CN110257313A - The bacillus amyloliquefaciens engineering bacteria of one plant height production spermidine - Google Patents

The bacillus amyloliquefaciens engineering bacteria of one plant height production spermidine Download PDF

Info

Publication number
CN110257313A
CN110257313A CN201910409349.3A CN201910409349A CN110257313A CN 110257313 A CN110257313 A CN 110257313A CN 201910409349 A CN201910409349 A CN 201910409349A CN 110257313 A CN110257313 A CN 110257313A
Authority
CN
China
Prior art keywords
spermidine
gene
bacillus amyloliquefaciens
engineering bacteria
sam2
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910409349.3A
Other languages
Chinese (zh)
Other versions
CN110257313B (en
Inventor
魏雪团
邹典
闵钰
李璐
阮丽英
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN201910409349.3A priority Critical patent/CN110257313B/en
Publication of CN110257313A publication Critical patent/CN110257313A/en
Application granted granted Critical
Publication of CN110257313B publication Critical patent/CN110257313B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • C07K14/395—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/001—Amines; Imines

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a kind of bacillus amyloliquefaciens engineering bacteria of high yield spermidine, for the engineering bacteria using bacillus amyloliquefaciens LX-12 as starting strain, superposition, which incorporates, on the basis of starting strain encodes S-adenosylmethionine synzyme in saccharomyces cerevisiaeSAM2S adenosylmethionine decarboxylase is encoded in gene and Escherichia colispeDGene, it is free to express encoding spermidine synzyme in saccharomyces cerevisiaespeEGene, it operates to obtain the bacillus amyloliquefaciens engineering bacteria HSPM3 of high yield spermidine by said gene, deposit number is CCTCC NO:M2019326, and bacterial strain yield of spermidine in liquid state fermentation culture reaches 56.59 mg/L, improves 8.23 times than wild-type strain LX-12.

