CN110257391A - The detection of the construction method and its expression of pig C1QTNF3 gene overexpression vector plasmid - Google Patents
The detection of the construction method and its expression of pig C1QTNF3 gene overexpression vector plasmid Download PDFInfo
- Publication number
- CN110257391A CN110257391A CN201910512086.9A CN201910512086A CN110257391A CN 110257391 A CN110257391 A CN 110257391A CN 201910512086 A CN201910512086 A CN 201910512086A CN 110257391 A CN110257391 A CN 110257391A
- Authority
- CN
- China
- Prior art keywords
- c1qtnf3
- pig
- gene
- primer
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The invention belongs to technical field of molecular biology, and in particular to the detection of the construction method and its expression of pig C1QTNF3 gene overexpression vector plasmid.The present invention provides sequences as shown in SEQ ID NO:1-2 for constructing the primer of pig C1QTNF3 gene overexpression vector plasmid and the construction method of pig C1QTNF3 gene overexpression vector plasmid；The present invention also provides sequences as shown in SEQ ID NO:3-4 for detecting the primer of pig C1QTNF3 gene expression dose, and the method for detection pig C1QTNF3 gene expression dose.The present invention provides effective ways and basis for the functional study and its application of pig C1QTNF3 gene.
Description
Technical field
The present invention relates to technical field of molecular biology, and in particular to the structure of pig C1QTNF3 gene overexpression vector plasmid
The detection method of construction method and its expression.
Background technique
C1QTNF3 (CORS26) is also known as CTRP3 or Cartducin, is the Adipocyte Factor of discovery in 2003.C1QTNF3's
Physiological function includes: to adjust chondrocyte proliferation and bone and joint diseases；Adjust endocrine, glycolipid metabolism, mitochondria biogenesis,
A variety of physiology, pathologic process such as immune, inflammatory reaction, Apoptosis, angiogenesis, angiosteosis and Ventricular Remodeling；It adjusts
The secretion of body testosterone, Adipocyte Factor.C1QTNF3 belongs to secretory protein family, can be divided into 4 structural domains: N- terminal signal peptide,
Variable domain, collagen repetitive sequence and the end C- gC1q ball-type domain.The end N- of people and mouse C1QTNF3 contain hydrophobic signal
Peptide, no transmembrane domain, it may be possible to non-memebrane protein.C1QTNF3 is mainly deposited in human body cell with dimer and multimeric forms
, but heterodimer or polymer cannot be formed between adiponectin and other family members.
Studies have shown that CTRP1, CTRP6 and CTRP9 of CTRP family can play biology effect by activation AdipoR1
It answers.But there is not correlative study also about CTRP3.Lysosomal associated membrane albumen 1 (LAMP-1) and lysosomal membrane protein53 2 (LAMPII)
It, can be directly in conjunction with C1QTNF3 as the potential receptor of C1QTNF3.C1QTNF3 transcriptional control passes through activating transcription factor knot
Coincidence point participate in adjust, wherein hypophysis specific transcription factor 1, peroxisome proliferators activated receptor γ (PPAR γ) and
Specific proteins 1 (SP1) can reduce the expression of C1QTNF3, and c-Jun is the only known transcription for increasing C1QTNF3 expression
The factor.
In mouse endothelial cells system MSS31, the dose-dependent proliferation and migration for increasing endothelial cell of C1QTNF3.
Speculate that C1QTNF3 promotes the proliferation of endothelial cell by ERK1/2 and p38MAPK, and passes through ERK1/2 directed cell migration.So
And the research of C1QTNF3 gene is largely concentrated on people and mouse at present, there has been no about pig C1QTNF3 gene at present
Research report.The efficient building of pig C1QTNF3 expression vector and pig C1QTNF3 gene expression dose it is quick, special,
Accurate detection is of great significance for the functional study of pig C1QTNF3 gene.
Summary of the invention
To solve the technical problems existing in the prior art, the purpose of the present invention is to provide for constructing pig C1QTNF3
The primer of gene overexpression vector plasmid, the efficient construction method of pig C1QTNF3 gene overexpression vector plasmid and for examining
Survey pig C1QTNF3 gene expression dose specific primer and pig C1QTNF3 gene expression dose it is quick, special, accurate
Detection method.
To achieve the above object, technical scheme is as follows: for the efficient special expansion for realizing pig C1QTNF3 gene
Increase and the rapidly and efficiently connection with expression vector plasmid, the present invention are obtained with artificial optimization for pig by largely screening
The primer of C1QTNF3 gene magnification and over-express vector plasmid construction, sequence is as shown in SEQ ID NO.1-2, the primer energy
It enough realizes the specific amplified of pig C1QTNF3 gene, and efficient homologous recombination connection can be carried out with expression vector plasmid, fastly
Speed accurately constructs pig C1QTNF3 gene overexpression vector plasmid, by the pig C1QTNF3 gene overexpression carrier of above-mentioned building
Plasmid imports in pig cell, can get the cell for being overexpressed pig C1QTNF3 gene.For the expression water convenient for pig C1QTNF3 gene
Flat detection, the present invention carry out pig C1QTNF3 gene expression for quantitative fluorescent PCR by largely screening to obtain with artificial optimization
The specific primer (sequence is as shown in SEQ ID NO.3-4) of level detection, compared with other primers, sequence such as SEQ ID
Primer shown in NO.3-4 can be realized the expression detection of special, accurate pig C1QTNF3 gene.
