CN110241138A - A kind of preparation method of human retinoblastoma model - Google Patents
A kind of preparation method of human retinoblastoma model Download PDFInfo
- Publication number
- CN110241138A CN110241138A CN201910236645.8A CN201910236645A CN110241138A CN 110241138 A CN110241138 A CN 110241138A CN 201910236645 A CN201910236645 A CN 201910236645A CN 110241138 A CN110241138 A CN 110241138A
- Authority
- CN
- China
- Prior art keywords
- human
- preparation
- human retinoblastoma
- gene
- culture medium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides a kind of preparation method of human retinoblastoma model, its step includes: (a) by carrying out gene editing to human retinoblastoma RB1 allele in human embryo stem cell, or the reprogramming of somatic cells behaviour for carrying RB1 allelic mutation patient Rb is induced multi-potent stem cell, establish the human pluripotent stem cells system of RB1 allelic mutation or knockout, further screening and identification；(b) human retinoblastoma model is divided into using the human pluripotent stem cells of external three-dimensional retina differentiated system induction RB1 allelic mutation or knockout.Present invention utilizes RB1 gene mutation identical with patient's genetic background or the multipotential stem cells of knockout, human retinoblastoma is spontaneously formed in retinal tissue growth course in vitro, can truer simulation patient tumour growth environment and tumor development process, for further research Tumorigenesis and treatment provide relatively reliable model.
Description
Technical field
The present invention relates to medicine, the model field of life science more particularly to a kind of human retinoblastoma models
Preparation method.
Background technique
Retinoblastoma (Rb) is the most common intraocular malignant for being primary in retina of infant, accounts for children's evil
Property tumour 2%~4%, disease incidence is about 1/15000~1/20000, wherein about 95% case occur before 5 years old, it is Unilateral
At 2~3 years old, bilateral Rb's age of onset of Rb fell ill earlier.Many places are in middle and advanced stage when patient Rb is medical, and treatment is more difficult, easily
Relapse and metastasis seriously endangers the eyesight and life of infant.Rb point is genotype and non-genotype, genotype accounting about 35%-45%,
Often to dye dominant inheritance, non-genotype accounts for 55%-65%；Eyes Rb is mostly genotypical, rather than genotype Rb is usually single
Eye morbidity.Studies have shown that about 93% genotype and 87% non-genotype Rb patient be there are the mutation of tumor suppressor gene RB1,
The mutation of RB1 allele or missing are the immediate causes that Rb occurs.It is big that RB1 gene is located at human chromosomal 13q14.2, DNA
Small is 180 kb, and encoded albumen is made of 928 amino acid, is important cell cycle regulating protein, RB1 allele
After mutation, cell will lose normal RB protein function, and cell differentiation is out of hand, to form tumour.
This, which is mainly limited, is not known for Rb cell origin in the specific occurrence and development mechanism and retina of Rb etc. at present
In lacking suitable disease model.It is primarily present three kinds of Rb models at present: (1) being heteroplastic transplantation model first, by humanized Rb
Allogeneic tumor is transplanted in animal eyes or is subcutaneously formed to cell, but needs to consider the tumour when human archeocyte is injected into animal
The change that microenvironment occurs may cause and genetically generate heterogeneous and disorder with normal tumour cell, while heterograft
The test by main body immune system is needed, in addition, the research for originating from for tumour and occurring, xenograft model is simultaneously uncomfortable
With；(2) genetic engineering animal model, it can preferably simulate the pathophysiological features of human diseases, in other human diseases
It is widely applied in pathogenesis and preclinical study, but the mankind have different science of heredity, morphology and life from other animals
Difference of science, especially in known animal, only the mankind can spontaneous generation Rb, have mouse and the children of RB1 gene delection
Rb can not occur for difference, obtain mouse Rb model and need together to knock out mouse RB1 and P53 or P107 gene, in addition,
The source mouse Rb is different from mankind Rb, is probably derived from without long prominent or horizontal cell；(3) Rb tumor cell line or tumor stem cell
It can be used for Rb pathogenesis, the research such as drug screening, but they lack 3D tumor environment, even if tumour chou can be formed
Structure also lacks the interaction between organ sample histology and tumour and normal tissue.
Recently the study found that using human pluripotent stem cell (hPSCs), including human embryo stem cell (hESCs) and people lure
Lead multipotential stem cell (hiPSCs) in vitro and can cultivate it is all similar to the structure of human eye retina and ingredient, structural integrity,
The retinal tissue model that function is mature, can be photosensitive, and the retina in differentiation source can be induced multi-potent stem cell in patient
Carry out the research such as disease pathogenesis and drug screening on model.The present invention is exactly to utilize the external 3D retina of human pluripotent stem cells
Differentiated system is induced, by RB1 gene mutation or human pluripotent stem cells is knocked out and breaks up for people's Rb tissue model, can be used for subsequent people Rb
Generation, development mechanism and Therapy study, for patient Rb early diagnosis and precision treatment scientific basis is provided.
The external 3D retina induction differentiated system of Selection utilization human pluripotent stem cells is come the reason of establishing Rb model: (1) Rb
Pathogenesis is more clear, and the mutation of retinoblastoma gene RB1 allele or missing are the immediate cause that Rb occurs, benefit
The human pluripotent stem cells of RB1 allelic mutation or missing are easier obtained with gene editing technology；(2) disease time of Rb
It is relatively early, it is infantile period (about 67% case occurred before 3 years old, and 95% occurred before 5 years old), especially bilateral Rb morbidity
(morbidity average age 9-12 months) earlier, human pluripotent stem cells vitro differentiation retina can reappear the view of this period of time
Film developmental state, and fall ill and more more early easier obtaining disease model in early days；(3) Rb is be primary in retina intraocular pernicious
Tumour utilizes people although whether originating from other retina cells of cone precursor and not bery clear for Rb at present
Multipotential stem cell can vitro differentiation go out whole retina tissue, wherein comprising may occur canceration cone precursor and other
Retina cell；(4) in known animal, only the mankind can spontaneous generation Rb, people's Rb pathogenesis is special, and it is suitable to lack
Animal model, using the identical human pluripotent stem cell of genetic background in vitro differentiation of human retinal tissue during spontaneous shape
At Rb, it is particularly suited for subsequent pathogenesis and Therapy study.