Description

The bacillus amyloliquefaciens engineering bacteria of one plant height production spermidine
Technical field
The invention belongs to technical field of microbial genetic engineering, and in particular to a kind of solution starch brood cell's bar of high yield spermidine Bacterium genetic engineering bacterium.
Background technique
Spermidine is a kind of typical aromatic polyamine, is had the function of in terms of human health and disease treatment important. Spermidine has Induces Autophagy, anti-aging, improves the multiple biological activities such as memory, cardiovascular, the adjusting nerve of protection, There is good application potential in terms of the prevention and treatment of cardiovascular disease and senile dementia, in food additives, health care Product and field of medicaments have potential application (referring to document: Madeo, F.；Eisenberg,T.；Pietrocola,F.； Kroemer,G.,Spermidine in health and disease.Science 2018,359)。
The application potential of spermidine is huge, but the yield of current spermidine is too low, and the means for synthesizing spermidine are mainly Chemical synthesis, energy consumption is high, side reaction is more, pollution is big, and spermidine is expensive.Biological synthesis process has green, environmental protection, peace Entirely, the advantages that mild condition, it is expected to the shortcomings that overcoming conventional chemical synthesis.Therefore, the present invention is for the first time to solve starch brood cell's bar Bacterium LX-12 is starting strain, is transformed by genetic engineering means to it, significantly improves the yield of spermidine.
Summary of the invention
It is an object of the invention to obtain the bacillus amyloliquefaciens base that a plant height produces spermidine by genetic engineering means Because of engineering bacteria HSPM3, the bacterial strain is using bacillus amyloliquefaciens LX-12 as starting strain, successively integrant expression saccharomyces cerevisiae SAM2 gene and Escherichia coli speD gene, it is free to express saccharomyces cerevisiae speE gene, the spermidine in liquid state fermentation culture Yield reach 56.59mg/L, improve 8.23 times than wild-type strain LX-12.
To achieve the goals above, the invention adopts the following technical scheme:
Using bacillus amyloliquefaciens (Bacillus amyloliquefaciens) LX-12 (2015 4 of freezing The moon is preserved in China typical culture collection center on the 15th, and deposit number is CCTCC NO:M 2015234) it is bacterium germination.Pass through It checks pertinent literature and spermidine anabolism access figure, analyzes the downstream key gene that can promote to synthesize spermidine, 3 important genes are therefrom had chosen, are the S-adenosylmethionine synthase gene (SAM2), big of Saccharomyces cerevisiae respectively The S adenosylmethionine decarboxylase gene (speD) in enterobacteria source and the spermidine synthase gene of Saccharomyces cerevisiae (speE), sequence is shown in SEQ ID NO.1-3.Using bacillus amyloliquefaciens LX-12 as starting strain, successively integrant expression SAM2 gene and speD gene, it is free to express saccharomyces cerevisiae speE gene, thus to obtain the solution starch brood cell of high yield spermidine Oxydans genetic engineering bacterium HSPM3, construction method are as follows:
1, plasmid T2-speD, T2-SAM2 are constructed: being expanded using the genomic DNA of bacillus amyloliquefaciens LX-12 as template Increasing obtains upstream and downstream homology arm (A, B) segment of prophage area integration site, and sequence is as shown in SEQ ID NO.4,5, with withered The genome of careless bacillus 168 is that template amplification obtains P43 promoter, and sequence is as shown in SEQ ID NO.6, with lichens brood cell The genome of bacillus WX-02 is that template amplification obtains terminator Tamly, and sequence is as shown in SEQ ID NO.7, with Escherichia coli DH5I genome is that template amplification obtains speD gene, and as shown in SEQ ID NO.2, the above-mentioned segment come that amplifies carries out sequence SOE-PCR fusion, fused fragment sequence is as shown in SEQ ID NO.8, by obtained SOE-PCR segment and temperature sensitive type plasmid T2 (ori) connection is simultaneously transformed into bacillus coli DH 5 alpha, confirms that insetion sequence is accurate by bacterium colony PCR and sequencing and integrates table Up to plasmid T2-speD；T2-SAM2 is also constructed with same method；
2, it constructs dual-gene integration bacterial strain LX12/MD: integrated plasmid T2-SAM2 is transformed into wild-type strain LX-12, Single double crossing over secondary culture is carried out, double crossing over verification result is as shown in figure 3, obtain SAM2 integration bacterial strain LX12::SAM2, herein On the basis of superposition incorporate speD gene and obtained double integration bacterial strain LX12/MD, wherein incorporating speD gene pairs host strain shadow Maximum is rung, the output increased of spermidine is most obvious；
3, it constructs free expression vector: according to the speE gene of the NCBI saccharomyces cerevisiae announced, it is excellent that codon being carried out to it Change, is expanded using the speE gene that full genome synthesizes as template, expand to obtain Promoter P43, end according to step 1 the method Promoter, target gene fragment and terminator are carried out SOE-PCR fusion, fused segment such as SEQ ID by only sub- Tamly Shown in NO.9, SOE-PCR is merged into segment and carrier pHY300PLK and carries out double digestion (BamHI and XbaI) and enzyme company, enzyme simultaneously It is big that connect product object is transformed into bacillus coli DH 5, passes through bacterium colony PCR and the sequencing confirmation accurate expression plasmid of insetion sequence pHY300-speE；
4, the free expression bacterial strain of building: free plasmid carrier pHY-speE electricity is gone into LX12/MD competent cell, is coated with In the plate for having tetracycline (Tet) resistance, picking transformant carries out bacterium colony PRC verifying, obtains engineering bacteria LX12/MD- PHY-speE is named as HSPM3.