Specifically, the present invention is provided to construct the primer of pig C1QTNF3 gene overexpression vector plasmid, including primer
TY-C1QTNF3-F and TY-C1QTNF3-R, nucleotide sequence is respectively as shown in SEQ ID NO:1-2.
Upstream primer, TY-C1QTNF3-F:
5′-CTGGTTTAGTGAACCGTCAGATCCGCCACCATGCTGGGG AGGCAGCTCGTCTG-3′；
Downstream primer, TY-C1QTNF3-R:
5′-CACCGTCATGGTCTTTGTAGTCCATCTTAGTTTCAAAGAG CAGGAAGCC-3′。
The sequence of above-mentioned primer TY-C1QTNF3-F and TY-C1QTNF3-R includes the sequence in conjunction with pig C1QTNF3 gene
With the homologous region sequence to be connect with carrier progress homologous recombination.Using the sequence primer as shown in SEQ ID NO:1-2 respectively,
The pig C1QTNF3 gene piece that amplification obtains can be effectively improved while guaranteeing pig C1QTNF3 gene efficient specific amplified
Section carries out the efficiency and accuracy rate of homologous recombination connection with over-express vector plasmid.
The present invention also provides be used to construct pig C1QTNF3 gene overexpression as shown in SEQ ID NO:1-2 comprising sequence
The kit of the primer of vector plasmid.
The present invention also provides a kind of methods for constructing pig C1QTNF3 gene overexpression vector plasmid, to utilize primer TY-
C1QTNF3-F and TY-C1QTNF3-R PCR amplification C1QTNF3 gene, using methods of homologous recombination by C1QTNF3 gene with
PIRES2-EGFP- 3 × flag connection.The nucleotide sequence of the primer TY-C1QTNF3-F and TY-C1QTNF3-R is respectively such as
Shown in SEQ ID NO:1-2.
In the present invention, pIRES2-EGFP-3 × flag plasmid be by 3 × flag sequence label by BamHI and
EcoRI restriction enzyme site is connected to pIRES2-EGFP plasmid construction and obtains.
Above-mentioned 3 × flag sequence label is as shown in SEQ ID NO.9.
Specifically, the method for the building pig C1QTNF3 gene overexpression vector plasmid includes the following steps:
(1) total serum IgE of porcine tissue is extracted, reverse transcription is at cDNA；
(2) using the cDNA of step (1) as template, primer TY-C1QTNF3-F and TY-C1QTNF3-R PCR amplification is utilized
C1QTNF3 gene；
(3) 3 × flag of restriction enzyme NheI and EcoRI double digestion pIRES2-EGFP- is utilized；
(4) the C1QTNF3 gene and pIRES2-EGFP-3 × flag through double digestion are subjected to homologous recombination connection,
Construct pig C1QTNF3 gene overexpression vector plasmid.
For primer TY-C1QTNF3-F and TY-C1QTNF3-R, the present invention has carried out the optimization of PCR amplification reaction condition
And screening, preferably, the pcr amplification reaction program of pig C1QTNF3 gene is as follows in above-mentioned steps (2): 95 DEG C of initial denaturations
5min, 95 DEG C of denaturation 15s, 65 DEG C of annealing 15s, 72 DEG C of extension 1min, 35 recycle, 72 DEG C of extension 10min.Using above-mentioned PCR
Response procedures can better ensure that the efficient specific amplified of pig C1QTNF3 gene.
Preferably, in above-mentioned steps (2), 20 μ L pcr amplification reaction systems of pig C1QTNF3 gene are as follows: Green
Taq Mix 10 μ L, 10 μM of upstream primers 1 μ L, 10 μM of 1 μ L, cDNA templates of downstream primer 4 μ L, ddH2O 4μL。
Preferably, 10 μ L reaction systems of double digestion described in above-mentioned steps (3) be restriction enzyme NheI and
EcoRI each 1 μ L, pIRES2-EGFP-3 × flag vector plasmid 300ng, NEB 2.1Buffer 1 μ L, ddH2O polishing is to 10 μ
L。
Preferably, in above-mentioned steps (3), the response procedures of the double digestion are as follows: 37 DEG C of digestion 1h, 65 DEG C of inactivations
20min。
Preferably, in above-mentioned steps (4), 20 μ L reaction systems of the homologous recombination connection are as follows: pIRES2-EGFP-3
1 μ L, 100ng PCR product of × flag linearized vector plasmid, 5 × CE II Buffer, 4 μ L, Exnase II, 2 μ L,
ddH2O polishing is to 20 μ L.
Preferably, in above-mentioned steps (4), the response procedures of the homologous recombination connection are as follows: 37 DEG C of connection 30min.
The present invention also provides the detection primer of pig C1QTNF3 gene expression dose, including primer C1F and C1R, nucleosides
Acid sequence is respectively as shown in SEQ ID NO:3-4.
Upstream primer, C1F:5 '-CCTCATGCACAATGGCAATAC-3 '；
Downstream primer, C1R:5 '-TTCTCAGCCAAACCTCATCC-3 '.
