CN110257422A - The application of OsGPT1 gene and application method - Google Patents

Abstract

The application of OsGPT1 gene and application method, belong to field of biotechnology.One aspect of the present invention provides a kind of OsGPT1 gene, on the other hand provides application and the application method of the OsGPT1 gene.The invention has the following advantages: applicant is had found by the research to OsGPT1 gene, the overexpression of OsGPT1 gene can be realized the increase of rice paddy seed in rice and mass of 1000 kernel increases, based on this, the present invention is by being in rice overexpressed the OsGPT1 gene, with the size of adjusting and controlling rice and mass of 1000 kernel, the improvement to rice varieties is realized.

Description

The application of OsGPT1 gene and application method

Technical field

The invention belongs to field of biotechnology, and in particular to the application of OsGPT1 gene and application method.

Background technique

Rice is that most populous cereal crops are eaten on the earth.8 must be reached to the yield of rice in 2025 according to estimates Hundred million tons of problems of food and clothing that just can solve population on the earth, and rice annual output in 2003 is 5.85 hundred million tons (Virk PS, 2004), Therefore the output per hectare that is averaged of worldwide rice needs to increase 5-8.5 twenties years from 2003 to 2025 year Ton.And with the reduction year by year of cultivated area, Monitoring of Paddy Rice Plant Area is also declining year by year, therefore the units increased in production of per hectare is to 2025 Year will should just can solve the problem of food and clothing of world population much higher than estimated output.

The organelle that starch is stored in higher plant endosperm is plastid -- the amyloplast (Amyloplast) of eggcase, It is mainly used for the synthesis and storage (Sakamoto et al., 2008) of starch.Starch is assembled into transparent in amyloplast Grain -- amylum body (Starch grains, SGs).Because the inner space overwhelming majority of amyloplast is all starch filled, make The volume of powder is nearly identical to the volume of amylum body (SGs).The diameter of amylum body (SGs) is about 10-20 μm in paddy endosperm (Matsushima et al., 2010), and only include an amylum body (SGs) in each amyloplast, but each amylum body It (SGs) is clearly demarcated polyhedron -- starch granules (Starch granules) group of water chestnut for being about 3-8 μm by many diameters At.

G-6-P/phosphoric acid transporter (Glucose-6-phosphate/phosphate translocator, GPT) specifically G-6-P (Glucose-6-phosphate, Glc6P) can be transported into plastid, while will be inorganic Phosphoric acid (P_i) or triose phosphate (Triose phosphates, TPs) transport out plastid.In plastid, Glc6P can be used as important Synthesis of the precursor substance for starch or fatty acid.Rice is important cereal crops, the synthesis and product of starch in plastid It is tired to be of great significance not only for rice yield, and for maintaining the normal fertility of male gametophyte pollen also significant. AtGPT1 function in arabidopsis pollen development is particularly significant, but the functional study of its homologous gene in rice or sky It is white.

RNA-seq data analysis shows: in Endosperm Development in Oryza sativa L early and middle portion, with ribosomes assembling, shearing and oxygen Change the relevant gene of phosphorylation to be expressed；Plant hormone, galactose metabolism and carbon fixation related gene are in endosperm development mid-term Significant up-regulation；It is but expressed in the later period height of endosperm development with plant disease-resistant, stress response and sugar or starch metabolism related gene (Gao et al.,2013).By the amino acid sequence of corn GPT, clone in rice (Oryza sativa L.) OsGPT1.In addition, also predicted in rice genome database other two OsGPT2-1 (LOC_Os07g33954) and (OsGPT2-1 has only lacked one section of 60aa, the ammonia of remainder in N-terminal than OsGPT2-2 to OsGPT2-2 (LOC_Os07g34006) Base acid sequence is identical, and the segment of the 60aa of OsGPT2-1 missing appears in its 5 ' end UTR region being predicted, Theoretically the two genes can go out identical protein sequence with transcription and translation, but since position on chromosome is different, Promoter region sequence is different, therefore the two genes are named as OsGPT2-1 and OsGPT2-2).Due to OsGPT2-1 and The CDS sequence of OsGPT2-2 be it is identical, cannot be distinguished, therefore the resulting result of fluorescent quantitative PCR experiment is The summation (being labeled as OsGPT2-1&2-2) of OsGPT2-1 and OsGPT2-2 expression quantity.But it is analyzed by our quantitative fluorescent PCRs It was found that only OsGPT1 high expression in rice paddy seed, and OsGPT2 expression quantity in Mature seed of rice is far below OsGPT1, And OsGPT2 does not express (Fig. 1) in endosperm.Fluorescent quantitative PCR result explanation, OsGPT1 is in rice paddy seed endosperm development mistake It is more important than OsGPT2-1&OsGPT2-2 in journey.

Summary of the invention

In view of the problems of the existing technology, it is an object of the invention to design to provide the application and application of OsGPT1 gene The technical solution of method.

The specific technical solution that the present invention uses is as follows:

Described one kind makes rice paddy seed increase and the increased method of mass of 1000 kernel, it is characterised in that in rice by OsGPT1 Gene overexpression, to obtain seed increase and the increased rice plant of mass of 1000 kernel.

Described one kind makes rice paddy seed increase and the increased method of mass of 1000 kernel, it is characterised in that the OsGPT1 gene sequence Column are as shown in SEQ ID No.1.

Described one kind makes rice paddy seed increase and the increased method of mass of 1000 kernel, it is characterised in that specifically includes following step It is rapid:

1) expression vector of the OsGPT1 and eYFP fusion protein of the promoter starting of OsGPT1 is constructed, carrier framework is pCAMBIA3300；

2) utilize Agrobacterium by pCAMBIA3300-P_OsGPT1: OsGPT1-eYFP carrier, P_OsGPT1: OsGPT1-eYFP sequence It such as SEQ ID NO.4, is transformed into Rice Callus, screening obtains the rice plant of OsGPT1-eYFP expressing fusion protein.

The OsGPT1 gene overexpression is promoting the application in rice paddy seed increase and mass of 1000 kernel increase.

Application of the OsGPT1 gene in the rice plant of preparation seed station.

The application, it is characterised in that in rice by OsGPT1 gene overexpression, to obtain seed increase and thousand The increased rice plant of weight.

A kind of promotion rice paddy seed increases and the construction method of the increased over-express vector of mass of 1000 kernel, feature exist In the following steps are included: expanding P from rice genome_OsGPT1: OsGPT1, in the pBTYWG2 carrier comprising pLAT52-eYFP Middle amplification eYFP expands the terminator of OsGPT1, using seamless integration kit, by P from rice genome_OsGPT1: The terminator of OsGPT1, eYFP and OsGPT1 carry out seamless integration with the pCAMBIA3300 after being linearized by BamH I and Xba I, It is promoted rice paddy seed increase and the increased over-express vector of mass of 1000 kernel.

The promotion rice paddy seed increases and the increased over-express vector of mass of 1000 kernel.