Bacillus amyloliquefaciens engineering bacteria HSPM3 is stored in China typical culture collection on May 5th, 2019 The heart, deposit number are CCTCC NO:M2019326, classification naming: bacillus amyloliquefaciens (Bacillus amyloliquefaciens)HSPM3。
Application of the bacillus amyloliquefaciens engineering bacteria HSPM3 in production spermidine: picking colony HSPM3 is inoculated in LB training It supports in base and carries out seed culture, be inoculated into spermidine high-yield culture medium (sucrose 40g/L, (NH according to certain inoculum concentration4)2SO46.3g/L, peptone 10g/L, corn pulp 5g/L, NaCl 2.5g/L, KH2PO43.0g/L, MgSO4·7H2O 4.2g/ L, urea 2g/L, aspartic acid 3g/L, pH are to 6.5), and 37 DEG C, 180r/min shaken cultivation 60h.The yield of spermidine is up to 56.59mg/L improves 8.23 times than going out bacterium germination LX-12.
Beneficial effects of the present invention:
(1) integrant expression SAM2 gene and speD gene and free table are superimposed in bacillus amyloliquefaciens LX-12 for the first time Up to speE gene, engineered strain HSPM3 is obtained；
(2) wherein integrant expression speD (coding S adenosylmethionine decarboxylase gene) gene, to spermidine synthesis Facilitation effect is best；
(3) product spermidine is extracellular products, convenient for extracting and utilizing；
(4) product spermidine has potential application in medicine, food, field of health care products.
Detailed description of the invention
Fig. 1: the building process of integration vector T2-speD.
The double digestion identification of Fig. 2: 2 integrated plasmids；Swimming lane 1: linear plasmid T2 (2)-ori (passes through BamHI and XbaI enzyme It cuts)；Swimming lane M:DL5000DNA Maker；Swimming lane 2: integration vector T2-SAM2 (BamHI and XbaI) digestion result；Swimming lane 3: whole Close carrier T2-speD (BamHI and XbaI) digestion result.
Fig. 3: T2-speD double crossing over results strain PCR identification；Swimming lane M:DL5000DNA Marker；Swimming lane 1-2: with bacterium Strain LX12/MD total DNA is the PCR result of template (1:SAM2 primer is Y-F and Y-R, and target length is about 3275bp)；With bacterial strain LX-12 total DNA is the PCR result of template (2:SAM2 primer is Y-F and Y-R, and target length is about 2093bp)；Swimming lane 3-4: with Bacterial strain LX12/MD total DNA is the PCR result (3:speD primer Y2-F and Y2-R, target fragment length about 3083bp) of template；With Bacterial strain LX-12 total DNA is the PCR result (4:speD primer Y2-F and Y2-R, target fragment length about 2184bp) of template.
Fig. 4: the building process of free expression vector pHY-speE.
The double digestion identification of Fig. 5: speE free expression plasmid；Swimming lane M:DL5000DNA Maker；Swimming lane 1:speE segment SOE-PCR (passes through BamHI and XbaI enzyme cutting)；Swimming lane 2: linear plasmid pHY300 (passes through BamHI and XbaI enzyme cutting)；Swimming lane 3: Free expression plasmid pHY-speE (BamHI and XbaI) digestion result.
The PCR identification of Fig. 6: pHY-speE free expression bacterial strain；Swimming lane M:DL5000DNA Marker；Swimming lane 1: bacterial strain The PCR result (speE primer pHY300-F and pHY300-R) of LX12/MD/Phy-speE.
Fig. 7: HSPM3 and the fermentation results of LX-12, LX12::SAM2, LX12/MD compare.
Specific embodiment
The present invention is described in detail by the following examples, but all embodiments do not constitute any limit to the present invention System.
The building of 1 high yield spermidine bacterial strain HSPM3 bacterial strain of embodiment
1, the building of integration vector
With bacillus amyloliquefaciens LX-12, (on April 15th, 2015 is preserved in China typical culture collection center, preservation Number is CCTCC NO:M 2015234) genomic DNA as template, with
A-F:5’-CGGGATCCCGGGCTCAAGACTTCAGT-3 ' (underscore is BamHI restriction enzyme site)
A-R:5’-CGAAAACATACCACCTATCA CCTTTTTAGACGGTGAGCA-3’
B-F:5’-AGTGCGACGGCATTATTGCG CATTACGCCCGTGTCTGT-3’
B-R:5’-GCTCTAGACGCCTTATCGACATAGCTC-3 ' (underscore is XbaI enzyme cutting site) is primer point Upstream and downstream homology arm (A, the B) segment for not obtaining prophage area integration site is respectively 537bp and 545bp, sequence such as SEQ ID NO.4, shown in 5.
Using the genome of Bacillus subtillis 168 as template, with
P43-F:5’-TGCTCACCGTCTAAAAAGG TGATAGGTGGTATGTTTTCG-3’
P43-R:5 '-CATTGCAGTTTCAGTTTTTTCAA TTCATGTGTACATTCCTCTC-3 ' obtains for primer amplification To P43 promoter, size 305bp, sequence is as shown in SEQ ID NO.6.
Using the genome of bacillus licheniformis WX-02 as template, with
Tamyl-F:5’-GCAATATGCCAGCTGTTTAA AAGAGCAGAGAGGACGGATT-3’
Tamyl-R:5’-ACAGACACGGGCGTAATG CGCAATAATGCCGTCGCACT-3’
Terminator Tamly is obtained for primer amplification, size is respectively 501bp, and sequence is as shown in SEQ ID NO.7.
Using bacillus coli DH 5 alpha genome as template, with
speD-F:5’-TGCTCACCGTCTAAAAAGG TGATAGGTGGTATGTTTTCG-3’
speD-R:5’-ACAGACACGGGCGTAATG CGCAATAATGCCGTCGCACT-3’
It is directly expanded for primer and obtains speD gene, size 795bp, sequence is as shown in SEQ ID NO.2.
The above-mentioned segment come that amplifies carries out SOE-PCR fusion, and fused clip size is 2683bp, sequence such as SEQ Shown in ID NO.8.With restriction enzyme BamHI and XbaI double digestion (as shown in Figure 2), obtained SOE-PCR segment and warp The same processed temperature sensitive type plasmid T2 (ori) of BamHI and XbaI double digestion carries out enzyme company, and enzyme-linked product is transformed into Escherichia coli DH5 α is coated on culture overnight on the plate for blocking that resistance, and scribing line is incubated at identical resistance after growing single colonie on plate Plate on cultivate 8h or so, use plasmid universal primer to carry out bacterium colony PCR verifying.It is correct that verifying is selected after electrophoresis is verified Positive clone molecule culture extracts plasmid and is sequenced through company, the comparison result on NCBI, confirmation insetion sequence is correct Function constructs integrant expression plasmid T2-speD.
T2-SAM2 is also constructed using same method, primer sequence is as follows:
SAM2-A-F:5’-CGGGATCC CTTCGGAACTGACACCGT-3’
SAM2-A-R:5’-CGAAAACATACCACCTATCA AAGCGCCAAAATCGTAAAC-3’
SAM2-P43-F:5’-GTTTACGATTTTGGCGCTT TGATAGGTGGTATGTTTTCG-3’
SAM2-P43-R:5’-AAGTTTTGCTCTTGGACAT TTCATGTGTACATTCCTCTC-3’
SAM2-F:5’-GAGAGGAATGTACACATGAA ATGTCCAAGAGCAAAACTT-3’