The detection primer of above-mentioned pig C1QTNF3 gene expression dose is that the present invention is obtained by largely screening with artificial optimization
, it is remarkably improved the specificity and accuracy of detection using the primer, better ensures that pig C1QTNF3 gene expression dose
Quickly, efficient detection.
The present invention also provides the kits of the detection primer containing the pig C1QTNF3 gene expression dose.
Preferably, the kit further includes the primer 18S-F and 18S-R for expanding 18S rRNA reference gene,
Its nucleotide sequence is respectively as shown in SEQ ID NO:5-6.
Upstream primer, 18S-F:5 '-ATGCCAGAGTCTCGTTCGTTAT-3 '；
Downstream primer, 18S-R:5 '-CGGACAGGATTGACAGATTGAT-3 '.
Further, the present invention also provides the detection primer of the pig C1QTNF3 gene expression dose or contain the pig
Application of the kit of the detection primer of C1QTNF3 gene expression dose in detection pig C1QTNF3 gene expression dose.
The present invention also provides the detection methods of a boar C1QTNF3 gene expression dose, to utilize the pig C1QTNF3
The kit of the detection primer of gene expression dose or the detection primer containing the pig C1QTNF3 gene expression dose carries out
Fluorescence quantitative PCR detection.
Specifically, the detection method of the pig C1QTNF3 gene expression dose includes the following steps:
(1) total serum IgE of pig cell to be measured is extracted, reverse transcription is at cDNA；
(2) using the cDNA of step (1) as template, primer 18S-F and 18S-R, fluorescent quantitative PCR 18S rRNA are utilized
Reference gene, while utilizing primer C1F and C1R, fluorescent quantitative PCR C1QTNF3 gene；
(3) fluorescent quantitative PCR result of analytical procedure (2) obtains pig C1QTNF3 gene expression dose.
Preferably, in above-mentioned steps (2), the response procedures of the quantitative fluorescent PCR are as follows: 95 DEG C of initial denaturation 30s；95
DEG C denaturation 5s, 60 DEG C of annealing 30s, 45 recycle；95 DEG C of 15s, 65 DEG C of 1min, 95 DEG C of 15s make melting curve.
Preferably, in above-mentioned steps (2), 20 μ L reaction systems of the quantitative fluorescent PCR are as follows: 2 × GoTaq qPCR
10 μ L of Master Mix goes 7.4 μ L of RNA enzyme water, 10 μM of 0.3 μ L of upstream primer, 10 μM of 0.3 μ L, cDNA templates of downstream primer
2.0μL。
Preferably, carrying out amplification curve and melting to the real-time monitoring result of quantitative fluorescent PCR in above-mentioned steps (3)
Tracing analysis, using relative quantitation method, using control group as outer ginseng (the outer ginseng of setting is for elimination different batches test error),
Calculate relative expression quantity=2 in different disposal-△△CT.C1QTNF3 gene is compared not using independent sample T check analysis
It with differential expression in processing group, is as a result indicated with average value ± standard error, P < 0.05 indicates that significant difference, P < 0.01 indicate difference
Extremely significant, all statistical analysis are completed with 20.0 software of SPSS version.
Beneficial effects of the present invention include at least:
(1) the present invention provides the primer constructed for pig C1QTNF3 gene overexpression vector plasmid, which can be
While guaranteeing pig C1QTNF3 gene efficient specific amplified, the pig C1QTNF3 genetic fragment and cross table that amplification obtains are effectively improved
The efficiency and accuracy rate of homologous recombination connection are carried out up to vector plasmid；Using the primer, the present invention realizes fast and efficiently pig
The building of C1QTNF3 gene overexpression vector plasmid；
It (2), can using the primer the present invention provides the specific primer detected for pig C1QTNF3 gene expression dose
The specificity and accuracy for significantly improving detection better ensure that the quick, efficient, accurate of pig C1QTNF3 gene expression dose
Detection,
Pig C1QTNF3 gene overexpression vector plasmid building provided by the invention and pig C1QTNF3 gene expression dose
Detection method has very strong practicability, provides effective ways and base for the functional study and its application of pig C1QTNF3 gene
Plinth.
Detailed description of the invention
Fig. 1 is the plasmid of over-express vector Sus-C1QTNF3-pIRES2- EGFP-3 × flag in the embodiment of the present invention 2
Map.
Fig. 2 is that over-express vector Sus-C1QTNF3-pIRES2- EGFP-3 × flag plasmid turns in the embodiment of the present invention 4
It contaminates pig renal epithelial cell PK15 and cultivates 36h, using the result of the expression of qPCR method detection C1QTNF3 gene.Histogram
In, the value of pillar is average ± standard error；* * indicates that difference is extremely significant (P < 0.001), and individual repeat number is 3 in figure,
QPCR loading techniques repeat number is 4.
Fig. 3 is that over-express vector Sus-C1QTNF3-pIRES2- EGFP-3 × flag plasmid turns in the embodiment of the present invention 5
Contaminate pig renal epithelial cell PK15 cultivate 36h, using qPCR method detect cell cycle related proteins CyclinB, CyclinD and
The expression of CDK2, wherein the expression that A is CyclinB detects；The expression that B is CyclinD detects, and C is
The expression of CDK2 detects；In histogram, the value of pillar is average ± standard error；* * indicates extremely significant (the P < of difference
0.001) it is 4 that, individual repeat number, which is 3, qPCR loading techniques repeat number, in figure.