OsGPT1 gene provided by the invention is a G-6-P/phosphoric acid transhipment on No. 8 chromosome of rice Body gene, gene number is Os08g0187800 (NCBI number), LOC_Os08g08840 (MSU number).The gene of OsGPT1 Group DNA overall length 2632bp contains 5 exons altogether, and (wherein uppercase indicates exon to sequence as shown in SEQ ID NO.1 (exon), small letters indicate introne (intron)), structure chart is shown in Fig. 2.The gene coding region the OsGPT1 CDS whole audience is 1164bp, sequence is as shown in SEQ ID NO.2；OsGPT1 gene encodes 387 amino acid, particular sequence such as SEQ ID NO.3 It is shown.OsGPT1 albumen contains the transmembrane spanning α-helices (I-VI) of 6 hypothesis, and arrow indicates transporter cracking site, OsGPT1 It is compared with GPT albumen in other species and sees Fig. 3.

The genomic DNA full length sequence of OsGPT1: OsGPT1 genome sequence (Genomic DNA), wherein uppercase It indicates exon (exon), small letters indicate introne (intron).

ATGCTACCTGCTGTGAAGCTCTCTCCTGGCCCTGTGGCCTTCGCTGGCACCAATCTACGGTCCAGATC AGCTTCGGTTTCATCTGTCTCAAGTCTCAAACCATCCAAATTTGTGGTCTCTTCACTCAGACCACTCTACCTTGCA CCACTAGATGGCCCAAGAGCTGCTGGGCAAAAGGCTCAGAGGCAGCCACTTGAGTTCAGGTGTGCTGCTTCCGCAG CCGATGACAAGGAGTCTAAGACCGAGGTGGTGCCCGTCCGCTCGGAAGCTGCCCAGAAGCTGAAGATCTCCATCTA TTTCGCGACATGGTGGGCGCTTAATGTGATCTTTAACATCTACAACAAGAAGGTTCTCAATGCTTTCCCATACCCC TGGCTCACTTCTACGCTCTCCCTTGCCTGCGGCTCTGCGATGATGCTTGTCTCATGGGCCACTCGCCTTGTTGAGG CCCCCAAGACTGACCTAGATTTCTGGAAAGTTCTTTTCCCGGTgagtggaatctttttcttggcaattatttgtat atttgctgtgcctgcttgggcaagcatgattgattttggctattttccttttgaaggtTGCTGTGGCTCATACAAT TGGGCATGTTGCTGCGACAGTGAGTATGTCAAAAGTAGCAGTGTCATTCACACACATTATCAAAAGTGCAGAGCCT GCATTCAGTGTTTTGGTATCAAGGTTCCTTCTTGGGGAGACGTTTCCGGTTCCTGTATATCTTTCTCTTCTTCCAA TCATTGGTGGATGTGCTCTTGCTGCTGTCACAGAGCTGAACTTTAACATGGTTGGtaagtatatatttcgaaatcg atgcatattctgctatgagcttatgaaccattatagccgcaatgctaatttgtataaacgatgagtagccgtgagc caactgaagtggttgctttagtaatcaatactttaatactatgttttaacacaaaatggcttattagatgattatt ttgccccatctggatgtctgtttttcaggaattgcaatgttcttgagattagaatttacaggaaataataaacagt aacagatcatagatacaacctattaaccttatctaatttaattgttatgaaaacaggtgcaattatattctccttt ataccagaagatacatgcttaagtctttttttctcatttcttcctgaagttccatgcgtagatttatgtttaagaa caaaacgaaataggagtcataggctctgtaattgtttccagtggtctggtcttgctcaggttagctcaggcaggtc ttctcctgttctctttctcttgatgttaacagttgttgtttctcctcataccaggATTCATGGGTGCCATGATATC AAACCTTGCATTTGTTTTCCGCAACATCTTCTCAAAGAGGGGCATGAAGGGGAAATCTGTCAGTGGCATGAATTAC TATGCCTGCCTGTCGATAATGTCCCTTGTCATACTCACACCATTCGCTATCGCTATGGAGGGCCCTCAAATGTGGG CTGCTGGTTGGCAAAAGGCTCTTGCGGAAGTTGGTCCCAATGTTGTCTGGTaagcaataaaataaaccaagcatcc tttaatttttcttcagcaattgctattttgtagcccgtagttttgtacttgtgttacataggacaactcagaatga acattattttcaccttaggagatatcattcatatgcttacatatttaacacacttttaagagaccattggtttcac tcttgtgctggacttagtttgggattttggccagtctttgctggcatgtattgatatattgtgttttatgtactgg acatattttggaatttacccagtctttgctggcatggattgatatattgtatttgatgatttacaacatactacag cgtatgcagcaacacttgagtattttattgatattacttaaattttggggatgttgaatattgtaggtGGGTTGCT GCACAGAGCGTTTTCTACCACTTATACAACCAGGTGTCTTACATGTCTCTGGATGAGATTTCTCCATTGACATTTA GCATTGGCAATACGATGAAGCGTATATCTGTGATTGTTTCGTCAATCATTATCTTCCACACACCTGTCCGCCCTGT CAATGCACTAGGAGCTGCCATTGCCATCCTTGGCACATTCCTGTATTCTCAGGtaaattcttgctttgatatttta ctttagccgtgcttgccctgtgtatacttcaaacaaactttcttttccctgcacgagaaggatgacattttgtata tagtattgtccacgtgtggtttgacattgatgtggaaaaacaggcagctactttgtgaatatgcttgattttaaat cctttccgctcaattataagcaggatggattggtaaatgatatgttactatcaactgtaattagactgcagagtat tttagttcattcttttgctataggaggtaatatcacttgaaagaggaaatctgaaaacatgagggagtaaatacga ctgcataagcttctgctgcacctgacttattcctccaatgccatatttatcctaaacatttttttttggttgtagc tgacgttttcttttctttacttacttttttaatttctgtttcaggCAAAGCAGTGA。

The invention has the following advantages: applicant by OsGPT1 gene the study found that in rice The overexpression of OsGPT1 gene can be realized the increase of rice paddy seed and mass of 1000 kernel increases, and be based on this, the present invention passes through in rice In the OsGPT1 gene is overexpressed, with the size of adjusting and controlling rice and mass of 1000 kernel, realize the improvement to rice varieties.

Detailed description of the invention

The expression figure of Fig. 1 OsGPT1 and OsGPT2 in rice paddy seed；OsGPT1 high expression in rice paddy seed in figure, And OsGPT2 expression quantity in Mature seed of rice is far below OsGPT1, and OsGPT2 is not expressed in endosperm.With Actin1 As reference gene.(3 independent biochemicals repeat the method that statistical analysis has used Student ' s t to examine, every secondary pollutant Repeat 3 technical repetitions.* *, P < 0.001).

Fig. 2 OsGPT1 gene structure figure.

GPTs is highly conserved in Fig. 3 rice, arabidopsis, corn, sorghum, potato and poplar, the cross-film of 6 hypothesis in figure Alpha-helix (I-VI), arrow indicates transporter cracking site.

Fig. 4 pCAMBIA3300-P_OsGPT1: OsGPT1-eYFP carrier figure.