SAM2-R:5’-AATCCGTCCTCTCTGCTCTT TTAAAATTCCAATTTCT-3’
SAM2-Tamly-F:5’-AGAAATTGGAATTTTAAAAGAGCAGAGAGGACGGATT-3’
SAM2-Tamly-R:5’-AACACGCCGACCATTTTCAAGAGCAGAGAGGACGGATT-3’
SAM2-B-F:5’-AATCCGTCCTCTCTGCTCTT GAAAATGGTCGGCGTGTT-3’
SAM2-B-R:5’-GCTCTAGA GGCGCAGTCAAGCAATTT-3’。
2, the building of integrant expression bacterial strain
Integrated plasmid T2-SAM2 (50ng/ μ L) the addition bacillus amyloliquefaciens LX-12 competence for drawing 10 μ L or so is thin Born of the same parents are resuspended after mixing and are transferred in the 2mm electrotransformation cup being pre-chilled in advance, ice bath 10min, pass through electric pulse conversion instrument 2.4KV electricity Piezoelectricity is hit once, is rapidly added 800 μ L recovery medias, is placed in 37 DEG C of constant-temperature tables with 100-120r/min renewal cultivation 3h or so is applied to the resistant panel containing corresponding antibiotic, 37 DEG C of culture 16-18h.Picking single colonie carries out bacterium colony PCR verifying, It verifies correct positive transformant to be inoculated in the LB liquid medium containing 20 μ g/mL card that antibiotic, in 45 DEG C, 180r/min Shaken cultivation 12h or so.
The progress double crossing over culture of 100 μ L to 5mL LB liquid mediums is drawn from the single exchange strains obtained (to be not added It is anti-), it is placed in 37 DEG C of shaken cultivation 12h.Take 5mL LB liquid medium serial dilution 106, therefrom drawing 100 μ L, to be coated on LB flat On plate, while 10 will be diluted3Be then placed in shaken cultivation 12h in 37 DEG C of constant-temperature tables, successively secondary culture.It is flat to LB simultaneously The single colonie grown on plate respectively corresponds dibbling in LB plate and trains containing 37 DEG C of constant temperature on the plate for blocking that resistance (Kan), are placed in It supports and cultivates 5-8h or so in case；It is chosen at LB plated growth and carries out PCR verifying in the non-growing single colonie of plate containing Kan (as shown in Figure 3) filters out bacterium colony and verifies correct double crossing over bacterial strain, as LX12::SAM2.It will by identical method SpeD gene integration (as shown in Figure 3) into LX12::SAM2, obtains dual-gene integration bacterial strain, as LX12/MD.Wherein bacterium colony Verifying primer is respectively as follows:
(SAM2)Y-F:5’—CGGAAAATGAACGAGAAAC—3’
(SAM2)Y-R:5’—GAAATCGGGAATGCTGTGA—3’
(speD)Y2-F:5’—AAGAGTCATACAATGCGGTC—3’
(speD)Y2-R:5’—GGCCTTTTCAATCTCTTCAG—3’
3, the building of free expression vector
It expands to obtain P43 promoter, P43 promoter according to step 1 the method, according to the NCBI saccharomyces cerevisiae announced SpeE gene carries out codon optimization to it, with the speE gene (sequence is as shown in SEQ ID NO.3) of full genome synthesis for mould Plate, with
speE-F:5’-GAGAGGAATGTACACATGAACATATGGCGCAGGAAATTAC-3’
speE-R:5’-AATCCGTCCTCTCTGCTCTTCTCGAGCTAATTCAGTTCTTTC-3’
SpeE gene, size 882bp are obtained for primer amplification.
The above-mentioned segment come that amplifies carries out SOE-PCR fusion, and fused clip size is 1688bp, sequence such as SEQ Shown in ID NO.9.With restriction enzyme BamHI and XbaI double digestion (as shown in Figure 5), obtained SOE-PCR segment and warp The same processed fabric shuttle-type plasmid pHY300PLK of BamHI and XbaI double digestion carries out enzyme company, and enzyme-linked product is transformed into Escherichia coli DH5 α is coated on culture overnight on the plate with Fourth Ring resistance, after growing single colonie on plate Scribing line, which is incubated on the plate of identical resistance, cultivates 8h or so, carries out bacterium colony PCR verifying using plasmid universal primer.It is tested through electrophoresis The correct positive clone molecule culture of verifying is selected after card, extract plasmid and is sequenced through company, the comparison result on NCBI, and confirmation is inserted Enter sequence and correctly successfully constructs free expression plasmid pHY-speE.
4, dissociate and express the building of bacterial strain
Free plasmid carrier pHY-speE electricity is gone into LX12/MD competent cell, coating has tetracycline (Tet) resistance Plate, in 37 DEG C of constant incubators cultivate 16-24h obtain corresponding transformant, a certain number of transformants of picking are in right It answers plate streaking culture 8h or so to carry out bacterium colony PCR verifying (as shown in Figure 6), correct bacterium colony picking will be verified in 5mL liquid LB culture medium (has one thousandth Fourth Ring antibiotic) in right amount, is placed in 37 DEG C of constant-temperature tables and cultivates 12h in 180r/min, draws 800 μ L are stored in glycerol tube, and glycerol tube is placed in -80 DEG C of ultra low temperature freezers and saves.Engineering is obtained using genetic engineering transformation Bacterium LX12/MD-pHY-speE, is named as HSPM3.
The spermidine of 2 bacillus amyloliquefaciens HSPM3 of embodiment ferments
It picks them separately bacterium colony bacillus amyloliquefaciens LX-12, LX12::SAM2, LX12/MD and HSPM3 and is inoculated in 5mL's In LB culture medium, 37 DEG C, 180r/min shaken cultivation is stayed overnight.It is transferred in the LB culture medium of 50mL with 4% inoculum concentration again, directly To OD600When for 3.0-4.0 or so, be inoculated into the spermidine high-yield culture medium of 25mL with 3% inoculum concentration (sucrose 40g/L, (NH4)2SO46.3g/L, peptone 10g/L, corn pulp 5g/L, NaCl 2.5g/L, KH2PO43.0g/L, MgSO4·7H2O 4.2g/L, urea 2g/L, aspartic acid 3g/L, pH 6.5).37 DEG C, 180r/min shaken cultivation 60h.Detection method passes through height Effect liquid phase chromatogram method carries out, and the perchloric acid of 1.5mL 0.4mol/L is added to containing in 0.5mL fermentation liquid, every 15min shakes Once, it is centrifugated supernatant, takes 250 μ L supernatants, sequentially adds 100 μ L inner mark solutions (100mg/L 1,7- diamino heptan Alkane), 75 μ L are saturated NaHCO3Solution, 25 μ L 2mol/L NaOH solutions and 500 μ L dansyl Cl (5g/L) derivatization reagents, Perform the derivatization processing under the conditions of being protected from light: 50 DEG C, 45min；It is added 25 μ L ammonia spirits, 50 