Specific embodiment
The preferred embodiment of the present invention is described in detail below in conjunction with embodiment.It will be appreciated that following real
Providing merely to play the purpose of explanation for example is applied, is not used to limit the scope of the present invention.The skill of this field
Art personnel without departing from the spirit and purpose of the present invention, can carry out various modifications and replace to the present invention.
Experimental method used in following embodiments is conventional method unless otherwise specified, such as Sambrook equal part
Sub- Cloning: A Laboratory Manual (Sambrook J&Russell DW, Molecular Cloning:a Laboratory Manual,
2001), or according to manufacturer's specification suggestion condition.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Screening and acquisition of the embodiment 1 for the primer of pig C1QTNF3 gene overexpression vector plasmid building
Pig C1QTNF3 gene mRNA sequence (the GenBank Accession No.NM_ announced according to NCBI
001145386.1) the homologous recombination primer of amplifiable C1QTNF3 full length gene is designed.
The present invention has found by lot of experiments, as long as not meeting general primer design principle or using design of primers
The designed primer out of software can be realized as guaranteeing amplified fragments while guaranteeing the expanding effect of pig C1QTNF3 gene
It can efficiently be connect with plasmid vector is overexpressed by homologous recombination.On the basis of meeting general design principle, this hair
It is bright to be directed to the secondary structure between primer and the affinity and mismatch rate, primer of target sequence and two between primer and target sequence
The G/C content of level structure and primer, Tm value, length and expanding fragment length etc. have carried out a large amount of artificial optimization's designs and screening,
Sequence primer pair TY-C1QTNF3 as shown in SEQ ID NO:1-2 is finally obtained, which can guarantee pig
Guarantee that amplified fragments can pass through homologous recombination reality with plasmid vector is overexpressed while the specifical and efficient amplification of C1QTNF3 gene
Existing higher joint efficiency and accuracy rate.The sequence of primer pair TY-C1QTNF3 is as follows:
Upstream primer, TY-C1QTNF3-F (SEQ ID NO:1):
5′-CTGGTTTAGTGAACCGTCAGATCCGCCACCATGCTGGGG AGGCAGCTCGTCTG-3′；
Downstream primer, TY-C1QTNF3-R (SEQ ID NO:2):
5′-CACCGTCATGGTCTTTGTAGTCCATCTTAGTTTCAAAGAG CAGGAAGCC-3′。
The building of 2 pig C1QTNF3 gene overexpression vector plasmid of embodiment
The present embodiment provides the construction methods of pig C1QTNF3 gene overexpression vector plasmid, specifically includes the following steps:
1, the acquisition of tissue sample
1 monthly age length pig 3, from Datong City, Shanxi Province kind pig farm.Tissue sample is acquired after butchering, and puts into liquid nitrogen immediately
In, it is subsequently placed at -80 DEG C of refrigerators and saves backup.
2, tissue RNA is extracted and cDNA is synthesized
The total serum IgE of each tissue is extracted using TaKaRa RNAiso Plus kit, extracting method is referring to kit explanation
Book.The integrality of total serum IgE is detected by agarose gel electrophoresis and is determined；Total rna concentration is micro ultraviolet by NanoDrop1000
Spectrophotometric determination.
Using PrimeScript RT reagent Kit with gDNA Eraser kit by RNA reverse transcription at
cDNA。
3, PCR amplification
Obtained primer pair TY-C1QTNF3 (sequence is as shown in SEQ ID NO:1-2) amplification is screened using embodiment 1
C1QTNF3 gene, the reaction system of PCR are as follows: 2 × Green Taq Mix, 10 μ L, 10 μM of 1 μ L of upstream primer, 10 μM of downstreams are drawn
1 μ L, cDNA template of object 4 μ L, ddH2O 4μL；The response procedures of PCR are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, 63 DEG C
Anneal 15s, 72 DEG C of extension 1min, 35 circulations, 72 DEG C of extension 10min.Electroresis appraisal is carried out to amplified production and carries out glue returning
It receives.
4, the building of pIRES2-EGFP-3 × flag plasmid
(1) design contains the primer of 3 × flag sequence, specific as follows:
F:AATTCATGGACTACAAAGACCATGACGGTGATTATAA AGATCATGACATCGATTACAAGGA is transformed
TGACGATGACAAGT；
R:GATCACTTGTCATCGTCATCCTTGTAATCGATGTCA TGATCTTTATAATCACCGTCATGGT is transformed
CTTTGTAGTCCATG；
(2) restriction enzyme BamHI and EcoRI double digestion pIRES2-EGFP is utilized；
(3) primer in above-mentioned (1) is annealed, the reaction system for the PCR that anneals are as follows: 10 × PNK buffer, 2.2 μ
L, 10 μM of upstream primers 2 μ L, 10 μM of downstream primers 2 μ L, ddH2O 14μL；The response procedures of annealing PCR are as follows: 93 DEG C of 3min,
93 DEG C of denaturation 30s (57 circulations, since second circulation, each circulation reduces by 1 DEG C), 25 DEG C of preservations；
(4) annealed product and the pIRES2-EGFP through double digestion are attached, construct pIRES2-EGFP-3 × flag
Carrier；Linked system are as follows: 2 × Solution, I 5 μ L, digestion carrier (50ng), annealed product 1 μ L, ddH2O 3μL；Connect journey
Sequence are as follows: 16 DEG C of 30min；
5, the building of linearized vector
It recovers and expands the bacterium solution that culture has pIRES2-EGFP-3 × flag, according to OMEGA plasmid extraction kit
Specification carries out plasmid extraction and is verified by electrophoresis.It extracts product and carries out double enzymes with restriction enzyme NheI and EcoRI
It cuts, the reaction system of double digestion are as follows: each 1 μ L, pIRES2-EGFP-3 × flag carrier matter of restriction enzyme NheI and EcoRI
Grain 300ng, NEB 2.1Buffer 1 μ L, ddH2O polishing is to 10 μ L.The response procedures of double digestion are as follows: 37 DEG C of digestion 1h, 65 DEG C
Inactivate 20min.