Fig. 5 P_OsGPT1: the electrophoretogram of the PCR product of the terminator of OsGPT1, eYFP and OsGPT1.

Fig. 6 is overexpressed OsGPT1 seed and becomes larger, (A) P in figure_OsGPT1: OsGPT1-eYFP Nip#5 seed becomes larger；(B) P_OsGPT1: OsGPT1-eYFP Nip#5 mass of 1000 kernel increases 12.7%；(C)P_OsGPT1: OsGPT1-eYFP Nip#5 does female parent, wild Raw type does male parent, and hybrid seed becomes larger；(D)P_OsGPT1: OsGPT1 expression quantity is approximately wild in OsGPT1-eYFP Nip#5 material 19 times of type, Bar=2mm.

Fig. 7 P_OsGPT1: OsGPT1-eYFP is expressed on the plastid film of rice protoplast, by P in figure_OsGPT1:OsGPT1- EYFP fusion and fluorescence probe plastid marker (pt-rk CD3-999) cotransformation are used into rice protoplast Confocal is observed, and Bar=10 μm.

Fig. 8 P_OsGPT1: OsGPT1-eYFP is expressed on OryzasativaLcv.Nipponbare seed amyloplast film, and Bar=10 μm.

Specific embodiment

The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..

Test method without specific conditions in following embodiment is carried out according to conventional steps, material therefor and examination Agent is commercial goods.

The positioning of embodiment 1:OsGPT1

Although all isolating and purifying or cloning in the species such as rice, arabidopsis, corn, sorghum, potato and poplar to obtain GPTs, but GPTs is rarely reported in the subcellular localization of active somatic cell.We are turned by the rice protoplast that PEG is mediated Change (Zhang et al., 2011), by P_OsGPT1: OsGPT1-eYFP and fluorescence probe plastid marker (pt-rk CD3-999) (Nelson et al., 2007) for cotransformation into rice protoplast, subcellular localization photo is shown in Fig. 7.Specific experiment method It is as follows:

(1) rice protoplast preparation and conversion.

The preparation and conversion of rice protoplast are to be separated from the stem and leaf sheath of the rice seedling of yellow by enzymatic isolation method Rice protoplast out, and the conversion (Zhang et al., 2011) for carrying out plasmid is mediated by PEG.The specific method is as follows:

1. being seeded in after rice paddy seed is sterilized in the solid medium that sterile Phytagel and MES are prepared, each glass Glass test tube sows about 2-3 seed.

2. dark culture 4-5 days again after a week by rice paddy seed optical culture.

3. taking out the rice seedling of yellow, Ye Hegen is cut, remaining tissue is cut into the fragment of about 0.1mm, incision is not It can cut repeatedly, with the cell of tamper-proof incision.

4. the enzymolysis liquid of appropriate volume is added in minced tissue, 1h is vacuumized, 40rpm is then protected from light and shakes incubation 5h, be added Isometric W5 solution is mixed with hand jog 2min and discharges protoplast.

5. room temperature, 1500rpm is centrifuged 4min with the nylon net filter of 4 layer of 400 mesh.Supernatant is carefully outwelled, W5 weight is added It is outstanding, repeated centrifugation, then plus W5 be resuspended, ice sets 30min, repeated centrifugation.

6. abandoning supernatant, adds the Suspension medium of certain volume that protoplast is resuspended, calculated simultaneously with blood counting chamber Adjustment protoplast concentration is 2.5-5X10⁶/mL。

7. the plasmid of 6-8 μ g and 40% PEG of 220 μ L, room temperature are added in the protoplast for the 200 μ L for mixing up concentration It is protected from light and is incubated for 2min, 1mL W5 is added and terminates reaction.

8. 28 DEG C of dark culturings are stayed overnight.With the fluorescence signal in Nikon C2 confocal detection protoplast. P_OsGPT1: OsGPT1-eYFP is observed with the channel 500-550nm FITC, plastid marker with the channel PI of 575-615nm into Row observation.

Experimental result: P_OsGPT1: OsGPT1-eYFP fusion and fluorescence probe plastid marker cotransformation to rice In protoplast, P can be clearly seen that by the result (Fig. 7) that Confocal is observed_OsGPT1: OsGPT1-eYFP is in rice original It is expressed on raw plastid film, this expresses position consistency with the GPTs for isolating and purifying GPTs and prediction in other species.P_OsGPT1: OsGPT1-eYFP sequence is as shown in SEQ ID NO.1.

(2)pCAMBIA3300-P_OsGPT1: the building of OsGPT1-eYFP carrier (carrier is shown in Fig. 4).The specific method is as follows:

P is expanded from rice genome_OsGPT1: OsGPT1, from the existing pBTYWG2 carrier comprising pLAT52-eYFP EYFP is expanded, the terminator of OsGPT1 is expanded from rice genome.Using seamless integration kit, by P_OsGPT1:OsGPT1、 The terminator of eYFP and OsGPT1 carries out seamless integration with the pCAMBIA3300 after being linearized by BamH I and Xba I.Clone obtains The electrophoretogram of each segment see Fig. 5.Primer sequence is shown in SEQ ID NO.5-10.

Using the genomic DNA of wild type Nip as template, genomic is amplified with high-fidelity DNA polymerase Phusion DNA and Terminator.

PCR response procedures are as follows:

2-4 step carries out 30 reactions

72℃ 10min

It is template from the existing pBTYWG2 carrier comprising pLAT52-eYFP in laboratory, uses high-fidelity DNA polymerase Phusion expands eYFP.

PCR response procedures are as follows:

2-4 step carries out 30 reactions

72℃ 10min

PCR product carries out 1% agarose electrophoresis, cuts purpose band, with the plastic recovery kit recovery purifying mesh of raw work Band.

Wherein n (target fragment): n (carrier)=2:1, ratio is 1:1 between each target fragment.

Experimental procedure:

1. placing 30min in 45 DEG C of water-baths again after target fragment and carrier are mixed, it is transferred on ice.

2. inhaling 5 μ L reaction solutions to be added in the large intestine competence that 50 μ L dissolve on ice, continue to place 20min on ice.

3. 42 DEG C of water-baths place 1min, 2min is placed on ice.

4. the LB liquid medium of 1mL is added, 37 DEG C, 200rpm, 1h recovery.

5. 4850rpm, 2min are coated on the plate of Kan resistance, 37 DEG C of inversion overnight incubations.

(3)P_OsGPT1: the acquisition of OsGPT1-eYFP Nip transgenic line.

With containing pCAMBIA3300-P_OsGPT1: the EHA105 of OsGPT1-eYFP carrier infects Rice Callus, and in It is co-cultured 3 days in 22 DEG C of culturing room, then after washing away Agrobacterium with fluid nutrient medium, Rice Callus is placed on containing suitable It is cultivated on the Selective agar medium of antibiotic, by resistance screening twice.It can get kanamycin-resistant callus tissue after resistance screening, by kanamycin-resistant callus tissue It is divided into seedling again, plants in rice greenhouse, specifically:

1. rice paddy seed sterilizes:

Mature seed of rice is taken, artificial or mechanical dejacketing selects the seed of full bright and clean no bacterial plaque, disappears according to the following steps Poison:

1) seed is put into 100mL sterile beaker, pours into 70% alcohol (15mL) disinfection 2min；

2) alcohol is removed, 30% sodium hypochlorite of 100mL (NaClO) solution is added, impregnates 30min；

3) liquor natrii hypochloritis is gone, is cleaned seed 4-5 times with sterile distilled water, last is all over immersion 30min.