Summary of the invention
For the change that tumor microenvironment in heteroplastic transplantation model occurs, in genetic engineering animal model, the mankind and other
Animal has different science of heredity, morphology and physiological difference, or is directly made using Rb tumor cell line or tumor stem cell
For research model, but the problem of they lack 3D tumor environment；The present invention provides a kind of human retinoblastoma model, this
The purpose of invention is RB1 gene mutation or knocks out human pluripotent stem cells and break up for people's Rb model, solves swelling for existing model
The problems such as tumor microenvironment is different, genetic background difference occur for further people Rb, development mechanism and Therapy study provide more
Reliable tumor model.
The present invention is achieved through the following technical solutions:
Invention introduces RB1 gene mutation identical with patient's Rb genetic background or knock out human pluripotent stem cells system and people's multipotency
Stem cell in vitro 3D retina induces differentiated system.
1. RB1 gene mutation identical with patient's Rb genetic background or knockout human embryonic stem cell preparation step are as follows:
1) select the common RB1 gene mutation site of patient Rb, i.e. in the 320th amino acids of 10 exon, CGA is mutated into
TGA can be such that RB1 gene translation terminates in advance；Selection RB1 gene knockout site is located on 1 exon, can silencing RB1 gene
Expression.
2) Cas9/sgRNA is designed: the design principle based on sgRNA, designs sgRNA in target site region, corresponding
Oligo sequence is CTCTGAGGTTGGAATCACTT.
3) targeting vector constructs: pCS-3G and LScKO-4G-LR-RR targeting vector is used, identifies and is sequenced by digestion,
Confirm that targeting vector building is completed.
4) positive colony screening and sequence verification: by the pCS-3G-sgRNA1-C for carrying sgRNA and homologous recombination mould is carried
The LScKO-4G-LR-RR-hES-ZQ-001-C targeting vector electricity of plate turns H9 cell line, rich by drug screening, positive colony
Collection, PCR screening finally obtain 4 homozygous positive colonies, are 5,15,20, No. 37 clones respectively.By mutant allele
PCR product is sequenced, and sequencing upstream primer is TGGGATGTTTGGAAAATCTTGGCAGT, and downstream primer is
GAAACGTGAACAAATCTGAAACACT, sequencing result are compared with wild-type genomic sequence, for confirming mutant gene sequence
Specific location and mutating alkali yl number in genome.
5) it equally, prepared by RB1 gene knockout human embryonic stem cell, designs sgRNA in target site region first, just
To sequence are as follows: CACCGCGGTGCCGGGGGTTCCGCGG, reverse sequence are as follows: AAACCCGCGGAACCCCCGGCACCGC.Make
With px330 targeting vector, by vector construction, electricity turns H9 cell, and positive colony screening obtains a RB1 homozygosis after PCR verifying
Positive colony A1 is knocked out, PCR upstream primer is TTTTCTCAGGGGACGTTGAAA, and downstream primer is
TCTGATGGACGCTCGCAA。
6) RB1 gene mutation or the culture of knockout human embryonic stem cell: the dedicated culture of the stem cell of Gibco company is utilized
8 Medium of base Essential is cultivated, and 0.5 M EDTA (PH=8.0) dilutes 1000 times and passes on for cell dissociation,
Nuwacell-hPSC frozen stock solution is used for cell cryopreservation.
7) RB1 gene mutation or the stemness verifying of knockout human embryonic stem cell: flow cytometry RB1 gene is utilized
Mutation or the expression for knocking out human embryo stem cell stemness marker gene OCT4.
8) RB1 gene mutation or the karyotyping of knockout human embryonic stem cell.
It is that preparation step is as follows that the RB1 allelic mutation people in patient 2.Rb source, which induces multi-potent stem cell:
1) patient's peripheric venous blood is collected, there are RB1 allele to dash forward using the sequencing of full exon and direct Sequencing verifying screening
The patient of change.
2) in-vitro separation purifying carries the mononuclearcell in RB1 allelic mutation patient's Rb peripheric venous blood, goes forward side by side
Row amplification cultivation.
3) mononuclearcell for turning patient Rb using circles mixing plasmid electricity establishes RB1 equipotential base by reprogramming
It is because mutant human induces multi-potent stem cell.Since patient carries RB1 allelic mutation, separate single in patient's peripheric venous blood
Nucleus, then reprogrammed behaviour and induced multi-potent stem cell, the people of foundation induces multi-potent stem cell having the same with patient
Genetic background, it is same to carry RB1 allelic mutation.
4) RB1 allelic mutation people induces multi-potent stem cell the culture for being: the stem cell using Gibco company is dedicated
8 Medium of culture medium Essential is cultivated, and 0.5 M EDTA (PH=8.0) dilutes 1000 times and passes for cell dissociation
Generation, Nuwacell-hPSC frozen stock solution are used for cell cryopreservation.
5) RB1 allelic mutation people induces multi-potent stem cell the stemness verifying for being: utilizing flow cytometry RB1
Gene mutation induces multi-potent stem cell the expression of stemness marker gene OCT4.
6) RB1 allelic mutation people induces multi-potent stem cell the karyotyping for being.
3.RB1 gene mutation knocks out the external 3D retina induction differentiation of human pluripotent stem cells, external three-dimensional retina point
Steps are as follows for change system 1:
1) the 0th day: by RB1 gene mutation or knocking out human pluripotent stem cells cell with containing DNase I and Y-27632
TrypLE Select is by cell dissociation at individual cells；It is counted with blood counting instrument, using being added to the I of 20 μM of Y-27632
Type culture medium is planted in 96 orifice plate of V-type bottom with 9000 cells/well.
2) the 2nd day after cell seeding, every hole adds 1% Matrigel, mixes.
3) the 6th day after cell seeding, I type culture medium of half is replaced in every hole.
4) the 12nd day after cell seeding, every hole cell is transferred to 9 cm without cultivating in adherency culture dish, addition contains 1%
The II type culture medium of Matrigel.
5) the 18th day, III type culture medium is replaced.
6) III type culture medium long-term cultivation, the every seven days fresh III type culture mediums of replacement are continued with after.
4.RB1 gene mutation knocks out the external 3D retina induction differentiation of human pluripotent stem cells, external three-dimensional retina point
Steps are as follows for change system 2:
7) the 0th day: by RB1 gene mutation or knocking out human pluripotent stem cells cell with containing 0.05 mg/ml DNase I and 10 μM
The TrypLE Select digestive juice of Y-27632 is digested to unicellular.After blood counting instrument counts cell suspension,
Cell density is adjusted to 120000 cells/ml with the IV type culture medium for being added to 20 μM of Y-27632, is planted in V-type bottom 96
In orifice plate (hole 100ul/).
8) the 6th day after cell seeding, every hole replacement half is added to the IV type culture medium of 55ng/ml hBMP4.