6, the building of pig C1QTNF3 gene overexpression vector plasmid
The C1QTNF3 gene PCR product of above-mentioned acquisition and pIRES2-EGFP-3 × flag linearized vector plasmid are passed through
Vazyme homologous recombination kit is attached, and obtains pig C1QTNF3 gene overexpression carrier S us-C1QTNF3-pIRES2-
EGFP-3×flag.The reaction system of homologous recombination are as follows: pIRES2-EGFP-3 × flag linearized vector plasmid 1 μ L, 100ng
PCR product, 5 × CE II Buffer, 4 μ L, Exnase II 2 μ L, ddH2O polishing is to 20 μ L.The response procedures of homologous recombination
Are as follows: 37 DEG C of connection 30min.
7, the identification of pig C1QTNF3 gene overexpression carrier
Connection product Sus-C1QTNF3-pIRES2-EGFP-3 × flag is transferred to DH5 α Escherichia coli, is applied to card
It is incubated overnight on the LB solid medium of that chloramphenicol resistance, 10 positive colonies of picking, bacterium colony PCR verifying is carried out, through 1%
Ago-Gel verifying, has obtained 5 clone strains for meeting target fragment size.3 positive colony bacterial strains are chosen, are carried out
The positive bacterium solution sample of pig C1QTNF3 gene overexpression carrier is sent to Hua Da biotech firm after expansion culture and uses universal primer
It is sequenced.Sequencing result shows the success of pig C1QTNF3 gene overexpression vector construction as shown in SEQ ID NO.10.Using
SnapGene draws the pig C1QTNF3 gene overexpression vector plasmid map (as shown in Figure 1) of above-mentioned building.It is correct to being sequenced
Bacteria liquid sample carries out protecting bacterium and plasmid extracts.
The screening and acquisition of 3 pig C1QTNF3 gene expression dose detection primer of embodiment
Pig C1QTNF3 gene mRNA sequence (the GenBank Accession No.NM_ announced according to NCBI
001145386.1) design can be used for detecting the primer of pig C1QTNF3 gene expression dose.
The present invention has found by lot of experiments, as long as not meeting general primer design principle or using design of primers
The designed primer out of software can be realized as the efficient specific detection of pig C1QTNF3 gene expression dose.It is general meeting
Design principle on the basis of, the present invention is for secondary structure between primer and the affinity and mismatch rate, primer of target sequence
And G/C content, Tm value, length and expanding fragment length of the secondary structure and primer between primer and target sequence etc. carries out
A large amount of artificial optimizations' designs and screening, finally obtain sequence primer pair C1 as shown in SEQ ID NO:3-4, the primer pair energy
Enough realize the efficient specific detection of quantitative fluorescent PCR of pig C1QTNF3 gene expression dose.The sequence of primer pair C1 is as follows:
Upstream primer, C1F (SEQ ID NO:3):
5′-CCTCATGCACAATGGCAATAC-3′；
Downstream primer, C1R (SEQ ID NO:4):
5′-TTCTCAGCCAAACCTCATCC-3′；
The fluorescence quantitative PCR detection of pig C1QTNF3 gene is using 18S rRNA as internal reference, therefore, while being announced according to NCBI
18S rRNA sequence, designed for 18S rRNA amplification primer pair 18S (SEQ ID NO:5-6):
Upstream primer, 18S-F (SEQ ID NO:5):
5′-ATGCCAGAGTCTCGTTCGTTAT-3′；
Downstream primer, 18S-R (SEQ ID NO:6):
5′-CGGACAGGATTGACAGATTGAT-3′。
The detection method of 4 pig C1QTNF3 gene expression dose of embodiment
Using the pig C1QTNF3 gene overexpression carrier S us-C1QTNF3-pIRES2-EGFP-3 obtained in embodiment 2
× flag plasmid transfects pig renal epithelial cell PK15, carries out fluorescent quantitation to the C1QTNF3 gene expression dose of transfection cell
PCR (qPCR) detection.Specifically comprise the following steps:
1, cell culture and collection
Recovery pig renal epithelial cell PK15, cell is laid in 100mm cell ware, cell confluency degree reaches 80% or so
When, according to Lonza Nucleofector 4D nuclear transfection system training handbook, stayed being centrifuged after pig renal epithelial cell PK15 digestion
Precipitating, turning reagent P1 and 2000ng plasmid with 100 μ L electricity, (overexpression group is pig C1QTNF3 gene overexpression vector plasmid, control
Group is control plasmid pIRES2-EGFP-3 × flag) mixing, it is put in electric revolving cup, using DS130 electricity carryover sequence, by pig
C1QTNF3 gene overexpression carrier S us-C1QTNF3-pIRES2-EGFP-3 × flag plasmid and control plasmid pIRES2-
EGFP-3 × flag by electricity in a twinkle when be transferred to intracellular, collect cell after being inoculated into 6 orifice plates culture 36h.