DEG C, 15min.Acetonitrile is added to determine molten arrive 1.5mL mixes 1min, and 2500 × g is centrifuged 5min, and supernatant is filtered through 0.22 μm of organic filter film, passes through high performance liquid chromatography Method detects Content of Biogenic Amines: Agilent 1100HPLC chromatograph, ZORBAX Eclipse XDB-C18 (4.6mm × 250mm, 5 μ M) chromatographic column, mobile phase carry out gradient elution, flow velocity 1mL/min, Detection wavelength 254nm, column temperature 30 using ultrapure water and acetonitrile DEG C, 10 μ L of sample volume.Judge that biogenic amine type and content, testing result are as shown in Figure 7 according to appearance time and peak area size. Wherein the yield of spermidine has reached 34.44mg/L after integrant expression speD gene, after the expression speE that dissociates, the production of spermidine Amount, which has reached maximum output, can reach 56.59mg/L, improve 8.23 times than going out bacterium germination LX-12.
Sequence table
<110>Hua Zhong Agriculture University
The bacillus amyloliquefaciens engineering bacteria of<120>one plant heights production spermidine
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1155
<212> DNA
<213>saccharomyces cerevisiae CICC 31001 (Saccharomyces cerevisiae)
<400> 1
atgtccaaga gcaaaacttt cttatttacc tctgaatccg tcggtgaagg tcacccagac 60
aagatttgtg accaagtttc tgatgctatt ttggacgctt gtttagaaca agatccattc 120
tccaaggttg cctgtgaaac agctgccaaa actggtatga ttatggtttt cggtgaaatt 180
accaccaaag ctagacttga ctaccaacaa atagtaagag ataccatcaa gaagattggt 240
tatgacgatt ctgccaaggg tttcgactac aagacatgta atgttttagt agctatcgaa 300
caacaatctc cagatatcgc tcaaggtctg cactatgaaa agagcttaga agacttaggt 360
gctggtgacc aaggtataat gtttggttac gctacagacg aaactccaga agggttacca 420
ttgaccattc ttttggctca caaattgaac atggctatgg cagatgctag aagagatggt 480
tctctcccat ggttgagacc agacacaaag actcaagtca ctgtcgaata cgaagacgac 540
aatggtagat gggttccaaa gaggatagat accgttgtta tttctgctca acatgctgat 600
gaaatttcca ccgctgactt gagaactcaa cttcaaaaag atattgttga aaaggtcata 660
ccaaaggata tgttagacga aaataccaaa tatttcatcc aaccatccgg tagattcgtc 720
atcggtggtc ctcaaggtga cgctggtttg accggtagaa agattattgt cgacgcttac 780
ggtggtgcct catccgtcgg tggtggtgcc ttctccggta aggactattc caaggtcgat 840
cgttccgctg cttacgctgc tagatgggtt gccaagtctc tagttgccgc tggtttgtgt 900
aagagagtcc aagtccaatt ttcatatgct attggtattg ctgaaccatt gtctttacat 960
gtggacacct atggtacagc tacaaaatca gatgacgaaa tcattgaaat tattaagaag 1020
aacttcgact tgagaccagg tgtgttagta aaggaattag atttggctag accaatttac 1080
ttaccaaccg cttcttatgg tcacttcact aatcaagagt actcatggga aaaaccaaag 1140
aaattggaat tttaa 1155
<210> 2
<211> 795
<212> DNA
<213>bacillus coli DH 5 alpha (Escherichia coli)
<400> 2
ttgaaaaaac tgaaactgca tggctttaat aatctgacca aaagtctgag tttttgtatt 60
tacgatatct gctacgccaa aactgccgaa gagcgcgacg gttatattgc ttatatcgat 120
gaactctata atgccaaccg tctgaccgaa atcctgtcag aaacctgttc cattatcggg 180
gctaatattc ttaacatcgc ccgccaggat tacgaaccac agggtgccag cgtcactatt 240
ctggtgagtg aagaaccggt tgacccgaaa ctcatcgaca aaacagaaca ccccggccca 300
ctgccagaaa cggtcgttgc ccatcttgat aaaagtcata tttgcgtaca tacctacccg 360
gaaagtcatc ctgaaggcgg tttatgtacc ttccgcgccg atattgaagt ctctacctgc 420
ggcgtgattt ctccgctgaa ggcgctgaat tacctgatcc accagcttga gtccgatatc 480
gtaaccattg attatcgcgt gcgcggtttt acccgcgaca ttaacggtat gaagcacttt 540
atcgaccatg agattaattc gattcagaac tttatgtctg acgatatgaa ggcgctgtat 600
gacatggtgg atgtgaacgt ctatcaggaa aatatcttcc ataccaagat gttgcttaaa 660
gagttcgacc ttaagcacta catgttccac accaaaccgg aagacttaac cgacagcgag 720
cgccaggaaa ttaccgctgc gctgtggaaa gaaatgcgcg agatttatta cgggcgcaat 780
atgccagctg tttaa 795
<210> 3
<211> 891
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
catatggcgc aggaaattac acatccgaca attgtcgatg gctggtttag agaaattagc 60
gatacaatgt ggccgggcca ggcgatgaca ctgaaagtcg aaaaagtcct gcatcatgaa 120
aaaagcaaat atcaggatgt cctgattttt aaaagcacaa catatggcaa tgtcctggtc 180
ctggataatg tcattcaggc gacagaaaga gatgaatttg cgtatcagga aatgattgcg 240
catctggcgc tgaatagcca tccgaatccg aaaaaagtcc tggtcattgg cggcggcgat 300
ggcggcgtcc tgagagaagt cgtcaaacat gatagcgtcg aagaagcgtg gctgtgcgat 360
attgatgaag cggtcattag actgagcaaa gaatatctgc cggaaatggc ggcgagctat 420
agccatccga aagtcaaaac acatattggc gatggctttc agtttctgag agattatcag 480
aatacatttg atgtcattat tacagatagc agcgatccgg aaggcccggc ggaaacactg 540
tttcagaaag aatattttca gctgctgaat agcgcgctga cagaaaaagg cgtcattaca 600
acacaggcgg aaagcatgtg gattcatctg ccgattatta aagatctgaa aaaagcgtgc 660
agcgaagtct ttccggtcgc ggaatatagc tttgtcacaa ttccgacata tccgacaggc 720
acaattggct ttatggtctg cagcaaagat aaaacatgca atgtcaaaaa accgctgaga 780
gaaattagcg atgaaaaaga agcggaactg tatagatatt ataataaaaa aattcatgaa 840
gcgagctttg tcctgccgac atgggcggcg aaagaactga attagctcga g 891
<210> 4
<211> 537
<212> DNA
<213>bacillus amyloliquefaciens LX-12 (Bacillus amyloliquefaciens)
<400> 4
cgggctcaag acttcagtat acaaaaaagc tgaaacggtt caaacatatc tattgctcag 60
acagctgtga aaatacgatc cgcgaattgc agaacttaac gtacgcaaaa aacaaaaacg 120
gcgttctgtc ggaagatgag ttttcaattg atccccacac actttcagcc atttggtatg 180
cgctggatga ctatgacgcg gcggatctga aagatgcatc acaaaaacgg agacgtccga 240
atcgggaaag gaggagatag gcgttgccta actatcaaaa cgttagagcc accgtcttta 300
aatcaaaaat ggccgcgccg caggcaaggc agatgaacga agatcaattt gccgatctgt 360
acggcgaaga catcatttca ccgccctata atctcattga actgaaaaca atcgccgaat 420
actcgacgat tcttcagcag tgcattgacg cgtatcgggt caatattacg ggttttgggt 480
tcgatgtgga atataccttt gatgtaaata gcccagattg ctcaccgtct aaaaagg 537
<210> 5
<211> 545
<212> DNA
<213>bacillus amyloliquefaciens LX-12 (Bacillus amyloliquefaciens)
<400> 5
cattacgccc gtgtctgtgg aaattaaatc acttgcggaa attctgcagg atgatgcgct 60
gtttcttgaa tatgacgaca gaagcagaaa taaactccgt tccgctttcc gtctcccgcc 120
gctttatacg ggagaggcgc aggaatacaa caaagccaca gccgatacgg cacggaaaat 180
aacggaggag caggtgtttc agccggagcg gaaaacgctg attaataagc tcaacacgtt 240
atttttgcct gaactgggtc tccacgatgt acagctcaca ttaaaagggc ctgattttcg 300
cgatccgctt gaaattgcga aggtgcttac gccatttatt tccgccggcg cggtctctcc 360
taatgacctc cgtgatctgg cgggaagagt gctcggcaag acgcttgagg aatggcctga 420
agagtactac agccggccgg tgctgaaagg gaaataggag caatcctgaa agggggtgaa 480
aacatctcgt gccgagagaa ttgagaaatg ccgtcatcag ttttgtgagc tatgtcgata 540
aggcg 545
<210> 6
<211> 305
<212> DNA
<213>bacillus subtillis 168 (Bacillus subtilis)
<400> 6