9) the 9th day after cell seeding, the 12nd day, the 15th day, IV type culture medium of every hole replacement half.
10) the 18th day after cell seeding, every hole cell is transferred to 9 cm without cultivating in adherency culture dish, is changed to III type
Culture medium.
11) III type culture medium long-term cultivation, the every seven days fresh III type culture mediums of replacement are continued with after.
The beneficial effects of the present invention are: present invention utilizes RB1 gene mutation identical with patient's genetic background or knockouts
Stem cell, spontaneously form human retinoblastoma in retinal tissue growth course in vitro, can truer simulation
Patient's tumour growth environment and tumor development process provide and more may be used for further research Tumorigenesis and treatment
The model leaned on.
Detailed description of the invention
Attached drawing 1 is RB1 gene mutation targeting vector strategy schematic diagram.
Attached drawing 2 is RB1 gene mutation targeting vector digestion qualification figure.
Attached drawing 3 is RB1 positive gene mutation colony screening PCR primer design principle figure.
Attached drawing 4 is RB1 positive gene mutation colony screening PCR Partial Characterization result.
Attached drawing 5 is PCR product sequencer map in RB1 positive gene mutation colony screening.
Attached drawing 6 is the tactful schematic diagram of RB1 gene knockout target practice.
Attached drawing 7 is the sequencing result figure of the determining carrying RB1 mutated patient of screening.
Attached drawing 8 is to carry RB1 mutated patient mononuclearcell to be separately cultured and reprogram flow chart.
Attached drawing 9 is to carry the mononuclearcell in RB1 mutated patient source and its inducing multi-potent stem cell for reprogramming formation
Form.
Attached drawing 10 is RB1 gene mutation or knockout human pluripotent stem cells system morphologic observation.
Attached drawing 11 is RB1 gene mutation or knockout human pluripotent stem cells system OCT4 versatility antibody mediated immunity flow analysis chart.
Attached drawing 12 is RB1 gene mutation or knockout human pluripotent stem cells system chromosome karyotype analysis figure.
Attached drawing 13 is that RB1 gene mutation or knockout human pluripotent stem cells system and normal human pluripotent stem cells system 3D retina are female
Cytoma breaks up schematic diagram.
Attached drawing 14 is RB1 gene mutation or knockout human pluripotent stem cells system and normal human pluripotent stem cells system source 3D view
The form and minitype CT scanning figure of film blastoma.
Attached drawing 15 is RB1 gene mutation or knockout human pluripotent stem cells system and normal human pluripotent stem cells system source 3D view
The immunofluorescence dyeing figure of the significant genes protein level of Rb in film blastoma.
Attached drawing 16 is RB1 gene mutation or knockout human pluripotent stem cells system and normal human pluripotent stem cells system source 3D view
Film blastoma transcriptome analysis figure.
Attached drawing 17 is RB1 gene mutation or knockout human pluripotent stem cells system and normal human pluripotent stem cells system source 3D view
Film blastoma subretinal space migration process and transplanting result.
Specific embodiment
1. experimental material
1.1 cell material
Human embryonic stem cell (H9) comes from WiCell Research Institute (Madison, WI).
1.2 are tested plasmid vector used
1) plasmid vector: plasmid pCS-3G and LScKO-4G-LR-RR used in RB1 gene mutation come from hundred Olympic Competition figure of Beijing.
2) plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9-2A-Puro used in RB1 gene knockout purchase to
addgene。
3) plasmid Episomal iPSC Reprogramming Plasmids used in reprogramming of somatic cells is purchased from System
Biosciences。
1.3 enzymes, reagent consumptive material and kit
1) RB1 gene mutation vector construction the primer comes from hundred Olympic Competition figure of Beijing, and oligo sequence sgRNA derives from Beijing hundred
Olympic Competition figure.
2) RB1 gene knockout carrier constructs oligo sequence sgRNAs design used and utilizes website CRISPR Design
Tool (http://crispr.mit.edu/)。
3) cell culture: TeSR-E8 medium (Stem cell Technologies)；Stemspan(Stem
Cell Technologies)；ReproTeSR (Stem cell Technologies)；Fetal calf serum (GIBCO)；
Matrigel (Becton Dickinson)；0.5 μM EDTA solution (GIBCO)；10 μM Y-27632
(Selleck)；TrypLE Select(Gibco)；Six porocyte culture plates (Nunc).
4) it is agents useful for same material that RB1 gene mutation or knockout human embryo stem cell, which are built: electricity turns kit (Lonza)；Electricity
Turn instrument Nucleofector 4D (Lonza)；Puromycin antibiotic (sigma).
5) RB1 gene mutation people induces multi-potent stem cell that build be agents useful for same material: Lymphoprep lymphocyte point
Chaotropic (Stem cell Technologies).
6) retina organoid breaks up agents useful for same material: GMEM(Gibco), KSR serum substitute (Gibco), NEAA
Nonessential amino acid (Gibco), acetonate (Gibco), beta -mercaptoethanol (Gibco), penicillin (Gibco), streptomysin
(Gibco), IWR1e (Sigma), hBMP4 (Sigma), fetal calf serum (Gibco), SAG (Sigma), DMEM/F12
(Gibco), N2 additive (Gibco), retinoic acid, IMDM(Gibco), Hams F12(Gibco), GlutaMax(Gibco) and, sulphur
For glycerol (Sigma), V-Lance Knife(ALCON SURGICAL).
2. experimental method
2.1 RB1 gene mutation human embryonic stem cell preparations identical with patient's Rb genetic background
1) practice shooting tactful: RB1 gene (this project is named with hES-ZQ-001-C) is on No. 13 chromosomes, and overall length is about
178.1kb.NCBI ID:5925.Terminator is sported by Arg in the 320th amino acid of hES-ZQ-001-C gene,
Corresponding base sequence becomes TGA from CGA, and tactful schematic diagram of practicing shooting is as shown in Figure 1.
2) target sequence sequencing confirmation: different cell lines, target-gene sequence may differences.It is designed in order to guarantee
The efficiency of Cas9/sgRNA, it is necessary first to PCR amplification and sequence verification be carried out to H9 cell line target site sequence, to protect
It demonstrate,proves sgRNA identification sequence and H9 cell line dna sequence is completely the same.PCR primer is as follows:
3)
4) Cas9/sgRNA is designed: the design principle based on sgRNA designs 6 sgRNA in target site region altogether,
Corresponding oligo sequence is as follows:
5)
| 5’guide | Sequence(5 ' -3 ') |
| Guide#1-C | CTCTGAGGTTGGAATCACTT PAM |
| Guide#2 | ATAGCCAATCAATAGATGAC PAM |
| Guide#3 | GCGTTAAAAGTCACAGTAGA PAM |
| Guide#4 | TTCATTAAGGTTGGGATACA PAM |
| 3’Guide#5 | ACTTGGTTATCAATACCACC PAM |
| 3’Guide#6 | TTCATATACTATTGCCTGCC PAM |
6) targeting vector constructs: carrier construction pCS-3G-sgRNA1-C and LScKO-4G-LR-RR-hES-ZQ-001-C pass through
Digestion identification and sequencing, confirmation targeting vector building are completed.