2, cell RNA extracts and cDNA is synthesized
The total serum IgE that each processing group (overexpression group and control group) is extracted using TaKaRa RNAiso Plus kit, is mentioned
Take method referring to kit specification.The integrality of total serum IgE is detected by agarose gel electrophoresis and is determined；Total rna concentration passes through
The micro ultraviolet specrophotometer measurement of NanoDrop1000.
3, fluorescent quantitative PCR
Obtained C1 primer pair (sequence is as shown in SEQ ID NO:3-4) is screened to C1QTNF3 gene using embodiment 3
Fluorescent quantitative PCR is carried out, internal reference 18S rRNA is carried out using 18S primer pair (sequence is as shown in SEQ ID NO:5-6)
Fluorescent quantitative PCR.Quantitative fluorescent PCR reaction system is using mixing sample-adding method, i.e., according to needed for each reaction system
The number of the reaction of PCR needed for the quantity and primary first-order equation of various components, calculates the total amount of various reactive components, is added to 1
It goes in the 1.5mL centrifuge tube of RNA enzyme, mixes well rear brief centrifugation, then be dispensed into dedicated 8 union of quantitative fluorescent PCR, so
After be separately added into template cDNA, then fluorescent quantitative PCR is carried out after brief centrifugation, whole operation process is protected from light as far as possible；Fluorescence
Quantitative PCR reaction system are as follows: GoTaq qPCR Master Mix (2 ×) 10 μ L goes 7.4 μ L of RNA enzyme water, 10 μM of upstream primers
0.3 μ L, 10 μM of 0.3 μ L, cDNA template of downstream primer, 2.0 μ L.Response procedures are as follows: 95 DEG C of initial denaturation 30s；95 DEG C of denaturation 5s, 60
DEG C annealing 30s, 45 circulation；95 DEG C of 15s, 65 DEG C of 1min, 95 DEG C of 15s make melting curve.
4, quantitative fluorescent PCR data are analyzed
The amplification curve and melting curve of fluorescent quantitative PCR result are analyzed.The result shows that each gene magnification curve
In serpentine and arrival plateau, illustrate effectively to expand；And each gene melting curve peak value is single, illustrates amplified production spy
Different, primer free dimer and other non-specific amplifications can carry out the analysis of subsequent result.(table is crossed according to different disposal group
Up to group and control group) CT value, using control group as outer ginseng (the outer ginseng of setting is for eliminate different batches test error), using phase
The relative expression quantity of pig C1QTNF3 gene, calculation formula are calculated quantitative approach are as follows: the relative expression quantity of C1QTNF3 gene=
2-△△CT。
5, it maps
According to the calculated result of relative quantification, significance test of difference is carried out using 20.0 software of SPSS version, and
It is mapped by GraphPad Prism 5, as a result as shown in Fig. 2, showing that compared with the control group, being overexpressed C1QTNF3 gene makes it
The extremely significant up-regulation of expression quantity.
The overexpression of 5 C1QTNF3 gene of embodiment promotes cell Proliferation
The cell cycle related proteins for being overexpressed C1QTNF3 gene pairs pig renal epithelial cell PK15 are detected by qPCR
The expression quantity of CyclinB, CyclinD and CDK2 change, and then verify the work of the overexpression cell proliferation of pig C1QTNF3 gene
With.As a result as shown in figure 3, being overexpressed C1QTNF3 gene, the expression of cyclin related gene has extremely significant up-regulation
Trend illustrates that the overexpression of pig C1QTNF3 gene promotes cell Proliferation.
Pig C1QTNF3 gene overexpression vector plasmid is constructed using homologous recombination primer provided by the invention, and to pig
The expression of C1QTNF3 gene carries out quantitative analysis, has special, accurately, fast and easily advantage, has very strong reality
With property, effective ways and basis are provided for the functional study and its application of pig C1QTNF3 gene.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be modified or is improved, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.