tgataggtgg tatgttttcg cttgaacttt taaatacagc cattgaacat acggttgatt 60
taataactga caaacatcac cctcttgcta aagcggccaa ggacgctgcc gccggggctg 120
tttgcgtttt taccgtgatt tcgtgtatca ttggtttact tatttttttg ccaaagctgt 180
aatggctgaa aattcttaca tttattttac atttttagaa atgggcgtga aaaaaagcgc 240
gcgattatgt aaaatataaa gtgatagcgg taccattata ggtaagagag gaatgtacac 300
atgaa 305
<210> 7
<211> 501
<212> DNA
<213>bacillus licheniformis WX-02 (Bacillus licheniformis)
<400> 7
aagagcagag aggacggatt tcctgaagga aatccgtttt tttattttgc ccgtcttata 60
aatttctttg attacatttt ataattaatt ttaacaaagt gtcatcagcc ctcaggaagg 120
acttgctgac agtttgaatc gcataggtaa ggcggggatg aaatggcaac gttatctgat 180
gtagcaaaga aagcaaatgt gtcgaaaatg acggtatcgc gggtgatcaa tcatcctgag 240
actgtgacgg atgaattgaa aaagcttgtt cattccgcaa tgaaggagct caattatata 300
ccgaactatg cagcaagagc gctcgttcaa aacagaacac aggtcgtcaa gctgctcata 360
ctggaagaaa tggatacaac agaaccttat tatatgaatc tgttaacggg aatcagccgc 420
gagctggacc gtcatcatta tgctttgcag cttgtcacaa ggaaatctct caatatcggc 480
cagtgcgacg gcattattgc g 501
<210> 8
<211> 2683
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
cgggctcaag acttcagtat acaaaaaagc tgaaacggtt caaacatatc tattgctcag 60
acagctgtga aaatacgatc cgcgaattgc agaacttaac gtacgcaaaa aacaaaaacg 120
gcgttctgtc ggaagatgag ttttcaattg atccccacac actttcagcc atttggtatg 180
cgctggatga ctatgacgcg gcggatctga aagatgcatc acaaaaacgg agacgtccga 240
atcgggaaag gaggagatag gcgttgccta actatcaaaa cgttagagcc accgtcttta 300
aatcaaaaat ggccgcgccg caggcaaggc agatgaacga agatcaattt gccgatctgt 360
acggcgaaga catcatttca ccgccctata atctcattga actgaaaaca atcgccgaat 420
actcgacgat tcttcagcag tgcattgacg cgtatcgggt caatattacg ggttttgggt 480
tcgatgtgga atataccttt gatgtaaata gcccagattg ctcaccgtct aaaaaggtga 540
taggtggtat gttttcgctt gaacttttaa atacagccat tgaacatacg gttgatttaa 600
taactgacaa acatcaccct cttgctaaag cggccaagga cgctgccgcc ggggctgttt 660
gcgtttttac cgtgatttcg tgtatcattg gtttacttat ttttttgcca aagctgtaat 720
ggctgaaaat tcttacattt attttacatt tttagaaatg ggcgtgaaaa aaagcgcgcg 780
attatgtaaa atataaagtg atagcggtac cattataggt aagagaggaa tgtacacatg 840
aattgaaaaa actgaaactg catggcttta ataatctgac caaaagtctg agtttttgta 900
tttacgatat ctgctacgcc aaaactgccg aagagcgcga cggttatatt gcttatatcg 960
atgaactcta taatgccaac cgtctgaccg aaatcctgtc agaaacctgt tccattatcg 1020
gggctaatat tcttaacatc gcccgccagg attacgaacc acagggtgcc agcgtcacta 1080
ttctggtgag tgaagaaccg gttgacccga aactcatcga caaaacagaa caccccggcc 1140
cactgccaga aacggtcgtt gcccatcttg ataaaagtca tatttgcgta catacctacc 1200
cggaaagtca tcctgaaggc ggtttatgta ccttccgcgc cgatattgaa gtctctacct 1260
gcggcgtgat ttctccgctg aaggcgctga attacctgat ccaccagctt gagtccgata 1320
tcgtaaccat tgattatcgc gtgcgcggtt ttacccgcga cattaacggt atgaagcact 1380
ttatcgacca tgagattaat tcgattcaga actttatgtc tgacgatatg aaggcgctgt 1440
atgacatggt ggatgtgaac gtctatcagg aaaatatctt ccataccaag atgttgctta 1500
aagagttcga ccttaagcac tacatgttcc acaccaaacc ggaagactta accgacagcg 1560
agcgccagga aattaccgct gcgctgtgga aagaaatgcg cgagatttat tacgggcgca 1620
atatgccagc tgtttaaaag agcagagagg acggatttcc tgaaggaaat ccgttttttt 1680
attttgcccg tcttataaat ttctttgatt acattttata attaatttta acaaagtgtc 1740
atcagccctc aggaaggact tgctgacagt ttgaatcgca taggtaaggc ggggatgaaa 1800
tggcaacgtt atctgatgta gcaaagaaag caaatgtgtc gaaaatgacg gtatcgcggg 1860
tgatcaatca tcctgagact gtgacggatg aattgaaaaa gcttgttcat tccgcaatga 1920
aggagctcaa ttatataccg aactatgcag caagagcgct cgttcaaaac agaacacagg 1980
tcgtcaagct gctcatactg gaagaaatgg atacaacaga accttattat atgaatctgt 2040
taacgggaat cagccgcgag ctggaccgtc atcattatgc tttgcagctt gtcacaagga 2100
aatctctcaa tatcggccag tgcgacggca ttattgcgca ttacgcccgt gtctgtggaa 2160
attaaatcac ttgcggaaat tctgcaggat gatgcgctgt ttcttgaata tgacgacaga 2220
agcagaaata aactccgttc cgctttccgt ctcccgccgc tttatacggg agaggcgcag 2280
gaatacaaca aagccacagc cgatacggca cggaaaataa cggaggagca ggtgtttcag 2340
ccggagcgga aaacgctgat taataagctc aacacgttat ttttgcctga actgggtctc 2400
cacgatgtac agctcacatt aaaagggcct gattttcgcg atccgcttga aattgcgaag 2460
gtgcttacgc catttatttc cgccggcgcg gtctctccta atgacctccg tgatctggcg 2520
ggaagagtgc tcggcaagac gcttgaggaa tggcctgaag agtactacag ccggccggtg 2580
ctgaaaggga aataggagca atcctgaaag ggggtgaaaa catctcgtgc cgagagaatt 2640
gagaaatgcc gtcatcagtt ttgtgagcta tgtcgataag gcg 2683
<210> 9
<211> 1697
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
tgataggtgg tatgttttcg cttgaacttt taaatacagc cattgaacat acggttgatt 60
taataactga caaacatcac cctcttgcta aagcggccaa ggacgctgcc gccggggctg 120
tttgcgtttt taccgtgatt tcgtgtatca ttggtttact tatttttttg ccaaagctgt 180
aatggctgaa aattcttaca tttattttac atttttagaa atgggcgtga aaaaaagcgc 240
gcgattatgt aaaatataaa gtgatagcgg taccattata ggtaagagag gaatgtacac 300
atgaacatat ggcgcaggaa attacacatc cgacaattgt cgatggctgg tttagagaaa 360
ttagcgatac aatgtggccg ggccaggcga tgacactgaa agtcgaaaaa gtcctgcatc 420
atgaaaaaag caaatatcag gatgtcctga tttttaaaag cacaacatat ggcaatgtcc 480
tggtcctgga taatgtcatt caggcgacag aaagagatga atttgcgtat caggaaatga 540
ttgcgcatct ggcgctgaat agccatccga atccgaaaaa agtcctggtc attggcggcg 600
gcgatggcgg cgtcctgaga gaagtcgtca aacatgatag cgtcgaagaa gcgtggctgt 660
gcgatattga tgaagcggtc attagactga gcaaagaata tctgccggaa atggcggcga 720
gctatagcca tccgaaagtc aaaacacata ttggcgatgg ctttcagttt ctgagagatt 780
atcagaatac atttgatgtc attattacag atagcagcga tccggaaggc ccggcggaaa 840
cactgtttca gaaagaatat tttcagctgc tgaatagcgc gctgacagaa aaaggcgtca 900
ttacaacaca ggcggaaagc atgtggattc atctgccgat tattaaagat ctgaaaaaag 960
cgtgcagcga agtctttccg gtcgcggaat atagctttgt cacaattccg acatatccga 1020
caggcacaat tggctttatg gtctgcagca aagataaaac atgcaatgtc aaaaaaccgc 1080
tgagagaaat tagcgatgaa aaagaagcgg aactgtatag atattataat aaaaaaattc 1140
atgaagcgag ctttgtcctg ccgacatggg cggcgaaaga actgaattag ctcgagaaga 1200
gcagagagga cggatttcct gaaggaaatc cgttttttta ttttgcccgt cttataaatt 1260
tctttgatta cattttataa ttaattttaa caaagtgtca tcagccctca ggaaggactt 1320
gctgacagtt tgaatcgcat aggtaaggcg gggatgaaat ggcaacgtta tctgatgtag 1380
caaagaaagc aaatgtgtcg aaaatgacgg tatcgcgggt gatcaatcat cctgagactg 1440
tgacggatga attgaaaaag cttgttcatt ccgcaatgaa ggagctcaat tatataccga 1500
actatgcagc aagagcgctc gttcaaaaca gaacacaggt cgtcaagctg ctcatactgg 1560
aagaaatgga tacaacagaa ccttattata tgaatctgtt aacgggaatc agccgcgagc 1620
tggaccgtca tcattatgct ttgcagcttg tcacaaggaa atctctcaat atcggccagt 1680
gcgacggcat tattgcg 1697