2. induction and squamous subculture: (following steps need sterile working)

1) seed is placed on aseptic filter paper and blots, in merging achievement embryonal induction culture medium, 20-30, every ware；

2) end of operation sealed membrane (Micropore^TMSurgical Tape) culture dish is sealed, it is trained in 28 DEG C of illumination Support case culture.Japonica rice Fiber differentiation 3-4 weeks.

3) culture dish is opened on superclean bench, embryo callus (faint yellow, the cause divided naturally with tweezers picking It is close in spherical), be placed in subculture medium, in 28 DEG C of illumination boxs, squamous subculture 1 week.

3. Agrobacterium is cultivated

Picking electricity turns pCAMBIA3300-P_OsGPT1: the Agrobacterium monoclonal of OsGPT1-eYFP carrier draws institute's preservation PCAMBIA3300-P is converted_OsGPT1: 50 μ L of OsGPT1-eYFP vector Agrobacterium bacterium solution (contains in the LB liquid medium of 5mL 50mg/L kanamycins and 50mg/L streptomysin), 28 DEG C, 250rpm shaken cultivation 12-16h to bacterium solution OD₆₀₀For 0.8-1.0.

4. sense bacterium and co-culturing: taking and cultured converted pCAMBIA3300-P_OsGPT1: OsGPT1-eYFP carrier bacterium solution 500 μ L are in 1.5mL centrifuge tube, room temperature, 4000rpm, are centrifuged 2min, remove supernatant.With containing 200 μm of ol/L acetosyringones Suspension, bacterium solution final concentration OD is made in 30mL AAM sense bacterium solution₆₀₀It is 0.01；The Rice Callus for growing to a certain size is chosen Out, it is put into agrobacterium suspension, 5min is rocked with 80rpm on horizontal shaker；Callus is taken out, sterile filter paper is placed in On drain 30-40min；Callus is placed on the co-cultivation base an of aseptic filter paper.25 DEG C dark culture 3 days.

5. selection culture: callus being taken out, with sterile water wash 5-6 times, needs ceaselessly to vibrate therebetween.Again with containing The sterile water wash of 300mg/L carbapen 2 times, rocks 30min on horizontal shaker every time.Finally it is placed in aseptic filter paper On drain 2h；The Selective agar medium that the callus dried is transferred to carbapen containing 300mg/L and corresponding screening pressure is enterprising Row first round selection, 28 DEG C, illumination cultivation 14 days.Initial callus with kanamycin-resistant callus tissue is gone into the benzyl mould of carboxylic containing 300mg/L It carries out the second wheel on the culture medium of plain sodium and corresponding screening pressure to select, 28 DEG C, illumination cultivation, until the kanamycin-resistant callus tissue of graininess Tissue grows (about 14 days).

6. the induction of resistant calli is broken up and takes root: the kanamycin-resistant callus tissue 3- for the color cadmium yellow that picking comes from different callus It 5, moves into the plastic jar equipped with differential medium, seals with sealing film, be put into constant temperature (25 DEG C) culturing room (light week Phase: 16h illumination), it waits seedling differentiation (about 40 days).To seedling length to 3cm or so, old root and callus are cut off from seedling base portion with scissors Tissue, is put into strong sprout in root media (about 1 week).

7.OsGPT1 is located at phosphoric acid transporter on plastid film, in order to verify OsGPT1 on paddy endosperm amyloplast Expression, we take out P_OsGPT1: the endosperm of seed after OsGPT1-eYFP Nip material is bloomed 4 days, under Confocal into Row observation.Observation indicate that P_OsGPT1: OsGPT1-eYFP expression is assembled into amyloplast on the amyloplast film in endosperm Starch granules (Starch granules) film on have no expression (Fig. 8).

Embodiment 2: obtaining OsGPT1 and be overexpressed material, and seed becomes larger, and mass of 1000 kernel increases

In plantation P_OsGPT1: find that the seed of the material increases when OsGPT1-eYFP Nip#5 material, mass of 1000 kernel increases About 12.7%.Have detected P_OsGPT1: the expression of OsGPT1 is raised in OsGPT1-eYFP Nip#5, OsGPT1 expression in about Nip 19 times (Fig. 6) of amount.In addition, we are by P_OsGPT1: OsGPT1-eYFP Nip#5 material is it with the pollen of Nip as female parent Pollination, finds the seed and Nip as female parent, Nip has been compared as the hybrid seed of male parent significantly to be increased, and has been dashed forward Break the size (Fig. 6) of original glume.

Specific experimental method is as follows:

(1) in rich amyloid rice paddy seed RNA extracting method

Use TransGen TransZol Plant (catalog number (Cat.No.): ET101-01) reagent.The mortar of rice paddy seed pre-cooling It is fully ground into powder, the extraction of RNA is then carried out according to the protocol of TransGen TransZol Plant.

(2) DNA in RNA is digested

The RNA of extraction has the pollution of genomic DNA, carries out processing digestion to DNA with DNase.DNase system for handling It is as follows:

Totally 25 μ L system, wherein RNA can handle 5-10 μ g, residual volume DEPC-H according to demand₂O is supplied.

Experimentation is as follows:

1. the DNase system for handling of 25 μ L mixed in PCR pipe after in 37 DEG C of placement 1h.

2. the DNase inactivation reagent of 2.5 μ L is added, 5min is placed at room temperature for after being sufficiently mixed.Purpose is DNase is subjected to inactivation processing.

3. centrifugation: 22 DEG C, 10000rpm, 5min.The careful supernatant for drawing 20 μ L surveys the dense of RNA in new PCR pipe Degree.

4. by DNase, treated that RNA is put in that -80 DEG C of refrigerators save.

(3) reverse transcription of RNA

RNA carries out reverse transcription reaction, synthesizes cDNA.Steps are as follows:

1. 65 DEG C of incubations RNA and OligdT23primer, 5min.System is as follows:

DEPC-H₂O *

OligdT23 1μL

RNA *

RNA can be according to experiment demand reverse transcription 500-1000ng, total system 5 μ L, residual volume DEPC-H₂O is supplied.

2. RT mix is added in the above system.

The RT mix system of 15 μ L is as follows:

Reaction condition is as follows:

(4) RT-PCR is analyzed

The cDNA that reverse transcription obtains is diluted 40 times as template according to experiment demand, is made with rice Actin1 gene For reference gene.RT-PCR primer sequence is shown in SEQ ID NO.11-14.

RT-PCR reaction system is as follows:

Diluted 5 μ L of cDNA

1.2μM primers 5μL

2 X RT-PCR mix 10μL

(5) it is overexpressed investigation of the OsGPT1 rice plant in terms of seed size and mass of 1000 kernel

OsGPT1 gene provided by the invention has very high application value in terms of rice paddy seed size and mass of 1000 kernel.It is logical It crosses and the seed RNA of the transgenic line of acquisition is extracted, after reverse transcription, RT-PCR detects the expression quantity of OsGPT1.RT-PCR inspection Survey discovery P_OsGPT1: the expression of OsGPT1 is raised in OsGPT1-eYFP Nip#5,19 times of OsGPT1 expression quantity in about Nip (Fig. 6).P_OsGPT1: OsGPT1-eYFP Nip#5 seed size and mass of 1000 kernel are all improved than control, specifically as shown in Figure 6.

(6)P_OsGPT1: the hybridization of OsGPT1-eYFP Nip#5 material and OryzasativaLcv.Nipponbare

P_OsGPT1: OsGPT1-eYFP Nip#5 material is pollinated with the pollen of Nip for it as maternal, find the seed with For Nip as female parent, Nip has compared the size for significantly increasing, and having broken through original glume as the hybrid seed of male parent (Fig. 6).

Sequence table

<110>Zhejiang University

<120>application of OsGPT1 gene and application method

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2632

<212> DNA

<213>rice (Oryza sativa L.)

<400> 1

atgctacctg ctgtgaagct ctctcctggc cctgtggcct tcgctggcac caatctacgg 60

tccagatcag cttcggtttc atctgtctca agtctcaaac catccaaatt tgtggtctct 120

tcactcagac cactctacct tgcaccacta gatggcccaa gagctgctgg gcaaaaggct 180

cagaggcagc cacttgagtt caggtgtgct gcttccgcag ccgatgacaa ggagtctaag 240

accgaggtgg tgcccgtccg ctcggaagct gcccagaagc tgaagatctc catctatttc 300

gcgacatggt gggcgcttaa tgtgatcttt aacatctaca acaagaaggt tctcaatgct 360

ttcccatacc cctggctcac ttctacgctc tcccttgcct gcggctctgc gatgatgctt 420

gtctcatggg ccactcgcct tgttgaggcc cccaagactg acctagattt ctggaaagtt 480

cttttcccgg tgagtggaat ctttttcttg gcaattattt gtatatttgc tgtgcctgct 540

tgggcaagca tgattgattt tggctatttt ccttttgaag gttgctgtgg ctcatacaat 600

tgggcatgtt gctgcgacag tgagtatgtc aaaagtagca gtgtcattca cacacattat 660

caaaagtgca gagcctgcat tcagtgtttt ggtatcaagg ttccttcttg gggagacgtt 720

tccggttcct gtatatcttt ctcttcttcc aatcattggt ggatgtgctc ttgctgctgt 780

cacagagctg aactttaaca tggttggtaa gtatatattt cgaaatcgat gcatattctg 840

ctatgagctt atgaaccatt atagccgcaa tgctaatttg tataaacgat gagtagccgt 900

gagccaactg aagtggttgc tttagtaatc aatactttaa tactatgttt taacacaaaa 960

tggcttatta gatgattatt ttgccccatc tggatgtctg tttttcagga attgcaatgt 1020

tcttgagatt agaatttaca ggaaataata aacagtaaca gatcatagat acaacctatt 1080

aaccttatct aatttaattg ttatgaaaac aggtgcaatt atattctcct ttataccaga 1140

agatacatgc ttaagtcttt ttttctcatt tcttcctgaa gttccatgcg tagatttatg 1200

tttaagaaca aaacgaaata ggagtcatag gctctgtaat tgtttccagt ggtctggtct 1260

tgctcaggtt agctcaggca ggtcttctcc tgttctcttt ctcttgatgt taacagttgt 1320

tgtttctcct cataccagga ttcatgggtg ccatgatatc aaaccttgca tttgttttcc 1380

gcaacatctt ctcaaagagg ggcatgaagg ggaaatctgt cagtggcatg aattactatg 1440

cctgcctgtc gataatgtcc cttgtcatac tcacaccatt cgctatcgct atggagggcc 1500

ctcaaatgtg ggctgctggt tggcaaaagg ctcttgcgga agttggtccc aatgttgtct 1560

ggtaagcaat aaaataaacc aagcatcctt taatttttct tcagcaattg ctattttgta 1620

gcccgtagtt ttgtacttgt gttacatagg acaactcaga atgaacatta ttttcacctt 1680

aggagatatc attcatatgc ttacatattt aacacacttt taagagacca ttggtttcac 1740

tcttgtgctg gacttagttt gggattttgg ccagtctttg ctggcatgta ttgatatatt 1800

gtgttttatg tactggacat attttggaat ttacccagtc tttgctggca tggattgata 1860

tattgtattt gatgatttac aacatactac agcgtatgca gcaacacttg agtattttat 1920

tgatattact taaattttgg ggatgttgaa tattgtaggt gggttgctgc acagagcgtt 1980

ttctaccact tatacaacca ggtgtcttac atgtctctgg atgagatttc tccattgaca 2040

tttagcattg gcaatacgat gaagcgtata tctgtgattg tttcgtcaat cattatcttc 2100

cacacacctg tccgccctgt caatgcacta ggagctgcca ttgccatcct tggcacattc 2160

ctgtattctc aggtaaattc ttgctttgat attttacttt agccgtgctt gccctgtgta 2220

tacttcaaac aaactttctt ttccctgcac gagaaggatg acattttgta tatagtattg 2280

tccacgtgtg gtttgacatt gatgtggaaa aacaggcagc tactttgtga atatgcttga 2340

ttttaaatcc tttccgctca attataagca ggatggattg gtaaatgata tgttactatc 2400

aactgtaatt agactgcaga gtattttagt tcattctttt gctataggag gtaatatcac 2460

ttgaaagagg aaatctgaaa acatgaggga gtaaatacga ctgcataagc ttctgctgca 2520

cctgacttat tcctccaatg ccatatttat cctaaacatt tttttttggt tgtagctgac 2580

gttttctttt ctttacttac ttttttaatt tctgtttcag gcaaagcagt ga 2632

<210> 2

<211> 1164

<212> DNA

<213>rice (Oryza sativa L.)

<400> 2

atgctacctg ctgtgaagct ctctcctggc cctgtggcct tcgctggcac caatctacgg 60

tccagatcag cttcggtttc atctgtctca agtctcaaac catccaaatt tgtggtctct 120

tcactcagac cactctacct tgcaccacta gatggcccaa gagctgctgg gcaaaaggct 180

cagaggcagc cacttgagtt caggtgtgct gcttccgcag ccgatgacaa ggagtctaag 240

accgaggtgg tgcccgtccg ctcggaagct gcccagaagc tgaagatctc catctatttc 300

gcgacatggt gggcgcttaa tgtgatcttt aacatctaca acaagaaggt tctcaatgct 360

ttcccatacc cctggctcac ttctacgctc tcccttgcct gcggctctgc gatgatgctt 420

gtctcatggg ccactcgcct tgttgaggcc cccaagactg acctagattt ctggaaagtt 480

cttttcccgg ttgctgtggc tcatacaatt gggcatgttg ctgcgacagt gagtatgtca 540

aaagtagcag tgtcattcac acacattatc aaaagtgcag agcctgcatt cagtgttttg 600

gtatcaaggt tccttcttgg ggagacgttt ccggttcctg tatatctttc tcttcttcca 660

atcattggtg gatgtgctct tgctgctgtc acagagctga actttaacat ggttggattc 720

atgggtgcca tgatatcaaa ccttgcattt gttttccgca acatcttctc aaagaggggc 780

atgaagggga aatctgtcag tggcatgaat tactatgcct gcctgtcgat aatgtccctt 840

gtcatactca caccattcgc tatcgctatg gagggccctc aaatgtgggc tgctggttgg 900

caaaaggctc ttgcggaagt tggtcccaat gttgtctggt gggttgctgc acagagcgtt 960

ttctaccact tatacaacca ggtgtcttac atgtctctgg atgagatttc tccattgaca 1020

tttagcattg gcaatacgat gaagcgtata tctgtgattg tttcgtcaat cattatcttc 1080

cacacacctg tccgccctgt caatgcacta ggagctgcca ttgccatcct tggcacattc 1140

ctgtattctc aggcaaagca gtga 1164

<210> 3

<211> 387

<212> PRT

<213>rice (Oryza sativa L.)

<400> 3

Met Leu Pro Ala Val Lys Leu Ser Pro Gly Pro Val Ala Phe Ala Gly

1 5 10 15

Thr Asn Leu Arg Ser Arg Ser Ala Ser Val Ser Ser Val Ser Ser Leu

20 25 30

Lys Pro Ser Lys Phe Val Val Ser Ser Leu Arg Pro Leu Tyr Leu Ala

35 40 45

Pro Leu Asp Gly Pro Arg Ala Ala Gly Gln Lys Ala Gln Arg Gln Pro

50 55 60

Leu Glu Phe Arg Cys Ala Ala Ser Ala Ala Asp Asp Lys Glu Ser Lys

65 70 75 80

Thr Glu Val Val Pro Val Arg Ser Glu Ala Ala Gln Lys Leu Lys Ile

85 90 95

Ser Ile Tyr Phe Ala Thr Trp Trp Ala Leu Asn Val Ile Phe Asn Ile

100 105 110

Tyr Asn Lys Lys Val Leu Asn Ala Phe Pro Tyr Pro Trp Leu Thr Ser

115 120 125

Thr Leu Ser Leu Ala Cys Gly Ser Ala Met Met Leu Val Ser Trp Ala

130 135 140

Thr Arg Leu Val Glu Ala Pro Lys Thr Asp Leu Asp Phe Trp Lys Val

145 150 155 160

Leu Phe Pro Val Ala Val Ala His Thr Ile Gly His Val Ala Ala Thr

165 170 175

Val Ser Met Ser Lys Val Ala Val Ser Phe Thr His Ile Ile Lys Ser

180 185 190

Ala Glu Pro Ala Phe Ser Val Leu Val Ser Arg Phe Leu Leu Gly Glu

195 200 205

Thr Phe Pro Val Pro Val Tyr Leu Ser Leu Leu Pro Ile Ile Gly Gly

210 215 220

Cys Ala Leu Ala Ala Val Thr Glu Leu Asn Phe Asn Met Val Gly Phe

225 230 235 240

Met Gly Ala Met Ile Ser Asn Leu Ala Phe Val Phe Arg Asn Ile Phe

245 250 255

Ser Lys Arg Gly Met Lys Gly Lys Ser Val Ser Gly Met Asn Tyr Tyr

260 265 270

Ala Cys Leu Ser Ile Met Ser Leu Val Ile Leu Thr Pro Phe Ala Ile

275 280 285

Ala Met Glu Gly Pro Gln Met Trp Ala Ala Gly Trp Gln Lys Ala Leu

290 295 300

Ala Glu Val Gly Pro Asn Val Val Trp Trp Val Ala Ala Gln Ser Val

305 310 315 320

Phe Tyr His Leu Tyr Asn Gln Val Ser Tyr Met Ser Leu Asp Glu Ile

325 330 335

Ser Pro Leu Thr Phe Ser Ile Gly Asn Thr Met Lys Arg Ile Ser Val

340 345 350

Ile Val Ser Ser Ile Ile Ile Phe His Thr Pro Val Arg Pro Val Asn

355 360 365

Ala Leu Gly Ala Ala Ile Ala Ile Leu Gly Thr Phe Leu Tyr Ser Gln

370 375 380

Ala Lys Gln

385

<210> 4

<211> 6837

<212> DNA

<213>artificial synthesized (synthetic sequence)

<400> 4

ggagaagtat tataatcttt gcattaaatg catgtcttgt ctcttgactt gggaagccaa 60

gcacacgtcg tcttgatgat ggggcctgtc aaatcttgcc gcctgacacg gggggtgccc 120

ctgtcagtca ccatttaatg ggtgaagact tctgggctcc tattacaccg ggaaacagga 180

gccttgcttt gaccagagcg ggaggaccga ctccggctgg gataagagga tgagaacatc 240

tcaccatcac tatttgatgg gacatgtcag gctgcacgcc gcctggcaca cgagcagcgc 300

acaggtgcac tagccagtcc catcggtcat tcgaccggtc acagaccggt tgagtgcact 360

gtacgccgca ttaaatgcga cgtggcgcga ccgctcggga cgccataaat gcgggtaggt 420

gggcacctgg aggcggacac ctaatccacc gtacgtggtg acctagagag ggggtcgggg 480

gagcccgacc cctagtcacg ggagggggcg gccgccgccc gacctcgggc ccgatccccc 540

ctcggggggg gagccacgtg gcgcctgggg cggccttctc cctctagtct cggccagaga 600

gtggccgccg ccctacctcg ggcccgaccc ccctcggggg agggtcacgt ggcattggag 660

ggcaacctcc tccaactagt ctttgggtaa ggagtggccg ccaccccacc tcgggtctga 720

ctcccctcgg gagagggcca cgtggcatcg gggggcagcc tcctctctct aaacctgata 780

ccccgggccc atatcaccga caagtgtaat tacactataa atatatgtat tttataatgt 840

aataaaaaat atcgctcttt ttatttataa tgtaataaaa aatatcgctc ttcttgaaaa 900

atatgatgtt ataactataa ctaatcacct tttttaaaag caacacttat atagaatttt 960

tttaaaaaag cacgacaaga tgcacatgaa aaaaaaaaga gcaaatagaa actaggaaaa 1020

tgcagtatag aacgcaacgt aagttatgct cgcctccaaa tcgcttttat aacctttttc 1080

ttgtttacct tgccggtgct aatttctttt gctttacatt ttcaacaaac tttgccttct 1140

acattatctc atcatctaga caacagggaa accaaaatca aactttattt tttttttggt 1200

ttttgctaca cacaacaatt tcctcccaaa ccaaaaaccc ggaaaaatca gaaatccatg 1260

tgctcgatga cacaaatact agggatggtc tccttaaaaa gaacaacatt tgcaataaaa 1320

ccctcacact tgtccaacct taccaacaag ccaccaagaa aagatacgca aaaaacaaaa 1380

aaaacgcatt ttttttcacc taccagccca gccgccacct tctcctctcc ccctttatac 1440

tcgccggagc ggagactccc ctctccttcc cttgtgatct ccgaattccc atatcagatt 1500

ccgagggctt ggggctctcc tacgatcccc cgcctcctcc tcctcctcca tacggtatat 1560

ctctcggcgg catctcgaaa tcctcatccg tttctgttgt tgtttccgcg gcgagtttga 1620

ggggtgtgtg ttcttggaga ggaagaaccg ttcgccggtt tgattcaggg tacaggaact 1680

tgctacagag tgattggtgg gtggataagg tgagatcttt tcttctcttg atcctacaaa 1740

gttgaggttg tttttttttt taagtttatt tttaaatttc tcttttcaat ctgcggcgat 1800

gccgccgccg ccgccacgtt tgttcctccc ctcgccgcga gggcgcgagg cttgagactg 1860

gcgtcttcat tcatgcatcc attttgtttt tgtgttgttg ttgttgggta ttttgatcca 1920

agaaagaagt cttcattcaa tctgggtggg ggtggtggta aagatgggtg atttgcatgc 1980

gaaatctgcc gggctagatc acgggagttg gagaagcttg gtatctttac gtgtagatca 2040

ctcggcgaaa acgatgtgat aatttgtccc catctatgat tttgtaggct tgtagtttct 2100

gtgatttggg gatttatttg gtgacggttc tgccgtgcag gtattgtgta ctactagtac 2160

tttccgctga gtaatttggg aggaaaacta aaaaagatgg ttgttgggtc atacatacat 2220

ggtcgattca ttcattggtt tgatcagttc aagagaaata tttttgggag ccatctcaaa 2280

agaatgatgt gtaaaattta cttaaccagc tcattgagga aagttgttcc atgtcacttt 2340

cttttctggt gctgatagat caattgctct actgaggtcc tcaaagaaag tttttgttga 2400

aaggaaatgg cctgttttgt tttatttgat gacagatgat gctttaaatt gtttcctacc 2460

tgttgtcatg tacaattttg ttctttgatt tgcagaagcc atgctacctg ctgtgaagct 2520

ctctcctggc cctgtggcct tcgctggcac caatctacgg tccagatcag cttcggtttc 2580

atctgtctca agtctcaaac catccaaatt tgtggtctct tcactcagac cactctacct 2640

tgcaccacta gatggcccaa gagctgctgg gcaaaaggct cagaggcagc cacttgagtt 2700

caggtgtgct gcttccgcag ccgatgacaa ggagtctaag accgaggtgg tgcccgtccg 2760

ctcggaagct gcccagaagc tgaagatctc catctatttc gcgacatggt gggcgcttaa 2820

tgtgatcttt aacatctaca acaagaaggt tctcaatgct ttcccatacc cctggctcac 2880

ttctacgctc tcccttgcct gcggctctgc gatgatgctt gtctcatggg ccactcgcct 2940

tgttgaggcc cccaagactg acctagattt ctggaaagtt cttttcccgg tgagtggaat 3000

ctttttcttg gcaattattt gtatatttgc tgtgcctgct tgggcaagca tgattgattt 3060

tggctatttt ccttttgaag gttgctgtgg ctcatacaat tgggcatgtt gctgcgacag 3120

tgagtatgtc aaaagtagca gtgtcattca cacacattat caaaagtgca gagcctgcat 3180

tcagtgtttt ggtatcaagg ttccttcttg gggagacgtt tccggttcct gtatatcttt 3240

ctcttcttcc aatcattggt ggatgtgctc ttgctgctgt cacagagctg aactttaaca 3300

tggttggtaa gtatatattt cgaaatcgat gcatattctg ctatgagctt atgaaccatt 3360

atagccgcaa tgctaatttg tataaacgat gagtagccgt gagccaactg aagtggttgc 3420

tttagtaatc aatactttaa tactatgttt taacacaaaa tggcttatta gatgattatt 3480

ttgccccatc tggatgtctg tttttcagga attgcaatgt tcttgagatt agaatttaca 3540

ggaaataata aacagtaaca gatcatagat acaacctatt aaccttatct aatttaattg 3600

ttatgaaaac aggtgcaatt atattctcct ttataccaga agatacatgc ttaagtcttt 3660

ttttctcatt tcttcctgaa gttccatgcg tagatttatg tttaagaaca aaacgaaata 3720

ggagtcatag gctctgtaat tgtttccagt ggtctggtct tgctcaggtt agctcaggca 3780

ggtcttctcc tgttctcttt ctcttgatgt taacagttgt tgtttctcct cataccagga 3840

ttcatgggtg ccatgatatc aaaccttgca tttgttttcc gcaacatctt ctcaaagagg 3900

ggcatgaagg ggaaatctgt cagtggcatg aattactatg cctgcctgtc gataatgtcc 3960

cttgtcatac tcacaccatt cgctatcgct atggagggcc ctcaaatgtg ggctgctggt 4020

tggcaaaagg ctcttgcgga agttggtccc aatgttgtct ggtaagcaat aaaataaacc 4080

aagcatcctt taatttttct tcagcaattg ctattttgta gcccgtagtt ttgtacttgt 4140

gttacatagg acaactcaga atgaacatta ttttcacctt aggagatatc attcatatgc 4200

ttacatattt aacacacttt taagagacca ttggtttcac tcttgtgctg gacttagttt 4260

gggattttgg ccagtctttg ctggcatgta ttgatatatt gtgttttatg tactggacat 4320

attttggaat ttacccagtc tttgctggca tggattgata tattgtattt gatgatttac 4380

aacatactac agcgtatgca gcaacacttg agtattttat tgatattact taaattttgg 4440

ggatgttgaa tattgtaggt gggttgctgc acagagcgtt ttctaccact tatacaacca 4500

ggtgtcttac atgtctctgg atgagatttc tccattgaca tttagcattg gcaatacgat 4560

gaagcgtata tctgtgattg tttcgtcaat cattatcttc cacacacctg tccgccctgt 4620

caatgcacta ggagctgcca ttgccatcct tggcacattc ctgtattctc aggtaaattc 4680

ttgctttgat attttacttt agccgtgctt gccctgtgta tacttcaaac aaactttctt 4740

ttccctgcac gagaaggatg acattttgta tatagtattg tccacgtgtg gtttgacatt 4800

gatgtggaaa aacaggcagc tactttgtga atatgcttga ttttaaatcc tttccgctca 4860

attataagca ggatggattg gtaaatgata tgttactatc aactgtaatt agactgcaga 4920

gtattttagt tcattctttt gctataggag gtaatatcac ttgaaagagg aaatctgaaa 4980

acatgaggga gtaaatacga ctgcataagc ttctgctgca cctgacttat tcctccaatg 5040

ccatatttat cctaaacatt tttttttggt tgtagctgac gttttctttt ctttacttac 5100

ttttttaatt tctgtttcag gcaaagcaga tggtgagcaa gggcgaggag ctgttcaccg 5160

gggtggtgcc catcctggtc gagctggacg gcgacgtaaa cggccacaag ttcagcgtgt 5220

ccggcgaggg cgagggcgat gccacctacg gcaagctgac cctgaagttc atctgcacca 5280

ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac cttcggctac ggcctgcagt 5340

gcttcgcccg ctaccccgac cacatgaagc agcacgactt cttcaagtcc gccatgcccg 5400

aaggctacgt ccaggagcgc accatcttct tcaaggacga cggcaactac aagacccgcg 5460

ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat cgagctgaag ggcatcgact 5520

tcaaggagga cggcaacatc ctggggcaca agctggagta caactacaac agccacaacg 5580

tctatatcat ggccgacaag cagaagaacg gcatcaaggt gaacttcaag atccgccaca 5640

acatcgagga cggcagcgtg cagctcgccg accactacca gcagaacacc cccatcggcg 5700

acggccccgt gctgctgccc gacaaccact acctgagcta ccagtccgcc ctgagcaaag 5760

accccaacga gaagcgcgat cacatggtcc tgctggagtt cgtgaccgcc gccgggatca 5820

ctctcggcat ggacgagctg tacaagtaag ttcaaaaaga tggtaatgtt cagggccatg 5880

gatgaagaag ggatccagat gaagaatgtc tctgccaaac cagtagcaag cactgaggcc 5940

aattttgctt gtgcaactta tcttgtagat ataggggggt taggttttga tatgaggtca 6000

taataataat ggtctatgtt gctcgtttct tgttccttgt tagtgcaaac tgaactccag 6060

aggctatgaa ctgtggtcga gtgtaatctt gaaataaaaa cttgaatggg aatttgtcga 6120

tgtttcattc tgggtgtggg aaggtaacta ccatccaagt cccaggtttc aatggttgtt 6180

actacctttc ttactggcaa atgaacggag gtcacaaata tgttgcaatt tttcttgagc 6240

aacaaagata ttgcaagttt tcttgatccc ttgatattat acagatcaaa atttctgaat 6300

gctttcaacc acataattct attgggatat aacacttagc ggccccatcg ttaataattt 6360

gtgaaaaaaa acttttacat ttgtattctt aacaatctaa aagtaaaggc tggaaaataa 6420

actgcgatga aaaaacccta aaaccaactc cacatcgcca aaatcagtta aaaattcaaa 6480

tttatggttt ataagtataa acataaacgg aaagagacga ggttgtcgat ttcttcatgg 6540

cttaatttgc taagtattga atgattctgc taaagaagtt cagttgaagg acatgatcac 6600

atgtcttaca ttatagccaa aaaaaaaaaa gccttgaagg atatgtttga ggacaatata 6660

agaacataca tgcttgtttt tatctggaat atattattag tatttaggta gcactgttaa 6720

atatttttct ttagaattca taagctctaa aatgaggtgc acgcatgagt ccaaagcccg 6780

tgggcctctg tggctgggaa tgaacatgca gctggaggat ctaattgatg cctccgt 6837

<210> 5

<211> 40

<212> DNA

<213>artificial synthesized (synthetic sequence)

<400> 5

agctcggtac ccggggatcc ggagaagtat tataatcttt 40

<210> 6

<211> 40

<212> DNA

<213>artificial synthesized (synthetic sequence)

<400> 6

tcctcgccct tgctcaccat ctgctttgcc tgaaacagaa 40

<210> 7

<211> 40

<212> DNA

<213>artificial synthesized (synthetic sequence)

<400> 7

ttctgtttca ggcaaagcag atggtgagca agggcgagga 40

<210> 8

<211> 40

<212> DNA

<213>artificial synthesized (synthetic sequence)

<400> 8

acattaccat ctttttgaac ttacttgtac agctcgtcca 40

<210> 9

<211> 40

<212> DNA

<213>artificial synthesized (synthetic sequence)

<400> 9

tggacgagct gtacaagtaa gttcaaaaag atggtaatgt 40

<210> 10

<211> 40

<212> DNA

<213>artificial synthesized (synthetic sequence)

<400> 10

gcctgcaggt cgactctaga acggaggcat caattagatc 40

<210> 11

<211> 20

<212> DNA

<213>artificial synthesized (synthetic sequence)

<400> 11

caacacccct gctatgtacg 20

<210> 12

<211> 21

<212> DNA

<213>artificial synthesized (synthetic sequence)

<400> 12

catcaccaga gtccaacaca a 21

<210> 13

<211> 22

<212> DNA

<213>artificial synthesized (synthetic sequence)

<400> 13

atggttggat tcatgggtgc ca 22

<210> 14

<211> 23

<212> DNA

<213>artificial synthesized (synthetic sequence)

<400> 14

tttgagggcc ctccatagcg ata 23

Claims (8)

1. one kind makes rice paddy seed increase and the increased method of mass of 1000 kernel, it is characterised in that OsGPT1 gene is crossed table in rice It reaches, to obtain seed increase and the increased rice plant of mass of 1000 kernel.

2. one kind as described in claim 1 makes rice paddy seed increase and the increased method of mass of 1000 kernel, it is characterised in that described OsGPT1 gene order is as shown in SEQ ID No.1.

3. one kind as described in claim 1 makes rice paddy seed increase and the increased method of mass of 1000 kernel, it is characterised in that specific packet Include following steps:

1) expression vector of the OsGPT1 and eYFP fusion protein of the promoter starting of OsGPT1 is constructed, carrier framework is pCAMBIA3300；

2) utilize Agrobacterium by pCAMBIA3300-P_OsGPT1: OsGPT1-eYFP carrier, P_OsGPT1: OsGPT1-eYFP sequence is such as SEQ ID NO.4, is transformed into Rice Callus, and screening obtains the rice plant of OsGPT1-eYFP expressing fusion protein.

4.OsGPT1 gene overexpression is promoting the application in rice paddy seed increase and mass of 1000 kernel increase.

Application of the 5.OsGPT1 gene in the rice plant of preparation seed station.

6. application as claimed in claim 5, it is characterised in that in rice by OsGPT1 gene overexpression, to obtain seed increasing The big and increased rice plant of mass of 1000 kernel.

7. it is a kind of promote rice paddy seed increase and the increased over-express vector of mass of 1000 kernel construction method, it is characterised in that including with Lower step: P is expanded from rice genome_OsGPT1: OsGPT1, in the existing pBTYWG2 comprising pLAT52-eYFP in laboratory EYFP is expanded in carrier, the terminator of OsGPT1 is expanded from rice genome, using seamless integration kit, by P_OsGPT1: The terminator of OsGPT1, eYFP and OsGPT1 carry out seamless group with the pCAMBIA3300 after being linearized by BamH I and Xba I It fills to get the increase of promotion rice paddy seed and the increased over-express vector of mass of 1000 kernel is arrived.

8. the promotion rice paddy seed increase constructed by method for claim 7 and the increased over-express vector of mass of 1000 kernel.