Sequence table
<110>Agricultural University Of Shanxi
<120>detection of the construction method and its expression of pig C1QTNF3 gene overexpression vector plasmid
<130> KHP191112424.5
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 53
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
ctggtttagt gaaccgtcag atccgccacc atgctgggga ggcagctcgt ctg 53
<210> 2
<211> 49
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
caccgtcatg gtctttgtag tccatcttag tttcaaagag caggaagcc 49
<210> 3
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
cctcatgcac aatggcaata c 21
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ttctcagcca aacctcatcc 20
<210> 5
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
atgccagagt ctcgttcgtt at 22
<210> 6
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
cggacaggat tgacagattg at 22
<210> 7
<211> 75
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
aattcatgga ctacaaagac catgacggtg attataaaga tcatgacatc gattacaagg 60
atgacgatga caagt 75
<210> 8
<211> 75
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
gatcacttgt catcgtcatc cttgtaatcg atgtcatgat ctttataatc accgtcatgg 60
tctttgtagt ccatg 75
<210> 9
<211> 66
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
gactacaaag accatgacgg tgattataaa gatcatgaca tcgattacaa ggatgacgat 60
gacaag 66
<210> 10
<211> 1169
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
tagtgaccgt cagatccgcc accatgctgg ggaggcagct cgtctgttgg cacctgctgg 60
ctttgctttt cctccctttt tgcctgtgtc aagatgaata catggaggtg agcggaagag 120
ctaataaagt ggtggcaaga atagtgcaaa gccatcagca gactggccgt agcggctcca 180
ggagggagaa agtgagagag cggagccatg ctagaactgg gactgtggat aataacactt 240
ctgcagacct aaaatccctg aaagccgatg agctaccgca ccccgaggta gatgacctag 300
cccagatcac cccattctgg ggccagtctc cacaaactgg aggactgccc ccagactgca 360
gcaagtgttg ccatggagac tacagcttcc gaggctacca aggcccccct ggaccccccg 420
gcccccctgg cattccagga aaccatggaa acaatggcaa taacggagcc actggccacg 480
aaggggccaa aggtgagaaa ggagacaaag gtgacctggg gccacgaggg gagcgggggc 540
agcatggccc caaaggagag aagggctacc cggggattcc accagaactg cagattgcat 600
tcatggcttc tctggccact cacttcagca atcagaacag tgggattatc ttcagcagtg 660
ttgaaaccaa cattggaaac ttctttgatg tcatgactgg gagatttggg gccccagtat 720
caggtgtgta cttcttcacc ttcagcatga tgaagcatga ggatgtcgag gaagtatatg 780
tatacctcat gcacaatggc aatacggtct tcagcatgta cagctatgag acaaagggga 840
aatccgatac atccagcaac catgcagtgc tgaagctggc caaaggggat gaggtttggc 900
tgagaatggg caatggcgct cttcatgggg accaccagcg cttctccacc tttgcaggct 960
tcctgctctt tgaaactaag atggactaca aagaccatga cggtgattat aaagatcatg 1020
acatcgatta caaggatgac gatgacaagt gatccgcccc tctccctccc ccccccctaa 1080
cggtactggc cgaagcccct tggaataagg ccggggtgcg tttgtctata tgttattttc 1140
caccctattg ccctcttttg ggaatgtga 1169
Claims (10)
1. the primer for constructing pig C1QTNF3 gene overexpression vector plasmid, which is characterized in that including primer TY-
C1QTNF3-F and TY-C1QTNF3-R, nucleotide sequence is respectively as shown in SEQ ID NO:1-2.
2. a kind of method for constructing pig C1QTNF3 gene overexpression vector plasmid, which is characterized in that utilize primer TY-
C1QTNF3-F and TY-C1QTNF3-R PCR amplification C1QTNF3 gene, using methods of homologous recombination by C1QTNF3 gene with
PIRES2-EGFP-3 × flag connection；
The nucleotide sequence of the primer TY-C1QTNF3-F and TY-C1QTNF3-R is respectively as shown in SEQ ID NO:1-2.
3. according to the method described in claim 2, it is characterized by comprising the following steps:
(1) total serum IgE of porcine tissue is extracted, reverse transcription is at cDNA；
(2) using the cDNA of step (1) as template, primer TY-C1QTNF3-F and TY-C1QTNF3-R PCR amplification is utilized
C1QTNF3 gene；
(3) restriction enzyme NheI and EcoRI double digestion pIRES2-EGFP-3 × flag is utilized；
(4) the C1QTNF3 gene and pIRES2-EGFP-3 × flag through double digestion are subjected to homologous recombination connection, building
Pig C1QTNF3 gene overexpression vector plasmid；
Preferably, the response procedures of the PCR amplification are as follows: 95 DEG C of initial denaturations 5min, 95 DEG C of denaturation 15s, 65 DEG C of annealing 15s,
72 DEG C of extension 1min, 35 circulations, 72 DEG C of extension 10min.
4. the detection primer of pig C1QTNF3 gene expression dose, which is characterized in that including primer C1F and C1R, nucleotides sequence
Column are respectively as shown in SEQ ID NO:3-4.
5. the kit containing detection primer described in claim 4；
Preferably, the kit further includes the primer 18S-F and 18S-R for expanding 18S rRNA reference gene, nucleosides
Acid sequence is respectively as shown in SEQ ID NO:5-6.
6. kit described in detection primer or claim 5 described in claim 4 is in detection pig C1QTNF3 gene expression dose
Application.
7. the detection method of a boar C1QTNF3 gene expression dose, which is characterized in that drawn using detection described in claim 4
Kit described in object or claim 5 carries out fluorescence quantitative PCR detection.
8. detection method according to claim 7, which comprises the steps of:
(1) total serum IgE of pig cell to be measured is extracted, reverse transcription is at cDNA；
(2) using the cDNA of step (1) as template, primer 18S-F and 18S-R, fluorescent quantitative PCR 18S rRNA internal reference are utilized
Gene, while utilizing primer C1F and C1R, fluorescent quantitative PCR C1QTNF3 gene；
(3) fluorescent quantitative PCR result of analytical procedure (2), the pig C1QTNF3 gene expression dose of acquisition.
9. detection method according to claim 8, which is characterized in that the response procedures of the quantitative fluorescent PCR are as follows: 95 DEG C
Initial denaturation 30s；95 DEG C of denaturation 5s, 60 DEG C of annealing 30s, 45 recycle；95 DEG C of 15s, 65 DEG C of 1min, 95 DEG C of 15s production melt bent
Line.
10. method according to claim 8 or claim 9, which is characterized in that 20 μ L reaction systems of the quantitative fluorescent PCR are as follows:
2 × GoTaq qPCR Master Mix, 10 μ L goes 7.4 μ L of RNA enzyme water, 10 μM of 0.3 μ L of upstream primer, 10 μM of downstream primers
0.3 μ L, cDNA template, 2.0 μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910512086.9A CN110257391A (en) | 2019-06-13 | 2019-06-13 | The detection of the construction method and its expression of pig C1QTNF3 gene overexpression vector plasmid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910512086.9A CN110257391A (en) | 2019-06-13 | 2019-06-13 | The detection of the construction method and its expression of pig C1QTNF3 gene overexpression vector plasmid |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110257391A true CN110257391A (en) | 2019-09-20 |
Family
ID=67918203
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910512086.9A Pending CN110257391A (en) | 2019-06-13 | 2019-06-13 | The detection of the construction method and its expression of pig C1QTNF3 gene overexpression vector plasmid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110257391A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109825560A (en) * | 2019-03-28 | 2019-05-31 | 山西农业大学 | For detecting primer, kit and the detection method of C1QTNF3 gene 219bp missing alternative splicing body |
-
2019
- 2019-06-13 CN CN201910512086.9A patent/CN110257391A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109825560A (en) * | 2019-03-28 | 2019-05-31 | 山西农业大学 | For detecting primer, kit and the detection method of C1QTNF3 gene 219bp missing alternative splicing body |
Non-Patent Citations (4)
| Title |
|---|
| GENBANK DATABASE: "Sus scrofa C1q and TNF related 3 (C1QTNF3), mRNA", 《GENBANK DATABASE》 * |
| 史明月等: "NR1H3基因调控猪前体脂肪细胞分化的研究", 《畜牧兽医学报》 * |
| 牛伟红等: "基于同源重组和反向PCR扩增技术构建BRD7溴区结构域缺失突变体", 《中南大学学报（医学版）》 * |
| 诺维赞: ""克隆快线（ClonExpress）"", 《RETRIEVED FROM：URL:HTTPS://WWW.SOHU.COM/A/163601915_216835》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102776286B (en) | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation | |
| CN105861641A (en) | Primer, kit and method for detecting CHO cell DNA residues | |
| CN103168235A (en) | A method of analysing a blood sample of a subject for the presence of a disease marker | |
| CN109468372A (en) | Primer combination, method and the kit in a variety of hereditary metabolic disorders hepatopathy targetings library are constructed based on high-flux sequence | |
| CN109837345A (en) | Detect the primer and method of mouse cell residual DNA | |
| CN101565742A (en) | Kit for detecting epidermal growth factor receptor (EGFR) mutation by primer specific fluorescence polymerase chain reaction (PCR) | |
| CN110438128A (en) | Utilize the method for CRISPR/Cas9 system knock-out pig CCAR1 gene | |
| CN106754938B (en) | A kind of aptamer detecting people's clear cell carcinoma of kidney cell and its application in preparation detection preparation | |
| CN109988842B (en) | Reagent group for in-situ detection of PDL1 by oligonucleotide labeled probe and application thereof | |
| CN110257391A (en) | The detection of the construction method and its expression of pig C1QTNF3 gene overexpression vector plasmid | |
| WO2023216707A1 (en) | Universal preclinical bio-distribution detection kit for nk cell therapy products | |
| CN107190005A (en) | Applications of the lncRNA as biomarker in adenocarcinoma of lung diagnosis and treatment | |
| CN109722472A (en) | Detect the universal PCR primer combination and application of Chimeric antigen receptor gene | |
| CN104818281B (en) | One boar Lgr5 genes and its application | |
| CN105936941A (en) | Mycobacterium tuberculosis PCR-LFB detection kit | |
| CN109517899A (en) | For detecting the kit and detection method of EGFR genetic mutation | |
| CN110029172A (en) | Horse, donkey derived component duplex PCR detection kit | |
| CN110218724A (en) | The detection of the construction method and its expression of pig NR1H3 gene overexpression vector plasmid | |
| CN105087794A (en) | Kit for tuberculosis detection | |
| CN106868197B (en) | Application of the gene marker in Huppert's disease | |
| CN109652556A (en) | CircARHGAP12 and its preparing application and diagnostic preparation in nasopharyngeal carcinoma diagnosis preparation | |
| CN109536644A (en) | For identifying AS-PCR primer and its application of canine distemper virus street strain and vaccine strain | |
| CN101906420B (en) | Human filaggrin gene prokaryotic expression system and application of expressed protein | |
| CN109402127A (en) | One group of high affinity nucleic acid aptamers and its application specifically bound with Connective Tissue Growth Factor | |
| CN117305452B (en) | Application of human SNRK mRNA in non-small cell lung cancer diagnosis, targeted therapy and prognosis evaluation and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190920 |