Claims (2)

1. the bacillus amyloliquefaciens engineering bacteria of plant height production spermidine, which is characterized in that the deposit number of the bacterial strain is CCTCC NO:M2019326.
2. application of the bacillus amyloliquefaciens engineering bacteria described in claim 1 in production spermidine.
CN201910409349.3A 2019-05-16 2019-05-16 Engineering bacterium of bacillus amyloliquefaciens for producing spermidine Active CN110257313B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910409349.3A CN110257313B (en) 2019-05-16 2019-05-16 Engineering bacterium of bacillus amyloliquefaciens for producing spermidine

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910409349.3A CN110257313B (en) 2019-05-16 2019-05-16 Engineering bacterium of bacillus amyloliquefaciens for producing spermidine

Publications (2)

Publication Number Publication Date
CN110257313A true CN110257313A (en) 2019-09-20
CN110257313B CN110257313B (en) 2020-12-08

Family

ID=67913225

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910409349.3A Active CN110257313B (en) 2019-05-16 2019-05-16 Engineering bacterium of bacillus amyloliquefaciens for producing spermidine

Country Status (1)

Country Link
CN (1) CN110257313B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111019960A (en) * 2019-11-26 2020-04-17 南京工业大学 Method for preparing spermidine by enzyme method
CN114874962A (en) * 2022-06-01 2022-08-09 深圳中科欣扬生物科技有限公司 Gene for synthesizing spermidine and construction of high-yield spermidine strain

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1654542B1 (en) * 2003-08-08 2008-12-24 Roche Diagnostics GmbH Use of protein spermidine synthase (spee) as a marker for colorectal cancer
CN101679964A (en) * 2008-04-10 2010-03-24 韩国科学技术院 Mutant microorganism with high ability of producing putrescine and preparation of putrescine using same
CN102051351A (en) * 2009-10-30 2011-05-11 中国科学院植物研究所 Drought-resistance related key enzyme derived from Leymus chinensis (Trin.) Tzvel. as well as coding gene and application thereof
CN103563996A (en) * 2013-11-12 2014-02-12 无锡亚克生物科技有限公司 Application of bacillus subtilis G1 in plant growth promoting
CN104031959A (en) * 2014-06-26 2014-09-10 华东理工大学 Method for improving yield of S-adenosylmethionine through gene expression regulation
CN106591332A (en) * 2016-11-10 2017-04-26 华南农业大学 Eggplant spermidine synthase gene SmSPDS and applications thereof to improvements of eggplant capability for resisting bacterial wilt
CN108070548A (en) * 2018-02-07 2018-05-25 华中农业大学 One plant height produces the bacillus amyloliquefaciens engineering bacteria and fermentation process of 1-DNJ