7) positive colony screens: pCS-3G-sgRNA1-C and LScKO-4G-LR-RR-hES-ZQ-001-C being practiced shooting and is carried
Body electricity turns H9 cell line, screens by drug screening, positive colony enrichment, PCR, finally obtains 4 homozygous positive gram
It is grand.PCR identification method is as follows: identification design of primers: primer hES-ZQ-001-L-GT-F and hES-ZQ-001-WT-R,
HES-ZQ-001-WT-F and hES-ZQ-001-C-R-GT-R design is in wildtype gene sequence.So using hES-ZQ-
001-C-L-GT-F/hES-ZQ-001-WT-R and hES-ZQ-001-WT-F/hES-ZQ-001-C-RGT-R this to primer into
When row PCR, the product of wild-type allele can be amplified, can also expand the product of mutant allele.hES-ZQ-
001-C-R-GT-F1/ hES-ZQ-001-C-R-GT-R this wild type and point mutation allele can be amplified simultaneously to primer
PCR product, PCR product is sequenced, specific genotype may determine that according to sequencing result and sequencing peak figure: homozygous/miscellaneous
Conjunction/wild type.Design of primers principle is as shown in Figure 3.
Primer information is as follows:
PCR condition
The sequencing of PCR product: the PCR product of mutant allele is sequenced, sequencing result and wild type gene group sequence
Column compare, for confirming specific location and mutating alkali yl number of the mutant gene sequence in genome.
2.2 RB1 gene knockout human embryonic stem cell preparations identical with patient's Rb genetic background
1) practice shooting strategy: RB1 gene knockout site is located on 1 exon, can silencing RB1 gene expression, practice shooting strategy as figure
Shown in 6.
2) Cas9/sgRNA is designed: the design principle based on sgRNA designs 2 pairs in target site region altogether
SgRNA, corresponding oligo sequence are as follows:
3)
| Guide | Sequence(5 ' -3 ') |
| Guide#1F | CACCGCGGTGCCGGGGGTTCCGCGG |
| Guide#1R | AAACCCGCGGAACCCCCGGCACCGC |
| Guide#2F | CACCGCGGTGGCGGCCGTTTTTCGG |
| Guide#2R | AAACCCGAAAAACGGCCGCCACCGC |
4) targeting vector constructs: sgRNA1 is building up to carrier pX330-U6-Chimeric_BB-CBh-hSpCas9-2A-
Puro is identified and is sequenced by digestion, and confirmation targeting vector building is completed.
5) electricity turns cell: the Supplement 1 of the P3 primary cell solution of 82 μ l and 18 μ l is mixed
It closes, the targeting vector of 2.5ug sgRNA plasmid and 2.5 ug is added, be added in electric revolving cup after mixing.It uses
Nucleofector 4D (Lonza) carries out electricity to the cell in electric revolving cup at program CA-137 and turns.After electricity turns, cell is turned
It moves in the TeSR-E8 culture medium containing 10 μM of Y-27632, is covered in culture medium on the plate of Matrigel, at 37 DEG C, 5%
CO2It is cultivated in incubator.
6) positive colony screens: it is 0.22 μ g/mL puromycin that concentration is added in the medium, is screened.
7) PCR is verified: basic PCR operating procedure, and PCR upstream primer is TTTTCTCAGGGGACGTTGAAA, downstream
Primer is TCTGATGGACGCTCGCAA.
8) culture of positive colony: once generating single stabilization cell clone, they being separated, pre- in Matrigel
It is cultivated in the culture dish of the culture medium of E8 containing human stem cell of processing.
It is preparation that the RB1 allelic mutation people in 2.3 patient Rb sources, which induces multi-potent stem cell,
1) 2 ml of patient's Rb peripheric venous blood is collected, combines direct sequencing screening to carry RB1 using the sequencing of full exon and is mutated
Patient.
2) it separates, purify, the peripheric venous blood mononuclear cell of amplification carrying RB1 mutated patient: as shown in figure 8, taking Rb sick
10 ml of human peripheric venous blood；Mononuclearcell is isolated and purified using Lymphoprep lymphocyte separation medium；With Stemspan blood
Facilitate within cell culture medium culture one week ripe, every other day changes fresh culture.
3) electricity turn Episomal Reprogramming nonconformity reprogramming plasmid (containing Oct4, Sox2, Lin28,
Klf4, L-Myc, p53shRNA and miR-302/367 cluster), induction peripheral vein blood mononuclear cell reprogramming is
Induce multi-potent stem cell: as shown in figure 8, collecting mature mononuclearcell, power-up turns liquid (the P3 primary cell of 82 μ l
The Supplement 1 of solution and 18 μ l) and Episomal iPSC Reprogramming Plasmids, it uses
Nucleofector 4D (Lonza) carries out electricity at program CA-137 and turns.
4) electricity turn after cell be transferred in six orifice plates of the pretreated culture medium containing haemocyte of Matrigel, set 37 DEG C it is low
Oxygen incubator culture；Electricity turns to change ReproTeSR culture medium on the 7th day, continues i.e. visible to induce multi-potent stem cell gram for culture about 7 days
It is grand.
5) long to suitable size wait clone, clone is scraped with pipette tips, is drawn to the new culture dish for being coated with Matrigel
In, with TeSR-E8 culture medium culture.
2.4 RB1 gene mutations knock out human pluripotent stem cells system (including human embryo stem cell and people's induced multi-potent are dry thin
Born of the same parents) verifying
2.4.1 RB1 gene mutation or the versatility verifying of knockout human pluripotent stem cells system
1) cellular morphology observation is carried out using common inverted microscope.
2) OCT4 versatility antibody mediated immunity flow cytometer showed: PBS washs cell for several times, uses 0.25% trypsase-EDTA
(Gibco) cell is carefully dissociated into single cell suspension, 1000rpm, room temperature is centrifuged 5 min, abandons supernatant.Then by cell
It is resuspended in culture medium, the PBS of 0.5%BSA and 2mM EDTA is contained with PEB() antibody dyeing in buffer.Under 4 °C
It is incubated for 30 minutes.Use following antibody: Alexa Fluor488 mouse anti-Oct3/4(1:100, BD Biosciences, Cat#
560253).By cell by 100 μm of nylon net filters, then pass through FACSCanto II(Becton Dickinson) analysis
Fluorescence.
2.4.2 RB1 gene mutation or the karyotyping of knockout human pluripotent stem cells system
Cell is immersed in 0.1 μ g/ ml colchicine to handle 2 hours at 37 DEG C, trypsin digestion is then used, suspends again
And be incubated for 15 hours at 37 DEG C in 0.075M potassium chloride, with 3:1 methanol: acetic acid is fixed, and is then dripped on glass slide to sprawl
Chromosome shows chromosome finally by Giemsa staining.
2.5 RB1 gene mutations or knockout human pluripotent stem cells system and the external 3D retina of normal human pluripotent stem cells system lure
Lead differentiation
External three-dimensional retina differentiated system 1 is as follows:
1) the 0th day: by RB1 gene mutation or knocking out human pluripotent stem cells cell with containing 0.05 mg/ml DNaseI and 10 μM
The TrypLE Select digestive juice of Y-27632 is digested to unicellular.After blood counting instrument counts cell suspension,
Cell density is adjusted to 90000 cells/ml with the I type culture medium for being added to 20 μM of Y-27632, is planted in 96 hole of V-type bottom
In plate (hole 100ul/).
2) the 2nd day after cell seeding, every hole adds 1% Matrigel, mixes.
3) the 6th day after cell seeding, I type culture medium of half is replaced in every hole.
4) the 12nd day after cell seeding, every hole cell is transferred to 9 cm without cultivating in adherency culture dish, addition contains 1%
The II type culture medium of Matrigel.
5) the 18th day after cell seeding, aggregation is separated into 4-8 block with V-Lance Knife, is changed to III type culture
Base.
6) III type culture medium long-term cultivation, the every seven days fresh III type culture mediums of replacement are continued with after.Culture used is
I type culture medium: GMEM contains 20% serum substitute, 0.1 mM nonessential amino acid, 1 mM acetonate, 0.1 mM β-sulfydryl
Ethyl alcohol, 100 U/ml penicillin, 100 mg/ml streptomysins, 3 μM of IWR1e；II type culture medium: GMEM contains 10% tire ox blood
Clearly, 0.1 mM nonessential amino acid, 1 mM acetonate, 0.1 Mm beta -mercaptoethanol, 100 U/ml penicillin, 100 mg/
Ml streptomysin, 100 nM SAG；III type culture medium: DMEM/F12 contains 10% fetal calf serum, 1%N2 additive, 0.5 μM of view Huang
Acid, 100 U/ml penicillin, 100 mg/ml streptomysins.
External three-dimensional retina differentiated system 2 is as follows:
1) the 0th day: by RB1 gene mutation or knocking out human pluripotent stem cells cell with containing 0.05 mg/ml DNaseI and 10 μM
The TrypLE Select digestive juice of Y-27632 is digested to unicellular.After blood counting instrument counts cell suspension,
Cell density is adjusted to 120000 cells/ml with the IV type culture medium for being added to 20 μM of Y-27632, is planted in V-type bottom 96
In orifice plate (hole 100ul/).
2) the 6th day after cell seeding, every hole replacement half is added to the IV type culture medium of 55ng/ml hBMP4.
3) the 9th day after cell seeding, the 12nd day, the 15th day, IV type culture medium of every hole replacement half.
4) the 18th day after cell seeding, every hole cell is transferred to 9 cm without cultivating in adherency culture dish, is changed to III type
Culture medium.
5) III type culture medium long-term cultivation, the every seven days fresh III type culture mediums of replacement are continued with after.Culture used is
IV type culture medium: 45% IMDM, 45% HamsF12,10% serum substitute, 1% GlutaMax Supplement, 450 μM
Thioglycerol, 100 U/ml penicillin, 100 mg/ml streptomysins.
The identification of 2.6 3D retinoblastomas
1) paired observation RB1 gene mutation or knockout human pluripotent stem cells system and normal human pluripotent stem cells system come under microscope
The 3D retinal development situation in source.
2) the RB1 gene mutation of different times or knockout human pluripotent stem cells system and normal human pluripotent stem cells system are come
The 3D retina in source carries out immunofluorescence dyeing.
3) the RB1 gene mutation in collection different differentiation periods or knockout human pluripotent stem cells system and normal person's multipotency are dry thin
The RNA sample of the 3D retina in born of the same parents system source and the RNA sample in Y-79 cell line source carry out transcriptome analysis comparison.
4) by the RB1 gene mutation in different differentiation periods or knockout human pluripotent stem cells system and normal human pluripotent stem cells
The retina cell for being source and Y-79 cell infusion pass through OCT to the vitreous chamber or subretinal space of immunodeficient mouse
Its tumor formation situation is compared in the methods of imaging, immunofluorescence dyeing, transcriptome analysis.All programs permit to assist according to moral animal
View carries out, and ratifies through local authority.Graft washed with PBS after 37 DEG C with addition 0.05mg/ml DNaseI 0.25%
Trypsase-EDTA digests 6-8 min.2 μ l cell suspending liquids (50,000-80,000 cell/μ l) are injected into retina
Cavity of resorption or vitreous chamber, specific injecting method are as follows: 6 week old immune deficiencies are anaesthetized in intraperitoneal injection yellow Jackets (40mg/kg)
NOD-Prkdc scid IL2rg em2/ SMOC(NSG) mouse, with 1% Tropicamide eye drops mydriasis.2.5% phyenlephrinium is added
Then drop local anesthetic proxymetacaine hydrochloride (0.5%) is added dropwise in HCI solution.With No. 33 syringe needles under surgical operation microscope
Hamilton syringe is injected.2 months execution mouse after heterograft take eyeball to carry out H & E dyeing and immunofluorescence dye
Color.On the day of OCT image, pass through intraperitoneal injection yellow Jackets anesthetized mice.Immediately with 1% Tropicamide eye drops mydriasis,
Then topical application ofloxacin eye ointment uses Micron IVRetinal Imaging to prevent bitot's patches
Microscope completes eye-ground photography and Optical coherence tomography.
3. result and analysis
The preparation of 3.1 RB1 gene mutation human embryonic stem cells
Target sequence sequencing confirmation: H9 human embryonic stem cell and the given sequence of Genebank and Ensembl are inconsistent, with reality
Subject to the sequencing result of border.
SgRNA design: the Activity determination of sgRNA comprehensively considers the factors such as activity, specificity selection Guide#1-c and carries out
It tests in next step.
Targeting vector building: carrier electrophoresis result such as Fig. 2 after digestion uses carrier restriction enzyme site, EcoRV, BamH+
Hind,Not+ Sall carries out digestion respectively, and as shown in Figure 2, sequence size meets expected size, also note that: enzyme
Cutting rear sequence to will appear " sequence becomes larger " is result caused by the morphologic change of plasmid after digestion.
Positive colony screening: PCR Partial Characterization result is illustrated in fig. 4 shown below, and 5,15,20 and No. 37 are positive colony.Pass through
The sequencing of PCR product, representative result is as shown in figure 5,5,15,20 and 37 drive in positive colony for homozygous point mutation.
The preparation of 3.2 RB1 gene knockout human embryonic stem cells
SgRNA design: the Activity determination of sgRNA comprehensively considers the factors such as activity, specificity and selects Guide#1F and Guide#1R
Carry out next step experiment.
RB1 homozygous knockout positive colony an A1, A2 are obtained after PCR verifying.
It is preparation that 3.3 patient Rb source RB1 gene mutation people, which induce multi-potent stem cell,
Patient's Rb screening: screening obtains patient Rb of 2 RB1 allelic mutations, and sequencing result is as shown in fig. 7, sequencing result
Show that the 1st patient carries RB1 mutation c.1216-1G > T, the 2nd patient carry RB1 mutation splicing:c.2520+2T >
G, two mutation are common mutations site in patient Rb.
Carry patient's Rb peripheral vein blood mononuclear cell of RB1 allelic mutation is separately cultured and reprograms process
It is as shown in Figure 8: to extract the peripheric venous blood 10ml of patient Rb, mononuclearcell is obtained after density gradient centrifugation；Turn weight through electricity
Result after programming as shown in figure 9, the 15th day it is i.e. visible induce multi-potent stem cell clone, continue to cultivate to after 30 days, allusion quotation can be obtained
The cellular morphology of type pluripotent cell clone's shape.
Establish 2 RB1 allelic mutation patients Rb induces multi-potent stem cell each three plants, representative result such as Fig. 9
Or shown in 10, obtained carrying RB1 allelic mutation to induce multi-potent stem cell form normal, in typical undifferentiated clone's shape
Form.
3.4 RB1 gene mutations knock out human pluripotent stem cells system (including human embryo stem cell and induce multi-potent stem cell)
Culture and identification
3.4.1 RB1 gene mutation or the versatility verifying of knockout human pluripotent stem cells system.
It is as shown in Figure 10 that cellular morphology observes representative result: mutation and knockout cell line photo, cellular morphology is normal, is in
Typical undifferentiated clone's shape form.
Mutation and the identification for knocking out cell line versatility: OCT4 versatility antibody mediated immunity flow cytometer showed representative result is as schemed
Shown in 11, showing nearly all cell all is in the OCT4 positive, illustrates that it still maintains versatility.
3.4.2 RB1 gene mutation or the karyotyping of knockout human pluripotent stem cells system
Mutation and knockout cell line chromosome karyotype analysis, representative result is as shown in figure 12, and analysis is normal, women, 46 XX dye
Colour solid.
3.5 RB1 gene mutations knock out human pluripotent stem cells system (including human embryo stem cell and induce multi-potent stem cell)
And the normal external 3D retina induction differentiation of human pluripotent stem cells system
Figure 13 is that 3D retinoblastoma breaks up aspect graph after schematic diagram, and differentiation, and bottom right outlines part as the knurl grown.
The identification of 3.6 3D retinoblastomas.
As shown in figure 14, minitype CT scanning result, which is shown, rolls into a ball spline structure with Rb tumour rose, and quality is uneven, edge mould
Paste；As shown in figure 15, the immunofluorescence analysis of some marker genes of Rb specificity is the results show that Ki67/SYK, Ki67/
CDKN2A, Ki67/NSE have high expression.
Transcriptome analysis shows some marker genes of high expression Rb specificity as shown in figure 16, the base of low expression in Rb
Cause, also low expression in our differentiation tumors (these genes are all to have reported the high expression for proving to generally acknowledge and low expression gene).
The 3.7 Rb subretinal space transplanting differentiated
The Rb subretinal space migration process and transplanting result differentiated is as shown in figure 17, and the Rb cell differentiated is transplanted to NSG
Visual tumors proliferation (ability of the specific infinite multiplication of the characteristic of tumour) after immunodeficient mouse subretinal space, 60 days visible
Tumour.
<110>Wenzhou Medical University
Wenzhou Medical University
<120>a kind of preparation side of human retinoblastoma model of a kind of preparation method of human retinoblastoma model
Method
<130> 11
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> pCS-3G-sgRNA1-C
<400> 1
CTCTGAGGTTGGAATCACTT 20
<210> 1
<211> 50
<212> DNA
<213> pX330-U6-Chimeric_BB-CBh-hSpCas9-2A-Puro
<400> 1
CACCGCGGTGCCGGGGGTTCCGCGG 25
AAACCCGCGGAACCCCCGGCACCGC 50
Claims (16)
1. a kind of preparation method of human retinoblastoma model, which comprises the following steps:
(1) gene editing is carried out to human retinoblastoma RB1 allele in human embryo stem cell；
(2) positive colony screening is carried out to the human embryo stem cell after gene editing；
(3) human retinoblastoma model is divided into using external three-dimensional retina differentiated system induction positive colony.
2. a kind of preparation method of human retinoblastoma model according to claim 1, which is characterized in that described
Human embryo stem cell is human embryo stem cell H9.
3. a kind of preparation method of human retinoblastoma model according to claim 1, which is characterized in that described
Gene editing includes gene mutation and gene knockout.
4. a kind of preparation method of human retinoblastoma model according to claim 3, which is characterized in that described
The mutational site that gene mutation introduces is that CGA is mutated into TGA in the 320th amino acids of 10 exon of RB1 gene.
5. a kind of preparation method of human retinoblastoma model according to claim 3, which is characterized in that described
The region of gene knockout is on 1 exon of RB1 gene.
6. a kind of preparation method of human retinoblastoma model according to claim 3, which is characterized in that described
Gene mutation is realized by CRISPR/Cas9 technology.
7. a kind of preparation method of human retinoblastoma model according to claim 3, which is characterized in that described
Gene knockout is realized by CRISPR/Cas9 technology.
8. a kind of preparation method of human retinoblastoma model according to claim 6, which is characterized in that described
Carrier used in CRISPR/Cas9 technology be pCS-3G-sgRNA1-C and LScKO-4G-LR-RR, used in pCS-3G-
SgRNA1-C plasmid carries effective sgRNA, corresponding to oligo sequence be CTCTGAGGTTGGAATCACTT, it is used
It include mutant gene locus on LScKO-4G-LR-RR plasmid homology arm.
9. a kind of preparation method of human retinoblastoma model according to claim 7, which is characterized in that described
Carrier used in CRISPR/Cas9 technology is pX330-U6-Chimeric_BB-CBh-hSpCas9-2A-Puro；Used
Oligo sequence of the sgRNA corresponding to it includes positive sequence are as follows: CACCGCGGTGCCGGGGGTTCCGCGG, reverse sequence are as follows:
AAACCCGCGGAACCCCCGGCACCGC。
10. a kind of preparation method of human retinoblastoma model, which comprises the following steps:
(1) people for establishing patient Rb source RB1 allelic mutation induces multi-potent stem cell；
(2) it is induced multi-potent stem cell using external three-dimensional retina differentiated system induction people and is divided into human retinoblastoma mould
Type.
11. a kind of preparation method of human retinoblastoma model according to claim 10, which is characterized in that described
The preparation that induces multi-potent stem cell of people be to be realized by reprogramming of somatic cells technology.
12. according to claim 1 or a kind of preparation method of human retinoblastoma model described in 10, which is characterized in that
The external three-dimensional retina differentiated system is external three-dimensional retina differentiated system 1 or external three-dimensional retina differentiated system
Any one in 2；The external three-dimensional retina differentiated system 1 includes: people's multipotency of (1) RB1 gene mutation or knockout
The unicellular digestion of stem cell；(2) cell seeding is in tissue culture plate after digesting；(3) I type culture medium induction differentiation 12 is utilized
It；Noble cells is transferred to culture dish after 12 days, and replacement II type culture medium induction differentiation was to the 18th day；The training of III type is replaced after 18 days
Supporting base maintains long-term cultivation to obtain human retinoblastoma model；The described external three-dimensional retina differentiated system 2 includes:
(1) the unicellular digestion of the human pluripotent stem cells of RB1 gene mutation or knockout；(2) cell seeding is in tissue culture plate after digesting；
(3) broken up using IV type culture medium to the 6th day；Half is carried out using the IV type culture medium that 55 ng/ml hBMP4 are added within 6th day to measure
Change liquid；9th day, the 12nd day, the 15th day carry out IV type culture medium, half amount and change liquid；III type culture medium is replaced after 18 days remains long-term
Culture obtains human retinoblastoma model.
13. a kind of preparation method of human retinoblastoma model according to claim 12, which is characterized in that described
External three-dimensional retina differentiated system 1 and the step of external three-dimensional retina differentiated system 2 in (1), used in unicellular digestion
Enzyme be Tryp LE Select, contain 0.05 mg/ml DNase I and 20 μM of Y-27632.
14. a kind of preparation method of human retinoblastoma model according to claim 12, which is characterized in that described
External three-dimensional retina differentiated system 1 and the step of external three-dimensional retina differentiated system 2 in (2), tissue culture plate is V-type
96 orifice plate of bottom, repopulating cell number are respectively 9000 cells/wells and 12000 cells/wells.
15. a kind of preparation method of human retinoblastoma model according to claim 12, which is characterized in that described
External three-dimensional retina differentiated system 1 and I type culture medium is GMEM in (3) the step of external three-dimensional retina differentiated system 2,
Containing 20% serum substitute, 0.1 mM nonessential amino acid, 1 mM acetonate, 0.1 mM beta -mercaptoethanol, 100 U/ml
Penicillin, 100 mg/ml streptomysins, 3 μM of IWR1e；II type culture medium is GMEM, contains 10% fetal calf serum, 0.1 mM is non-must
Need amino acid, 1 mM acetonate, 0.1 mM beta -mercaptoethanol, 100 U/ml penicillin, 100 mg/ml streptomysins, 100
nM SAG；III type culture medium is DMEM/F12, contains 10% fetal calf serum, 1% N2 additive, 0.5 μM of retinoic acid, 100 U/ml
Penicillin, 100 mg/ml streptomysins；IV type culture medium be 45% IMDM, 45% Hams F12,10% serum substitute, 1%
GlutaMax Supplement, 450 μM of thioglycerols, 100 U/ml penicillin, 100 mg/ml streptomysins.
16. a kind of preparation method of human retinoblastoma model according to claim 12, which is characterized in that described
External three-dimensional retina differentiated system 1 and II type culture medium induction point in (3) the step of external three-dimensional retina differentiated system 2
Change, the induction differentiation of III type culture medium is carried out in low adherency culture dish.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910236645.8A CN110241138A (en) | 2019-03-27 | 2019-03-27 | A kind of preparation method of human retinoblastoma model |
| PCT/CN2019/081841 WO2020191816A1 (en) | 2019-03-27 | 2019-04-09 | Method for preparing human retinoblastoma model |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910236645.8A CN110241138A (en) | 2019-03-27 | 2019-03-27 | A kind of preparation method of human retinoblastoma model |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110241138A true CN110241138A (en) | 2019-09-17 |
Family
ID=67883147
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910236645.8A Pending CN110241138A (en) | 2019-03-27 | 2019-03-27 | A kind of preparation method of human retinoblastoma model |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN110241138A (en) |
| WO (1) | WO2020191816A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111662907A (en) * | 2020-07-09 | 2020-09-15 | 成都华西海圻医药科技有限公司 | Method for knocking out NANS gene of induced pluripotent stem cell and application |
| CN113068660A (en) * | 2021-03-29 | 2021-07-06 | 华东师范大学 | Construction method of spontaneous rheumatoid arthritis mouse model |
| CN114085868A (en) * | 2020-08-24 | 2022-02-25 | 中国医学科学院肿瘤医院 | Targeting vector, recombinant Huh7 cell line, construction method and application |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103031370A (en) * | 2011-09-30 | 2013-04-10 | 广州益善生物技术有限公司 | RB1 gene mutation detection specific primer and liquid chip |
| CN104726492A (en) * | 2015-01-20 | 2015-06-24 | 深圳市三启生物技术有限公司 | Method for constructing LQT disease model and application of LQT disease model in drug screening |
| CN104726494A (en) * | 2015-02-12 | 2015-06-24 | 中国人民解放军第二军医大学 | Method for constructing chromosome translocation stem cell and animal model by CRISPR-Cas9 technology |
| CN106350521A (en) * | 2016-08-24 | 2017-01-25 | 中国科学院生物物理研究所 | Preparation method of ALS (Amyotrophic Lateral Sclerosis) patient specific motor neuron |
| CN109423480A (en) * | 2017-12-21 | 2019-03-05 | 中山大学中山眼科中心 | A kind of mechanizable abductive approach of simple and efficient that human pluripotent stem cells are divided into retinal tissue |
| WO2019048689A1 (en) * | 2017-09-11 | 2019-03-14 | Imba - Institut Für Molekulare Biotechnologie Gmbh | Tumor organoid model |
-
2019
- 2019-03-27 CN CN201910236645.8A patent/CN110241138A/en active Pending
- 2019-04-09 WO PCT/CN2019/081841 patent/WO2020191816A1/en active Application Filing
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103031370A (en) * | 2011-09-30 | 2013-04-10 | 广州益善生物技术有限公司 | RB1 gene mutation detection specific primer and liquid chip |
| CN104726492A (en) * | 2015-01-20 | 2015-06-24 | 深圳市三启生物技术有限公司 | Method for constructing LQT disease model and application of LQT disease model in drug screening |
| CN104726494A (en) * | 2015-02-12 | 2015-06-24 | 中国人民解放军第二军医大学 | Method for constructing chromosome translocation stem cell and animal model by CRISPR-Cas9 technology |
| CN106350521A (en) * | 2016-08-24 | 2017-01-25 | 中国科学院生物物理研究所 | Preparation method of ALS (Amyotrophic Lateral Sclerosis) patient specific motor neuron |
| WO2019048689A1 (en) * | 2017-09-11 | 2019-03-14 | Imba - Institut Für Molekulare Biotechnologie Gmbh | Tumor organoid model |
| CN109423480A (en) * | 2017-12-21 | 2019-03-05 | 中山大学中山眼科中心 | A kind of mechanizable abductive approach of simple and efficient that human pluripotent stem cells are divided into retinal tissue |
Non-Patent Citations (7)
| Title |
|---|
| AMBILY VINCENT等: "Generation of a Human Induced Pluripotent Stem Cell Line (VRFi001-A) From Orbital Adipose Tissue of a Bilateral Retinoblastoma Patient With Heterozygous RB1 Gene Deletion", 《STEM CELL RESEARCH》 * |
| JIAN TU等: "Generation of human embryonic stem cell line with heterozygous RB1 deletion by CRIPSR/Cas9 nickase", 《STEM CELL RESEARCH》 * |
| LAURA STEENPASS: "Generation of two H1 hESC sublines carrying a heterozygous and homozygous knock-out of RB1", 《STEM CELL RES.》 * |
| LEONIE SCHIPPER等: "Generation of heterozygous and homozygous hESC H9 sublines carrying inactivating mutations in RB1", 《STEM CELL RES.》 * |
| SICONG ZENG等: "Generation of induced pluripotent stem cells (iPSCs) from a retinoblastoma patient carrying a c.2663GNA mutation in RB1 gene", 《STEM CELL RESEARCH》 * |
| 怀思远等: "CRISPR/Cas9 基因编辑系统应用于非人灵长类细胞及胚胎Rb1基因编辑的研究", 《解放军医学院学报》 * |
| 郑蔓茵等: "视网膜母细胞瘤发病机制的研究进展", 《解剖学研究》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111662907A (en) * | 2020-07-09 | 2020-09-15 | 成都华西海圻医药科技有限公司 | Method for knocking out NANS gene of induced pluripotent stem cell and application |
| CN111662907B (en) * | 2020-07-09 | 2023-07-14 | 成都华西海圻医药科技有限公司 | Method for knocking out induced pluripotent stem cell NANS gene and application thereof |
| CN114085868A (en) * | 2020-08-24 | 2022-02-25 | 中国医学科学院肿瘤医院 | Targeting vector, recombinant Huh7 cell line, construction method and application |
| CN113068660A (en) * | 2021-03-29 | 2021-07-06 | 华东师范大学 | Construction method of spontaneous rheumatoid arthritis mouse model |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2020191816A1 (en) | 2020-10-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110241138A (en) | A kind of preparation method of human retinoblastoma model | |
| CN107988256A (en) | Human Huntington gene knock-in recombinant vector and its construction method and the application in swine model structure | |
| CN105177044B (en) | The method for obtaining lymthoma miniature pig disease model by knocking out P53 gene | |
| JPH05504066A (en) | Transgenic animals, cells and cell lines obtained therefrom, and uses thereof | |
| CN103930542A (en) | Brown fat cell compositions and methods | |
| CN1860222A (en) | Stem cells for clinical and commercial uses | |
| CN104046593A (en) | Human cell with low immunogenicity and preparation method thereof | |
| CN106222204B (en) | A kind of method of swamp eel gene editing | |
| EA028902B1 (en) | Method of generating induced pluripotent stem cells and differentiated cells | |
| CN108603169A (en) | Induction type pacemaker cells from adult stem cell and Purkinje cell | |
| CN107739739A (en) | The method for carrying out genetic modification and disease modeling using the mammal of the expression Cre Cas9 genes relied on | |
| CN102286535B (en) | Method for transdifferentiation of fibroblasts into hepatic stem cells | |
| Miller et al. | Teratocarcinoma× friend erythroleukemia cell hybrids resemble their pluripotent embryonal carcinoma parent | |
| CN110373428A (en) | A kind of transgene carrier system and its application promoting cell transplantation and gene expression | |
| CN108251378A (en) | A kind of interstital stem cell excretion body for being overexpressed PTGDS genes and its preparation method and application | |
| CN103920189A (en) | Method of constructing engineering fat | |
| CN105950622B (en) | The crRNA of specific recognition GS gene and its application | |
| CN102732476B (en) | Embryonic stem cell culture medium and application thereof | |
| CN109679998B (en) | Vector for site-specific mutagenesis of MSTN (myostatin) and simultaneous site-specific integration of PPAR (peroxisome proliferator activated receptor) gamma | |
| CN111635912A (en) | Gene combination for inducing liver cells into liver cancer cells and application thereof | |
| CN113166763B (en) | Nucleic acid molecule targeting CYP4V2 gene mutation site and application thereof | |
| CN115807038A (en) | Retina differentiation potential cell line CRX-Shen001 and construction method thereof | |
| CN108300737A (en) | A kind of method for building up and application thereof for the malignant lymphoma model that phenotype is highly consistent | |
| CN103952441A (en) | Constructing method of 1.3 copy C gene type HBV transgenic mice | |
| CN110283847A (en) | A kind of while site-directed integration FAD3 and FABP4 gene carrier and recombinant cell |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190917 |