using the DNA of sample to be tested as template, is detected using the detection method of embodiment 2, utilizes the EB disease of embodiment 3
Hemlock examines product Plasmid DNA as positive control, and sterile water is as negative control.
As a result see Fig. 2.In Fig. 2, abscissa is recurring number, and ordinate is fluorescence signal intensity.From Figure 2 it can be seen that only EB
Virus-positive sample and positive control obtain S type amplification curve, and it is bent that healthy person sample and negative control do not obtain the amplification of S type
The testing result of line, healthy person sample is consistent with clinical identification result.The result shows that the primer sets of identification Epstein-Barr virus of the invention
When carrying out Epstein-Barr virus identification, as a result accurately and reliably.
Comparative example 1 identifies Epstein-Barr virus using other primers
Sample to be tested are as follows: the Epstein-Barr virus reference material Plasmid DNA of embodiment 3.
1, with 10 times of gradient dilution Epstein-Barr virus reference material Plasmid DNA of sterile water, the dilution of Epstein-Barr virus reference material Plasmid DNA is obtained
Liquid；
2, using the dilution of step as template, the primer sets of identification Epstein-Barr virus of the invention, primer sets A is respectively adopted and draws
Object group B, is detected according to the detection method of embodiment 2, and the copy number of Epstein-Barr virus reference material Plasmid DNA is in reaction system
500, and using sterile water as negative control.
Primer sets A sequence information is as follows:
A-F3:5′-TGTGACCCTTGGGCCTGG-3′
A-B3:5′-CTGGCTCTTTGGCAGGCC-3′
A-FIP:5′-CCATAGACTCCCATGTAATTACATGGGAGTCTATGG-3′
A-FIP:5′-GACAGGGCGCGCATGGCCCAAAAGTAGAGGCTCA-3′
A-LF:5′-CGGGCTGCTGTCTGGCTTA-3′
A-LB:5′-CAGAGCGCCAGGAGTCAT-3′
Primer sets B sequence information is as follows:
B-F3:5′-ATCTAAGGCCAGGAGAGG-3′
B-B3:5′-TAGCAGCAGCGCAGCC-3′
B-FIP:5′-AGCCCCAAAGCGGGTGATTACCTGTTACTGC-3′
B-FIP:5′-ACCATAGACCCGCTTCGGCCTAAAACCCCCAG-3′
B-LF:5′-CGGGCTGTTACTGTCTGGC-3′
B-LB:5′-CAGAGCGCATCCAGGAGT-3′
The result shows that the primer sets of identification Epstein-Barr virus of the invention obtain S type amplification curve, primer sets A, primer sets B and
Negative control does not obtain S type amplification curve.
<110>one groups for detecting the LAMP primer and application of Epstein-Barr virus in intraocular liquid
<120>intelligence moral in Beijing is attained and Co., Ltd, medical test institute
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 17
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 1
gttcgcgttg ctaggcc 17
<210> 2
<211> 21
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 2
aaggggaaaa gttagaaact g 21
<210> 3
<211> 39
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 3
ataccagggg cagtggtccc tctcagtcca gcgcgttta 39
<210> 4
<211> 41
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 4
gtcctgcagc tatttctggt cgctagggag aggtagaaga c 41
<210> 5
<211> 19
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 5
ggctgctgtc tggcttacg 19
<210> 6
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 6
atcagagcgc caggagtc 18
<210> 7
<211> 860
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 7
tgtgaccctt gggcctggct ccccatagac tcccatgtaa gcctgcctcg agtaggtgcc 60
tccagagccc cttttgcccc cctggcggcc cagcccgacc cccgggcgcc cccaaacttt 120
gtccagatgt ccaggggtcc ccgagggcga ggcccagccc cctcccaccc ctgtccactg 180
ccccggtccc cccagaagcc cccaaaagta gaggctcagg ccatgcgcgc cctgtcacca 240
ggcctgccaa agagccagat ctaaggccag gagaggcagc cccaaagcgg gtgcagtaac 300
aggtaatctc tggtagtgat ttggacccaa aatctgacac tttagagctc tggaggactt 360
taaaactcta aaaatcaaaa ctttagaggc gaatgggcgc cattttgtcc ccacgcgcgc 420
ataatggcgg acctaggcct aaaaccccca ggaagcgggt ctatggttgg ctgcgctgct 480
gctatcttta gaggggaaaa gaggaataag cccccagaca ggggagtggg cttgtttgtg 540
acttcaccaa aggtcagggc ccaagggggt tcgcgttgct aggccacctt ctcagtccag 600
cgcgtttacg taagccagac agcagccaat tgtcagttct agggaggggg accactgccc 660
ctggtataaa gtggtcctgc agctatttct ggtcgcatca gagcgccagg agtccacaca 720
aatgtaagag ggggtcttct acctctccct agccctccgc cccctccaag gactcgggcc 780
cagtttctaa cttttcccct tccctccctc gtcttgccct gcgcccgggg ccaccttcat 840
caccgtcgct gactccgcca 860
Claims (9)
1. primer sets are made of primers F 3-1, primer B3-1, primers F IP-1, primer BIP-1, primer LF-1 and primer LB-1；
The primers F 3-1 is following (a1) or (a2):
(a1) single strand dna shown in the sequence 1 of sequence table；
(a2) have by sequence 1 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 1 identical
The single strand dna of function；
The primer B3-1 is following (a3) or (a4):
(a3) single strand dna shown in the sequence 2 of sequence table；
(a4) have by sequence 2 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 2 identical
The single strand dna of function；
The primers F IP-1 is following (a5) or (a6):
(a5) single strand dna shown in the sequence 3 of sequence table；
(a6) have by sequence 3 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 3 identical
The single strand dna of function；
The primer BIP-1 is following (a7) or (a8):
(a7) single strand dna shown in the sequence 4 of sequence table；
(a8) have by sequence 4 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 4 identical
The single strand dna of function；
The primer LF-1 is following (a9) or (a10):
(a9) single strand dna shown in the sequence 5 of sequence table；
(a10) have by sequence 5 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 5 identical
The single strand dna of function；
The primer LB-1 is following (a11) or (a12):
(a11) single strand dna shown in the sequence 6 of sequence table；
(a12) have by sequence 6 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 6 identical
The single strand dna of function.
2. the application of primer sets described in claim 1 is any one following of (b1) into (b6):
(b1) identifying the application in Epstein-Barr virus；
(b2) application in the kit for identifying Epstein-Barr virus is being prepared；
(b3) identifying whether tested bacteria is application in Epstein-Barr virus；
(b4) preparation for identify tested bacteria whether the application in the kit for being Epstein-Barr virus；
(b5) whether contain the application in Epstein-Barr virus in identification sample to be tested；
(b6) preparation for identify sample to be tested whether the application in the kit containing Epstein-Barr virus.
3. application according to claim 2, it is characterised in that: the sample to be tested is eye clinical sample culture, eye
Liquid or aspirate.
4. the kit containing primer sets described in claim 1；The purposes of the kit is following (c1) or (c2) or (c3):
(c1) identify Epstein-Barr virus；
(c2) identify whether tested bacteria is Epstein-Barr virus；
(c3) whether identification sample to be tested contains Epstein-Barr virus.
5. kit according to claim 4, it is characterised in that: the sample to be tested be eye clinical sample culture,
Ocular fluid body or aspirate.
6. application of the kit of claim 4 or 5 in following (c1) or (c2) or (c3):
(c1) identify Epstein-Barr virus；
(c2) identify whether tested bacteria is Epstein-Barr virus；
(c3) whether identification sample to be tested contains Epstein-Barr virus.
7. application according to claim 6, it is characterised in that: the sample to be tested is eye clinical sample culture, eye
Liquid or aspirate.
8. the preparation method of primer sets described in claim 1, including each primer is independently packed.
9. the preparation method of the kit of claim 4 or 5, including dividing each primer of primer sets described in claim 1
Other independent packaging.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810235386.2A CN110295166A (en) | 2018-03-21 | 2018-03-21 | One group for detecting the LAMP primer and application of Epstein-Barr virus in intraocular liquid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810235386.2A CN110295166A (en) | 2018-03-21 | 2018-03-21 | One group for detecting the LAMP primer and application of Epstein-Barr virus in intraocular liquid |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110295166A true CN110295166A (en) | 2019-10-01 |
Family
ID=68025412
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810235386.2A Pending CN110295166A (en) | 2018-03-21 | 2018-03-21 | One group for detecting the LAMP primer and application of Epstein-Barr virus in intraocular liquid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110295166A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017105353A1 (en) * | 2015-12-18 | 2017-06-22 | Agency For Science, Technology And Research | Detection and quantification of target nucleic acid sequence of a microorganism |
-
2018
- 2018-03-21 CN CN201810235386.2A patent/CN110295166A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017105353A1 (en) * | 2015-12-18 | 2017-06-22 | Agency For Science, Technology And Research | Detection and quantification of target nucleic acid sequence of a microorganism |
Non-Patent Citations (2)
| Title |
|---|
| SEIKO IWATA等: "Rapid detection of Epstein–Barr virus DNA by loop-mediated isothermal amplification method", 《JOURNAL OF CLINICAL VIROLOGY》 * |
| TSUGUNORI NOTOMI等: "Loop-mediated isothermal amplification of DNA", 《NUCLEIC ACIDS RESEARCH》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yoshikawa et al. | Detection of human herpesvirus 7 DNA by loop-mediated isothermal amplification | |
| Druce et al. | Utility of a multiplex PCR assay for detecting herpesvirus DNA in clinical samples | |
| de Jong et al. | Quantitation of varicella-zoster virus DNA in whole blood, plasma, and serum by PCR and electrochemiluminescence | |
| US5231015A (en) | Methods of extracting nucleic acids and pcr amplification without using a proteolytic enzyme | |
| Whiley et al. | Detection and differentiation of human polyomaviruses JC and BK by LightCycler PCR | |
| Minjolle et al. | Amplification of the six major human herpesviruses from cerebrospinal fluid by a single PCR | |
| Norton et al. | Detection of human herpesvirus 6 by reverse transcription-PCR | |
| US6475729B1 (en) | Nucleic acid amplification and detection methods using rapid polymerase chain reaction cycle | |
| CN102399866A (en) | Generic buffer for amplification | |
| Zhang et al. | Detection of Chlamydia trachomatis by isothermal ramification amplification method: a feasibility study | |
| IE902410A1 (en) | Improvements to the techniques of amplification of nucleic¹acid | |
| CN112592992A (en) | Primer probe set and kit for combined detection of mycoplasma pneumoniae and chlamydia pneumoniae based on fluorescent RMA method | |
| CN110295166A (en) | One group for detecting the LAMP primer and application of Epstein-Barr virus in intraocular liquid | |
| WO2022257663A1 (en) | Method and kit for detecting and screening n501y mutation in covid-19 | |
| CN113234866B (en) | Detection kit for synchronously detecting pathogens of multiple blood circulation systems and detection method thereof | |
| US6465171B1 (en) | CoRT-PCR assay for the discrimination of endogenous reverse transcriptase activity in eukaryotic cell lines from infectious retrovirus contamination | |
| KR101678553B1 (en) | Oligonucleotide kit for detecting Epstein-Bar virus and EBV detecting methods using the same | |
| US6268127B1 (en) | Method for preparing DNA from serum and plasma | |
| US20070202522A1 (en) | Isothermal screening of tumor cell related nucleic acids | |
| CN111394510B (en) | High-speed and high-sensitivity nucleic acid detection box and method suitable for swab sample | |
| CN112553357A (en) | Nested PCR (polymerase chain reaction) detection primer group and kit for equine piroplasmosis and application of nested PCR detection primer group and kit | |
| CN112646928A (en) | Detection kit and detection method for VSVG gene residual quantity | |
| CN102260748A (en) | Method for detecting human cytomegalovirus by loop-mediated isothermal amplification, kit for detection and primer group | |
| Kunisada et al. | Detection of human immunodeficiency virus-1 nucleic acid on inactivated filter paper disks by polymerase chain reaction and microtiter plate assay | |
| CN110295165A (en) | One group for detecting the LAMP primer and application of mycobacterium tuberculosis in intraocular liquid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20191230 Address after: 100020 No. 8 South Road, workers' Stadium, Beijing, Chaoyang District Applicant after: BEIJING CHAO-YANG HOSPITAL, CAPITAL MEDICAL University Address before: The three District 101300 Beijing City Renhe Town, Shunyi District LAN Xiyuan 37 building two layer (innovation function area) Applicant before: BEIJING ZHIDE MEDICAL LABORATORY CO.,LTD. |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191001 |