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1654542B1 (en) * 2003-08-08 2008-12-24 Roche Diagnostics GmbH Use of protein spermidine synthase (spee) as a marker for colorectal cancer
CN101679964A (en) * 2008-04-10 2010-03-24 韩国科学技术院 Mutant microorganism with high ability of producing putrescine and preparation of putrescine using same
CN102051351A (en) * 2009-10-30 2011-05-11 中国科学院植物研究所 Drought-resistance related key enzyme derived from Leymus chinensis (Trin.) Tzvel. as well as coding gene and application thereof
CN103563996A (en) * 2013-11-12 2014-02-12 无锡亚克生物科技有限公司 Application of bacillus subtilis G1 in plant growth promoting
CN104031959A (en) * 2014-06-26 2014-09-10 华东理工大学 Method for improving yield of S-adenosylmethionine through gene expression regulation
CN106591332A (en) * 2016-11-10 2017-04-26 华南农业大学 Eggplant spermidine synthase gene SmSPDS and applications thereof to improvements of eggplant capability for resisting bacterial wilt
CN108070548A (en) * 2018-02-07 2018-05-25 华中农业大学 One plant height produces the bacillus amyloliquefaciens engineering bacteria and fermentation process of 1-DNJ

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
C W TABOR 等: "Spermidine synthase of Escherichia coli: localization of the speE gene", 《PNAS》 *
CELIA WHITE TABOR 等: "The speEspeD Operon of Escherichia Coli. Formation and Processing of a Proenzyme Form of S-adenosylmethionine Decarboxylase", 《THE JOURNAL OF BIOLOGICAL CEMISTRY》 *
LIN CHEN 等: "Beneficial Rhizobacterium Bacillus Amyloliquefaciens SQR9 Induces Plant Salt Tolerance Through Spermidine Production", 《MOL PLANT MICROBE INTERACT》 *
N HAMASAKI-KATAGIRI 等: "Spermidine Biosynthesis in Saccharomyces Cerevisae: Polyamine Requirement of a Null Mutant of the SPE3 Gene (Spermidine Synthase)", 《GENE》 *
闵钰 等: "解淀粉芽胞杆菌中speE基因在亚精胺合成中的功能鉴定", 《食品与发酵工业》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111019960A (en) * 2019-11-26 2020-04-17 南京工业大学 Method for preparing spermidine by enzyme method
CN111019960B (en) * 2019-11-26 2023-10-10 南京工业大学 Method for preparing spermidine by enzyme method
CN114874962A (en) * 2022-06-01 2022-08-09 深圳中科欣扬生物科技有限公司 Gene for synthesizing spermidine and construction of high-yield spermidine strain
CN114874962B (en) * 2022-06-01 2023-10-24 深圳中科欣扬生物科技有限公司 Gene for synthesizing spermidine and construction of high-yield spermidine strain

Also Published As

Publication number Publication date
CN110257313B (en) 2020-12-08

Similar Documents

Publication Publication Date Title
CN106190937B (en) A method of the building &#34;-rock algae lactose of recombination bacillus coli biosynthesis 2
CN104894047B (en) The construction method of the recombined bacillus subtilis of the epimerase of expression D psicoses 3 based on D alanine deficiency selection markers
CN106119268B (en) A method of improving alpha-L-Rhamnosidase r-Rha1 thermal stability
CN107502585A (en) One plant of bacillus licheniformis engineering bacteria for efficiently synthesizing poly- γ glutamic acid
CN105296456B (en) A kind of stability-enhanced glutamic acid decarboxylase enzyme mutant of pH and its application
CN106967659A (en) A kind of structure and fermentation process of the antibiotic-free resistance recombined bacillus subtilis for expressing glutamate decarboxylase
CN106190938A (en) The recombination bacillus coli of a kind of structure and the method for biosynthesis 3 &#39; saliva lactose
CN101210230A (en) Gene engineering bacterium for producing beta-alanine and its preparation and application
CN110257313A (en) The bacillus amyloliquefaciens engineering bacteria of one plant height production spermidine
CN110106206A (en) A kind of corynebacterium glutamicum construction method improving L-lysine yield and stability
CN109402034A (en) Only produce recombinant bacterium and its application of a kind of branched-chain amino acid
CN108070548A (en) One plant height produces the bacillus amyloliquefaciens engineering bacteria and fermentation process of 1-DNJ
CN107460203A (en) A kind of recombinant bacterium and construction method and purposes for producing rhodioside and the like
CN113846024B (en) Method for reducing byproduct fumaric acid in L-malic acid fermentation process, strain and application
CN106119145A (en) A kind of Corynebacterium glutamicum mutant and application
CN104212757A (en) Method for high-efficiently producing L-theanine through production of coli [gamma]-glutamylmethylamine synthetase with escherichia coli
CN110343709A (en) A kind of arctic nocardia lasso trick peptide gene cluster and its cloning and expression method
CN112080452B (en) High-yield phenyllactic acid bacillus licheniformis genetically engineered bacterium, method for producing phenyllactic acid and application
CN106520652B (en) One plant of Corynebacterium glutamicum and its key gene for synthesizing tryptophan
CN104745520B (en) A kind of strain excellent of high yield L phenylalanines and its application
CN109913508A (en) A method of phloretin is synthesized using cyanobacteria
CN105200075B (en) The building and application method of plasmid and its corresponding engineering bacteria for theanine production
CN107460152A (en) Produce recombinant bacterium, construction method and the purposes of rhodioside and the like
CN109929854A (en) One plant is overexpressed the engineering bacteria and its construction method that catabolite controls albumin A encoding gene
CN109609421A (en) A kind of biological method improving resveratrol cumulant

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant