CN107988256A

CN107988256A - Human Huntington gene knock-in recombinant vector and its construction method and the application in swine model structure

Info

Publication number: CN107988256A
Application number: CN201711251907.5A
Authority: CN
Inventors: 闫森; 李晓江; 赖良学; 李世华
Original assignee: Guangzhou Institute of Biomedicine and Health of CAS; Jinan University
Current assignee: Guangzhou Institute of Biomedicine and Health of CAS; Jinan University; University of Jinan
Priority date: 2017-12-01
Filing date: 2017-12-01
Publication date: 2018-05-04
Anticipated expiration: 2037-12-01
Also published as: CN107988256B

Abstract

A kind of application the invention discloses human Huntington gene knock-in recombinant vector and its construction method and in swine model structure.The Huntingdon exon genes of first passage fixed point gene knock-in people's mutation of the present invention, and Disease-causing gene is knocked in using CRISPR/Cas9 technologies fixed point first, by optimizing sgRNA, optimize donor vehicle, improve the probability of gene knock-in positive colony cell, the probability for improving the gene knock-in pig for directly obtaining the positive is combined with pig nucleus transplantation technology, obtains the miniature pig that human Huntington disease gene is knocked in, it was demonstrated that this method is used for the efficient feasibility for building genetic modification pig.The huntingtin gene that the present invention is built, which knocks in swine model, can produce the Behavioral feature similar with mankind Huntingdon disease such as typical respiratory disorder, dyskinesia and the heritable passage that can be stablized, reliable model is provided for human research Huntingdon disease, and quantity is able to ensure that so that drug screening can be used for, and gene therapy stem-cell therapy etc., the good disease model of the mankind can be become.

Description

Human Huntington gene knock-in recombinant vector and its construction method and swine model build In application

Technical field

The present invention relates to genetic engineering field, more particularly, to a kind of human Huntington gene knock-in recombinant vector and its structure Construction method and the application in swine model structure.

Background technology

Huntingdon disease (Hutington Diseases, HD) is by carrying the N ends for being more than 37 polyglutamic acids and repeating End fragment forms (Gusella et al., Archives of caused by the aggregation of inclusion body and nerve fibre in core neurology,1993；Vonsattel et al.,Journal of neuropathology and experimental Neurology 1998), undergone mutation by the huntingtin gene (Huntingtin, Htt) on No. four the short arm of a chromosome Caused autosomal dominant inherited disease, is mainly shown as that variant protein accumulates in cranial nerve cell and causes nerve cell It is dead.The pathogenic factor of Huntingdon disease is very clear, when HTT genes contain the consequent glutamine sequences of more than 37, mutation Huntington protein false folding just occurs, in neuron formed inclusion body aggregation causes neuronal death, so as to make one to produce Raw movement and cognition dysfunction.

Due to directly to patient carry out experiment suffer from experiment material and ethics in terms of limitation, so make one with The substantially similar Huntingdon disease model of human physiological's function, has research mankind Huntingdon and other nerve degenerative diseases Important meaning, helps to disclose the mechanism that the inclusion body as caused by aggregation and misfolded protein is formed.At this stage Huntingdon disease animal model is mainly the small animal models such as drosophila, zebra fish, mouse and rat, can not truly react the mankind The symptom of Huntingdon disease.Compared with these animal models, pig is in evolution with the mankind more closely, such as nerve, Digestive The anencephaly ditch and gyrus extremely similar in appearance to people compared to rat, mouse such as system, skin, skeleton development and metabolism；The brain of pig Structure has brain ditch and gyrus, and capacity etc. and human brain are closely similar；And the gene expression of pig, the occurrence and development of disease are more It is similar to the mankind.Therefore, pig can be used as a kind of preferably Huntingdon disease animal model.

It is transferred in the pig of variation Huntintin genes, newborn pigs are often very small and weak compared with normal pig and weight increases Add slowly, death just occurs soon after birth, therefore the nervus retrogression that people just falls ill after the middle age cannot be simulated well The symptom of disease.By analysis, this is because the overexpression of the multi-copy integration of gene or Huntintin variant proteins causes Big animal is postnatal dead immediately.

Traditional gene knock-in model is often obtained using the method for mouse stem cells homologous recombination, and the conventional method is used for pig The probability that fibroblast obtains gene knock-in is very low, and only 10^-6And the cycle is grown to 6 months to 1 year.And utilize and lure Pluripotent stem cell (ips) is led gene knockout or knock in there are still technical problem, in general, time-consuming, effort and It is expensive.In recent years, the appearance of artificial endonucleases (Engineered endonuclease, EEN) technology causes dynamic greatly There occurs earth-shaking change for thing gene targeting.Artificial nuclease can be broken by producing DNA double chain in DNA target site (Double strand breaks, DSBs), the DSBs can be with non-homologous end joining (Non- intrinsic in active cell Homologous end-ing-joining, NHEJ) or homologous recombination repair (Homology-Directed Repair, HDR) Two kinds of different repair mechanisms repair the DNA of damage, so as to fulfill the fixed point editor to genome.Effective artificial nucleus Sour enzyme includes Zinc finger nuclease (ZFNs), can will knock out efficiency and improve to 4%, but still be difficult in face of gene knock-in efficiency Realize.Transcriptional activation sample effector nuclease (Transcription activator-like effector nucleases, TALENs) further improve gene knockout efficiency, however, the TALE repetitive sequences of structure length are a mistakes taken time and effort Journey.

Cas9 endonucleases derive from the CRISPR/Cas9 systems of bacterium, the relevant Cas9 of CRISPR- of RNA mediations Enzyme can target sequence by specific 20 base-pair and shearing is identified.At the beginning of 2013, the Feng Zhang seminar of MIT is first Secondary report utilizes EMX1 the and PVALB genes of CRISPR/Cas9 system on human 293T cells and the Th of mouse Nero2A cells Gene realizes rite-directed mutagenesis (Cong et al., Science, 2013).The mRNA and specific sgRNA that encode Cas9 are injected Into unicellular zebrafish embryo, have in 10 cleavage sites 8 sites all there occurs cutting (Hruscha et al., Development, 2013), and its effect is higher than TALEN far away, and Cas9RNA and sgRNA are injected into embryo and do not examined Measure its toxicity.Therefore, using Cas9 technologies come carry out gene targeting genetic modification be it is a kind of efficiently, easily and efficiently means. At present Cas9 technologies have been widely used for mouse cell, mouse (Shen et al., Cell Res, 2013；Wang et Al., Cell, 2013), in the animal such as rat (Ma et al., Cell Res, 2014), mankind's various kinds of cell system, and pass through Technology improves to have obtained low-down efficiency of missing the target.Cas9mRNA and sgRNA by being injected into the kytoplasm of embryonated egg by Tang etc. In, directly obtain the hemophilia model (Hai et al., Cell Res, 2014) for knocking out vWF gene pigs.Zhou etc. utilizes Cas9 By knocking out the tyrosinase TYR on Banna minipig (black) by way of body-cell neucleus transplanting^-/-Successfully obtain Albefaction disease model and the swine model that is not fitted together to, pass through PARK2^-/-/PINK1^-/-Double knockout gene pigs obtain Parkinson Disease model pig (Zhou et al., Cell Mol Life Sci, 2015).Although very high gene can be produced using Cas9 Knock out efficiency, but directly by Cas9, sgRNA, recombinant vector be injected into producer gene in embryonated egg knock in animal efficiency it is remote Far below the efficiency of gene knockout.

The content of the invention

Based on this, it is necessary to provide a kind of gene knock-in it is efficient and can stablize passage human Huntington gene knock-in weight Group carrier and its construction method and the application in swine model structure.

A kind of recombinant vector of human Huntington gene knock-in, it is described to strike inserted with knocking in fragment in the recombinant vector Entering fragment includes the huntingtin gene fragment of people's mutation and the upstream for the huntingtin gene fragment being mutated respectively positioned at the people With the homology arm homologous with the huntingtin gene of miniature pig in downstream, the huntingtin gene fragment of people's mutation is Heng Ting containing people The sequence fragment that CAG repetitive sequences are mutated in gene First Exon.

In one of the embodiments, the quantity of the CAG repetitive sequences in the huntingtin gene fragment of people's mutation surpasses 36 are crossed, is preferably 150, more preferably the sequence of the huntingtin gene fragment of people's mutation is as shown in SEQ ID No.13.

A kind of construction method of recombinant vector, includes the following steps：Build the huntingtin gene fragment of the mutation containing someone Fragment is knocked in, the huntingtin gene fragment of people's mutation is that CAG repetitive sequences are dashed forward in the First Exon of gene containing human Huntington The sequence fragment of change, and knocked at this in fragment, the upstream and downstream of the huntingtin gene fragment of people's mutation connects respectively There is the homology arm homologous with the huntingtin gene of miniature pig, the fragment of knocking in is connected on carrier, obtain the restructuring and carry Body.

In one of the embodiments, it is described by it is described knock in fragment and be connected on carrier further include following steps：With sequence It is upstream and downstream primer to arrange DNA fragmentation as shown in SEQ ID No.3 and SEQ ID No.4, using the genomic DNA of miniature pig as Template amplification obtains two homology arms of miniature pig and the pig huntingtin gene first among two homology arms is shown outside Sub-piece, which is connected to through pBluescript made from same inscribe cleavage after EcoRI and KpnI digestions On KS (-) carrier, pBS-HD plasmids are formed, the huntingtin gene fragment that the people is mutated then is inserted into two homology arms Pig huntingtin gene First Exon fragment is replaced in centre, obtains pBS-HD-KI recombinant vectors.

In one of the embodiments, the huntingtin gene fragment that the people is mutated is inserted into two homology arms Replace pig huntingtin gene First Exon fragment and include the following steps in centre：

Using the huntingtin gene fragment of people's mutation as masterplate, and NcoI and ApaI restriction enzyme sites are designed at its both ends, PCR expands Increase the huntingtin gene fragment for the people's mutation for be connected with restriction enzyme site；

PBS-HD plasmids and the huntingtin gene fragment for the people's mutation for being connected to restriction enzyme site are subjected to NcoI and ApaI respectively Double digestion；

The huntingtin gene fragment that people is mutated is connected in pBS-HD plasmids using T4DNA ligases, is obtained described PBS-HD-KI recombinant vectors.

A kind of construction method of the reconstructed eggs of human Huntington gene knock-in swine model, includes the following steps：

Step 1：Meet G (N) for the intron sequences after the First Exon of the huntingtin gene of miniature pig₁₆NGG sequences The positive strand sequence part of row pattern separately designs sgRNA of two sequences respectively as shown in SEQ ID No.1 and SEQ ID No.2 Identification sequence, be denoted as the first sgRNA identification sequences and the 2nd sgRNA identification sequences respectively, the first sgRNA identifies sequence With the 2nd sgRNA identification sequence with corresponding introne positive strand sequence G (N)₁₆Unanimously, N A, T, C or G, subscript 16 represent The number of N；

Step 2：Identify that sequence and the 2nd sgRNA identify sequence design complementary series, institute to the first sgRNA respectively State the first sgRNA identification sequences and its complementary series forms the first double-stranded DNA, the 2nd sgRNA identification sequences and its complementation The second double-stranded DNA of Sequence composition；

Step 3：SgRNA transcription vectors are designed according to first double-stranded DNA and second double-stranded DNA respectively, are denoted as First sgRNA carriers and the 2nd sgRNA carriers, wherein, first double-stranded DNA is contained in the first sgRNA carriers, it is described Contain second double-stranded DNA in 2nd sgRNA carriers；

Step 4：By the first sgRNA carriers, the 2nd sgRNA carriers, donor vehicle and contain Cas9 notch enzyme genes The fibroblast of carrier cotransfection miniature pig, filters out the positive monocytes clone of human Huntington gene knock-in, the donor Carrier is the recombinant vector of the human Huntington gene knock-in described in any of the above-described embodiment, or the donor vehicle is using upper The construction method for stating the recombinant vector described in any embodiment builds to obtain；

Step 5：By the positive monocytes Clone Digestion into individual cells, the enucleation oocyte of miniature pig is injected into In, form reconstructed eggs.

In one of the embodiments, in the step 3, the first sgRNA carriers and the 2nd sgRNA carriers are equal The transcription vector started for U6 promoters.

In one of the embodiments, in the step 4, the cotransfection is the method using electrotransfection, electrotransfection Parameter：1400V、10ms、1pulse.

In one of the embodiments, in the step 4, the fibroblast of the miniature pig after cotransfection is training Support in the ascorbic culture medium for being 25 μ g/ml added with concentration.

A kind of construction method of the reconstructed eggs of human Huntington gene knock-in swine model using described in any of the above-described embodiment Build obtained reconstructed eggs.

A kind of people's gene knocks in the construction method of swine model, includes the following steps：

Construction method according to the reconstructed eggs of the human Huntington gene knock-in swine model described in any of the above-described embodiment is built Reconstructed eggs；

Cell fusion and activation, the reconstructed eggs activated are carried out to the reconstructed eggs；

By the reconstructed eggs of the activation as in the fallopian tubal of replace-conceive sow, or by the reconstructed eggs of the activation in vitro Cultivated, form reconstructed embryo, then the reconstructed embryo is transplanted to the intrauterine of replace-conceive sow again；

The replace-conceive sow is raised, produces human Huntington gene knock-in swine model.

In one of the embodiments, it is described that cell fusion and activation, the reconstruct activated are carried out to the reconstructed eggs Ovum, specifically comprises the following steps：

The reconstructed eggs are operated from stoning to be fused in embryo medium and activation is gone in liquid；

The reconstructed eggs are transferred to fusion liquid activation liquid to be balanced, the reconstructed eggs balanced are moved into converged container It is interior, gently stir reconstructed eggs, make the contact surface of egg mother cell and the cell of injection parallel to two strip electrodes, between two strip electrodes between 1mm is divided into, then carries out electric pulse stimulation, electrofusion parameter is：120volts/mm, 30 μ s, 2 times；

Reconstructed eggs are moved into embryo operation liquid after electric pulse stimulation, filter out the successful reconstructed eggs of fusion.

Above-mentioned human Huntington gene knock-in recombinant vector and its construction method, the reconstructed eggs and its construction method of swine model The Huntingdon First Exon gene (HTT genes) being mutated with the construction method of swine model, first passage fixed point gene knock-in people, And Disease-causing gene is knocked in using CRISPR/Cas9 technologies fixed point first, by optimizing sgRNA, optimize donor vehicle, improve base Because knocking in the probability of positive colony cell, the gene knock-in for improving and directly obtaining the positive is combined with pig nucleus transplantation technology The probability of pig, obtains the miniature pig that human Huntington disease gene is knocked in, it was demonstrated that this method is used for the height for building genetic modification pig Imitate feasibility.Because Huntingdon disease is single-gene autosomal dominant inherited disease, Disease-causing gene is single and typical, and is obtained Huntingtin gene knock in swine model and show typically Huntingdon pathology and Behavioral feature, most importantly Huntingdon base Because knocking in heritable passage that swine model can be stablized, reliable model can be provided for human research Huntingdon disease, and Quantity is able to ensure that so that drug screening, and gene therapy stem-cell therapy etc. can be used for, the good disease of the mankind can be become Animal pattern.

Brief description of the drawings

Fig. 1 is the construction method principle schematic of the human Huntington gene knock-in swine model of an embodiment；

Fig. 2 knocks in fibroblast PCR qualification figures and body-cell neucleus transplanting pregnancy rate result for positive gene；

Fig. 3 is detection and the observation result that positive gene knocks in pig after pregnancy pig produces；

Fig. 4 is body, locomitivity, survivorship curve and the changes of weight result of KI pigs and WT pigs；

Fig. 5 is the HD gene knock-in pig protein expression result figures of mutation；

Fig. 6 is that the huntingtin gene of mutation knocks in the hereditary result figure of pig.

Embodiment

For the ease of understanding the present invention, the present invention is described more fully below with reference to relevant drawings.In attached drawing Give presently preferred embodiments of the present invention.But the present invention can realize in many different forms, however it is not limited to this paper institutes The embodiment of description.On the contrary, the purpose for providing these embodiments is to make the understanding to the disclosure more thorough Comprehensively.

Unless otherwise defined, all of technologies and scientific terms used here by the article is with belonging to technical field of the invention The normally understood implication of technical staff is identical.Term used in the description of the invention herein is intended merely to description tool The purpose of the embodiment of body, it is not intended that in the limitation present invention.Term as used herein "and/or" includes one or more phases The arbitrary and all combination of the Listed Items of pass.

As shown in Figure 1, the construction method of the human Huntington gene knock-in swine model of an embodiment, includes the following steps：

Step S110：Meet for the intron sequences after the First Exon (Exon 1) of the huntingtin gene of miniature pig G(N)₁₆The positive strand sequence part of NGG sequence patterns separately designs the identification sequence of two different sgRNA, is denoted as first respectively SgRNA identification sequences (sgRNA-1) and the 2nd sgRNA (sgRNA-2) identification sequences, the first sgRNA identification sequences and second SgRNA identification sequence with corresponding introne positive strand sequence G (N)₁₆Unanimously, N A, T, C or G, subscript 16 represent the number of N.

Miniature pig, that is, minipig (Sus scrofa, HTT Gene ID：397014), can be but not limited to as Chinese wide Western melt water miniature pig.

In the present embodiment, the first sgRNA identifies sequence (GCACCGACCGTGAGTGC) as shown in SEQ ID No.1, 2nd sgRNA identification sequences (GCGGTGACGTCATGCCT) are as shown in SEQ ID No.2.Meet G (N) in introne normal chain₁₆The sequence of NGG sequence patterns respectively such as SEQ ID No.7 (GAGCCGCTGCACCGACCGTGAGTGCGGGCCCCCTGCA) and Shown in SEQ ID No.8 (GCGGGGCAGCGGTGACGTCATGCCTCGGGGCGGGGGC).

Step S120：Identify that sequence and the 2nd sgRNA identify sequence design complementary series to the first sgRNA respectively, first SgRNA identifies that sequence and its complementary series form the first double-stranded DNA, and the 2nd sgRNA identification sequences and its complementary series form the Two double-stranded DNAs.

Specifically in the present embodiment, the building process of the first double-stranded DNA and the second double-stranded DNA includes the following steps：

Identify that sequence and the 2nd sgRNA identify sequence design complementary series to the first sgRNA respectively；

ATA is added at 5 ' ends of the first sgRNA identification sequences, 3 ' ends add GT sequence fragments, form such as SEQ ID No.9 Shown sequence fragment (ATA GCACCGACCGTGAGTGC GT), and 5 ' of the complementary series in the first sgRNA identification sequences End adds TAAAAC sequence fragments, forms the sequence fragment (TAAAAC as shown in SEQ ID No.10 GCACTCACGGTCGGTGC), sequence and its complementary sequence added with cohesive end will be identified added with the first sgRNA of cohesive end Row, which are made annealing treatment, obtains the first double-stranded DNA with cohesive end；

ATA is added at 5 ' ends of the 2nd sgRNA identification sequences, 3 ' ends add GT sequence fragments, form such as SEQ ID Sequence fragment (ATA GCGGTGACGTCATGCCT GT) shown in No.11, and in the complementary series of the 2nd sgRNA identification sequences 5 ' ends add TAAAAC sequence fragments, sequence fragment (TAAAAC of the formation as shown in SEQ ID No.12 AGGCATGACGTCACCGC), sequence and its complementary sequence added with cohesive end will be identified added with the 2nd sgRNA of cohesive end Row are made annealing treatment, and obtain the second double-stranded DNA with cohesive end.

The first double-stranded DNA and the cohesive end of the second double-stranded DNA formed, available for being connected to corresponding transcription vector On.

Step S130：SgRNA transcription vectors are designed according to the first double-stranded DNA and the second double-stranded DNA respectively, are denoted as first SgRNA carriers and the 2nd sgRNA carriers, wherein, contain the first double-stranded DNA in the first sgRNA carriers, in the 2nd sgRNA carriers Contain the second double-stranded DNA.

This step is to correspond to the first double-stranded DNA and the second double-stranded DNA to be connected to the plasmid containing sgRNA coded sequences In, the plasmid vector containing U6 promoters is such as connected to, which specifically may include steps of：Encoded containing sgRNA Corresponding restriction enzyme site is introduced in the plasmid vector of sequence, such as BbsI restriction enzyme sites, obtains intermediate plasmid, then by the first double-strand DNA and the second double-stranded DNA are connected to the correspondence of the intermediate plasmid after digestion by the restriction enzyme site (i.e. cohesive end) of introducing Position obtains required plasmid.Wherein, restriction enzyme site can be, but not limited to BbsI restriction enzyme sites, when restriction enzyme site is BbsI digestions During site, which is respectively connected with above-mentioned cohesive end with second double-stranded DNA, and cloning vector is through BbsI digestions Processing.

Step S140：Build the fragment of knocking in of the huntingtin gene fragment of the mutation containing someone, the Huntingdon base of the people's mutation Because fragment is the sequence fragment that CAG repetitive sequences are mutated in the First Exon of gene containing human Huntington, and knocked at this in fragment, The upstream and downstream of the huntingtin gene fragment of people's mutation is connected to the homology arm homologous with the huntingtin gene of miniature pig, Fragment will be knocked in be connected on carrier, obtained recombinant vector is as donor vehicle.

In one embodiment, specifically using the DNA fragmentation of sequence shown in SEQ ID No.3 and SEQ ID No.4 as it is upper, Anti-sense primer, two homology arms of miniature pig and same positioned at this two are obtained by template amplification of the genomic DNA of miniature pig Pig huntingtin gene First Exon fragment among source arm, which is connected to after EcoRI and KpnI digestions through On pBluescript KS (-) carrier of same inscribe cleavage, pBS-HD plasmids are formed, the Huntingdon base for being then mutated people The middle of two homology arms is inserted into because of fragment and replaces pig huntingtin gene First Exon fragment, obtains pBS-HD-KI restructuring Carrier.In other embodiments, it is not limited to use pBluescript KS (-) carrier.

More specifically, CAG repetitive sequences in the huntingtin gene fragment behaviour huntingtin gene First Exon of people's mutation The sequence fragment of mutation of the quantity more than 36, the centre that the huntingtin gene fragment that people is mutated is inserted into two homology arms are replaced Pig huntingtin gene First Exon fragment is changed to include the following steps：

The huntingtin gene fragment that people is mutated is connected in pBS-HD plasmids using T4DNA ligases etc., is obtained described PBS-HD-KI recombinant vectors.

Described in present embodiment people mutation huntingtin gene fragment in CAG repetitive sequences quantity more than 36, Preferably 150, more preferably the sequence of the huntingtin gene fragment of people's mutation is as shown in SEQ ID No.13.

Step S150：By the first sgRNA carriers, the 2nd sgRNA carriers, donor vehicle and contain Cas9 notch enzyme genes Carrier cotransfection miniature pig fibroblast, filter out human Huntington gene knock-in positive monocytes clone.

The carrier containing Cas9 notch enzyme genes can be but not limited to as the load containing CMV-Cas9-neo genes Body.

In this step, cotransfection is the method using electrotransfection, the parameter of electrotransfection：1400V、10ms、1pulse.

Further, in this step, the fibroblast of the miniature pig after cotransfection is that culture is being added with concentration In the ascorbic culture medium of 25 μ g/ml.

The positive monocytes clone for filtering out human Huntington gene knock-in includes the following steps：

The clone cell of part culture is cracked, extracts lysate；

PCR processing is carried out to lysate, wherein, the primer sequence of PCR respectively as SEQ ID No.5 (5 '- GGAGAGCTGGGAGAGAATGCCAGTGTGACAGT-3 ') and SEQ ID No.6 (5 '- GCGGCTGAGGCAGCAGCGGCTGTGCCTG-3 ') shown in, PCR conditions are：95 DEG C of pre-degenerations 3 minutes；95 DEG C are denatured 30 seconds, 65 DEG C are annealed 30 seconds, and 72 DEG C extend 90 seconds, totally 30 circulations；Last 72 DEG C extend 2 minutes；

Take PCR product to carry out 1% agarose gel electrophoresis detection and/or sequencing analysis, select positive colony cell.

In addition, in the present embodiment, by the first sgRNA carriers, the 2nd sgRNA carriers, donor vehicle and containing The carrier cotransfection of Cas9 notch enzyme genes is further included respectively to the first sgRNA carriers, second into before fibroblast Expand culture after sgRNA carriers, donor vehicle and the inverted processing of carrier containing Cas9 notch enzyme genes, then extract respectively The step of first sgRNA carriers, the 2nd sgRNA carriers, donor vehicle and carrier containing Cas9 notch enzyme genes.

Step S160：By positive monocytes Clone Digestion into individual cells, it is injected into the enucleation oocyte of miniature pig, Form reconstructed eggs.

Specifically in the present embodiment, following steps can be used to carry out：

Centrifugal treating is carried out after positive colony cell is digested using trypsase, abandons supernatant, cell is resuspended；

During stoning operates liquid to egg mother cell with after the stoning of blind suction method, walking the cell direct injection of resuspension in absorption in going In the perivitelline of the egg mother cell of core, egg mother cell is gently extruded, makes the cell of the cell membrane and the cell of injection of egg mother cell Film contacts.

Step S170：Cell fusion and activation, the reconstructed eggs activated are carried out to reconstructed eggs.

Specifically, described to carry out cell fusion and activation to reconstructed eggs, the reconstructed eggs activated, specifically include following step Suddenly：

Reconstructed eggs are operated from stoning to be fused in embryo medium and activation is gone in liquid；

Reconstructed eggs are transferred to fusion liquid activation liquid to be balanced, the reconstructed eggs balanced are moved into converged container, gently Gently stir reconstructed eggs, make the contact surface of egg mother cell and the cell of injection parallel to two strip electrodes, between two strip electrodes at intervals of 1mm, then carries out electric pulse stimulation, and electrofusion parameter is：120volts/mm, 30 μ s, 2 times；

Step S180：By the reconstructed eggs of activation as in the fallopian tubal of replace-conceive sow, or by the reconstructed eggs of activation in body It is outer to be cultivated, reconstructed embryo is formed, then reconstructed embryo is transplanted to the intrauterine of replace-conceive sow again, raises replace-conceive sow, is produced Human Huntington gene knock-in swine model.

Further, the authentication step to human Huntington gene knock-in swine model can also be included：To be produced from replace-conceive sow Porkling tissue obtain genomic DNA be template, with the DNA fragmentation of sequence shown in SEQ ID No.5 and SEQ ID No.6 PCR amplification is carried out for upstream and downstream primer, amplified production is detected and/or is sequenced into row agarose gel electrophoresis and is detected, PCR bars Part is：95 DEG C of pre-degenerations 3 minutes；95 DEG C are denatured 30 seconds, and 65 DEG C are annealed 30 seconds, and 72 DEG C extend 90 seconds, totally 30 circulations；Last 72 DEG C extension 2 minutes.

Above-mentioned mankind's huntingtin gene knocks in the construction method of swine model, the henry of first passage fixed point gene knock-in people's mutation The court of a feudal ruler First Exon gene (HTT genes), and Disease-causing gene is knocked in using CRISPR/Cas9 technologies fixed point first, by excellent Change sgRNA sequences, optimize donor homologous recombination plasmid, cell proportion when optimization transfects, and added during cell screening Vitamin C, improves the probability of gene knock-in positive colony cell, is combined to improve with pig nucleus transplantation technology and directly obtained The probability of positive gene knock-in swine model is obtained, Huntingdon disease gene is obtained and knocks in miniature pig, it was demonstrated that this method is used for structure Build the efficient feasibility of genetic modification pig.Because Huntingdon disease is single-gene autosomal dominant inherited disease, Disease-causing gene list One and typical case, and the HD gene knock-in swine models obtained show typically Huntingdon pathology and Behavioral feature, the most It is important that heritable passage that HD gene knock-ins swine model can be stablized, can be provided for human research Huntingdon disease can The model leaned on, it is ensured that quantity can simultaneously be used for drug screening, and gene therapy stem-cell therapy etc., and it is good can to become the mankind Disease model animals.

It is specific embodiment part below.

Material：Cell：Rongshui Guangxi miniature pig primary fibroblast.

Animal：All experimental animals are according to Chinese Academy of Sciences Guangzhou Institute of Biomedicine and Health standard and requirement Operated, in accordance with animal welfare morals.It is miniature pig used by this experiment, because its bodily form is smaller, closer to the mankind, just In operation and behaviouristics measure.

Pig ovary：Purchased from slaughterhouse.

Bacterial strain：Top10 competent cells (Beijing Tiangeng biochemical technology company)

Other reagents, unless stated otherwise, are purchased from Sigma companies, are corresponding Chinese and/or business behind parantheses Product catalog number (Cat.No.).

(1) structure of CRISPR/Cas9 targeting systems：

According to sequence (the Gene ID of the HTT genes of the middle-size and small-size pig of ncbi database：397014), pressed with intron sequences According to G (N)₁₆NGG principles, respectively to after First Exon (exon1) introne normal chain (partial sequence such as SEQ ID No.7 and Shown in SEQ ID No.8) the identification sequence of two corresponding sgRNA of design, the first sgRNA identifications sequence (such as SEQ is denoted as respectively Shown in ID No.1) and the 2nd sgRNA identification sequences (as shown in SEQ ID No.2).

Genome of the extraction for cell to be transfected, is designed a pair of at the target sequence both ends of the identification recognition sequence of sgRNA Primer, wherein upstream primer sequence are：5 '-GGAGAGCTGGGAGAGAATGCCAGTGTGACAGT-3 ' (such as SEQ ID No.5 It is shown), downstream primer sequence is：5 '-GCGGCTGAGGCAGCAGCGGCTGTGCCTG-3 ' (as shown in SEQ ID No.6), PCR amplification contains the DNA fragmentation of target sequence, clip size 388bp.PCR amplification condition is：95 DEG C of pre-degenerations 3 minutes；95℃ Denaturation 30 seconds, 65 DEG C are annealed 30 seconds, and 72 DEG C extend 90 seconds, totally 30 circulations；Last 72 DEG C extend 2 minutes.The target sequence of amplification Fragment, with the sequence alignment on GenBank, determines that sequence is correct after sequencing.

2 Bbs I are introduced in plasmid sgRNA-GFP-T1 (being purchased from Addgene companies, catalog number 41819) plasmid Restriction enzyme site, obtains U6-sgRNA cloning vectors.Identify that sequence and the 2nd sgRNA identify sequence design to the first sgRNA respectively Complementary series, and identify sequence and the 2nd sgRNA identification sequences and corresponding complementary series both ends plus viscosity in the first sgRNA End, re-annealing processing form the first double-stranded DNA and the second double-stranded DNA.Wherein, the sequence of two chains is divided in the first double-stranded DNA Not as shown in SEQ ID No.9 and SEQ ID No.10, the sequence of two chains is respectively such as SEQ ID No.11 in the second double-stranded DNA Shown in SEQ ID No.12.

The first double-stranded DNA and the second double-stranded DNA are corresponded to respectively and are connected to the U6-sgRNA cloning vectors through BbsI digestions In, the first sgRNA carriers and the 2nd sgRNA carriers are obtained, determines that sequence connection is correct through being sequenced.

(2) donor vehicle of gene to be knocked in is built

With SEQ ID No.3 (ACGAATTCTGCATGAAGGCTGGCAT (EcoRI)) and SEQ ID No.4 The DNA fragmentation of sequence is upstream and downstream primer shown in (TTGGTACCCTCCCGCAGCATATGG (Kpn1)), with the gene of miniature pig Group DNA is the target sequence 18Q that template amplification obtains two homology arms of miniature pig and is connected between two homology arms (18CAG repetitive sequences), which is connected on pBluescript KS (-) carrier, then by First Exon The huntingtin gene that the people that PolyQ is 150Q is mutated is inserted into the middle of homology arm and replaces target sequence 18Q, obtains pBS-HD-KI Plasmid is as donor vehicle.

Specifically, the huntingtin gene that the people that PolyQ is 150Q is mutated is inserted into the middle of homology arm and replaces target Sequence includes the following steps：

Using the DNA fragmentation of sequence shown in SEQ ID No.3 and SEQ ID No.4 as upstream and downstream primer, with the base of miniature pig Because group DNA is that template amplification obtains two homology arms of miniature pig and the pig huntingtin gene among two homology arms First Exon fragment, which is connected to through same inscribe cleavage after EcoRI and KpnI digestions On pBluescript KS (-) carrier, pBS-HD plasmids are formed；

Using the DNA of the repetitive sequences of 150CAG containing someone of mutation as masterplate, and NcoI and ApaI digestions are designed at its both ends Site carries out PCR amplification, amplifies exons 1 DNA fragmentation that is that people is mutated and including 150 CAG repetitive sequences, amplifies The human Huntington exons 1 gene containing 150 CAG of about 600bp；

PBS-HD plasmids and the exons 1 PCR recovery products containing 150CAG repetitive sequences that people is mutated are carried out respectively NcoI and ApaI digestions, after fragment recycling, are connected in pBS-HD plasmids using T4DNA ligases, obtain pBS-HD-KI Plasmid gene knocks in donor plasmid.

(3) cell transfecting and screening

Respectively to the first sgRNA carriers, the 2nd sgRNA carriers, donor vehicle and load containing Cas9 notch enzyme genes Body (carrier such as containing CMV-Cas9-neo genes, purchased from Addgene companies, catalog number MLM3613) inverted place Expand culture after reason, then extract the first sgRNA carriers, the 2nd sgRNA carriers, donor vehicle respectively and contain Cas9 nickases The carrier of gene, the first sgRNA carriers and each 2.5 μ g of the 2nd sgRNA carriers, donor vehicle and contain Cas9 notch enzyme genes Each 10 μ g of carrier.

The fetus primary fibroblast of day before transfection recovery melt water miniature pig, adds in 10cm Tissue Culture Dish 10ml 15%FBS DMEM culture mediums, are placed in 37 DEG C of incubator cultures；After cell covers with 90% culture dish, pancreatin digestion weight Outstanding cell, 100 μ l of cell are resuspended using the buffer R (MPK10096, invitorgen) in Transfection kit, then Add 2.5 μ g of the first sgRNA carriers, 2.5 μ g of the 2nd sgRNA carriers, 10 μ g of donor vehicle and contain Cas9 nickase bases The 10 μ g of carrier of cause, carry out electricity using NeonTMTransfection System electroporations (MPK5000, invitorgen) and turn Contaminate, the E2buffer of 3ml is previously added in electroporation, electricity turns parameter：1400V、10ms、1pulse.After electricity turns, pass through dilution Method is diluted in different culture dishes, after G418 screens cell clone, treats that individual cells grow up to clone's shape, is chosen with clone's ring Elect, and carry out PCR and agarose gel electrophoresis identification on a small quantity.

Authentication step is：The monoclonal cell taken out for identifying is collected by centrifugation, adds 15 μ l NP40 lysates (to contain 0.45%NP-40 and 0.6% Proteinase K), successively 56 DEG C crack 1h, 95 DEG C crack 10 minutes, obtained lysate in- 20 DEG C save backup；PCR processing is carried out to lysate, wherein, the primer sequence of PCR respectively as SEQ ID No.5 (5 '- GGAGAGCTGGGAGAGAATGCCAGTGTGACAGT-3 ') and SEQ ID No.6 (5 '- GCGGCTGAGGCAGCAGCGGCTGTGCCTG-3 ') shown in, PCR conditions are：95 DEG C of pre-degenerations 3 minutes；95 DEG C are denatured 30 seconds, 65 DEG C are annealed 30 seconds, and 72 DEG C extend 90 seconds, totally 30 circulations；Last 72 DEG C extend 2 minutes；

PCR product is taken to carry out 1% agarose gel electrophoresis detection.The PCR product of a single bright band is obtained with forward direction Primer send Guangzhou Ai Ji gene sequencing.Sequencing result is consistent with former donor plasmid pBS-HD-KI sequence alignments, obtains people's mutation HD gene knock-in positive cell clones.

The monoclonal cell of the positive is selected as nuclear transfer donor cell, carries out body-cell neucleus transplanting.

To improve the state of the efficiency of gene knock-in and cell culture, when transfection, makes cell be in active division to increase shape State, adds vitamin C, concentration is 25 μ g/ml, to maintain preferable cell state in the medium.Treat that picked clones expand During passage, a small amount of progress PCR identifications are taken out.First, cell to be identified is placed in baking oven, when 56 DEG C 1 small after be warming up to 96 DEG C of changes Property 10 minutes, positive colony is identified by above-mentioned PCR method PCR, is positive HD gene knock-ins into fiber finer containing homology arm Born of the same parents clone.

(4) body-cell neucleus transplanting

1) separation of porcine oocytes and maturation

Ovary is taken from slaughterhouse, ovary is put in 39 DEG C of physiological saline containing penicillin and streptomysin, will with syringe In ovarian follicle extraction ovarian follicle extraction, 39 DEG C stand 30 minutes, remove supernatant, using TL-HEPES be resuspended precipitate, then stand it is last will Re-suspension liquid is put into 60mm plates, under stereoscope, selects more than 2 layers of ovarian cumulus of parcel, the uniform cumulus cell of kytoplasm-ovum is female thin Born of the same parents, are cleaned 3 times with ripe liquid, are transferred in nutrient solution and cultivate, 42 it is small when after, take off ovarian cumulus with the DPBS containing 0.5% hyaluronidase, Choose the egg cell containing polar body and carry out body-cell neucleus transplanting.

Specifically, by collected pig ovary be placed in 39 DEG C added with penicillin, streptomysin physiological saline in.Suction out ovarian follicle Liquid is simultaneously kept the temperature in 39 DEG C of water-baths.Standing removes supernatant after five minutes, adds egg-cleaning liquid PVA-TL-HEPES and (weighs 6.6633g NaCl、0.2386g KCl、0.1680g NaHCO₃、0.0408g NaH₂PO4、0.1017g MgCl₂·6H₂O、2.3830g Hepes (4- hydroxyethyl piperazineethanesulfonic acids, H3784), 0.0650g Penicillin (penicillin, P3032), 0.0100g PHenol Red (phenol red, 5530), 0.2940g CaCl₂·2H₂O, 0.1000g Polyvinyl alcohol (PVA, poly- second Enol P8136), 2.1860g Sorbitol (D-sorbite, S1876), 0.0250g Gentamicin (gentamicin), 0.0220g Sodium pyruvate (Sodium Pyruvate, P4562), add 998.132ml Milli Q H₂Add again after O (ultra-pure water) 1.868ml Na Lactate (sodium lactate, L7900), it is 7.2-7.4, osmotic pressure 295-310mOsm that pH is adjusted after dissolving) choose Cumulus oocyte compound is taken, is transferred to ripe liquid (TCM-199 (Gibco companies) plus the 3.05mM D- balanced in advance Glucose (D-Glucose, G7021), 0.91mM Sodium pyruvate (Sodium Pyruvate, P4562), 0.1%PVA (Sigma, P8136), 75 μ g/ml Penicillin (Sigma, P3032), 50 μ g/ml Streptomycin (streptomysin, S1277), 0.5 μ g/ml Luteinizing hormone (LH, metakentrin, L5269), 10ng/ml Epidermal Growth factor (EGF, epidermal growth factor, S4127), 0.5 μ g/ml Follicle stimulating hormone (FSH, follicle-stimulating hormone (FSH), F2293), 0.57mM Cysteine (cysteine, C8152), 10% liquor folliculi.) in 5% CO₂, saturated humidity, cultivate under the conditions of 39 DEG C.12 orifice plates place 40-70 pieces of cumulus oocyte compound per hole.Maturation in vitro After cultivating 42-44h, cumulus oocyte compound is transferred to 39 DEG C and removes ovarian cumulus operation liquid (0.030g Hyaluronidase (hyaluronidase, H3506), 5.46g Mannitol (mannitol, M9647), 0.001g BSA (bovine serum albumin(BSA), A8022), 5ml PVA-TL-Hepes egg-cleaning liquids, 95ml Milli Q H₂O), be vortexed concussion 5 minutes, comes off to cumulus cell. Postdigestive egg mother cell is transferred to and fills embryo operation liquid (9.500g TCM-199 (Gibco companies), 0.050g NaHCO₃, 0.750g Hepes (H3784), 0.050g Penicillin (P3032), 0.060g Streptomycin (S1277), 1.755g NaCl, 3.00g BSA, 1000ml Milli Q H₂O, after pH is adjusted after dissolving as 7.2-7.4 dissolvings Adjusting pH is 7.2-7.4, osmotic pressure 295-310mOsm) 35mm culture dishes in, picking discharge first polar body under body formula mirror Egg mother cell is in another 35mm culture dishes for filling embryo operation liquid, and 39 DEG C of preservations are stand-by.

2) body-cell neucleus transplanting

Mature oocyte is enucleated, Ran Hou by positive colony cell dissociation into individual cells using micromanipulation system Its perivitelline injects donorcells, and electro' asion activation reconstruct embryo, continues to cultivate.

Specifically, the positive colony cell of culture carries out digestion process 4 minutes with 0.25% trypsase, afterwards with 1300 Rev/min speed centrifuge 5 minutes, abandon supernatant, with culture medium be resuspended cell.Egg mother cell is enucleated using blind suction method, by one Donor cell injection makes egg mother cell gently be contacted with donorcells in the perivitelline of enucleation oocyte.Reconstructed eggs are put Enter in the embryo medium PZM3 balanced, placed in 38.5 DEG C of incubators, it is to be fused with activating.

Reconstructed eggs are gone to fusion activation liquid (0.3M Mannitol (M9647), 1.0mM from embryo medium CaCl₂·2H₂O, 0.1mM MgCl₂·6H₂O, 0.5mM Hepes (H3784)) in it is to be fused with activation, by reconstructed eggs before fusion It is transferred to fusion activation liquid to be balanced, the reconstructed eggs balanced is moved into integration slot, weight is gently stirred with capillary glass pin Structure embryo, makes the contact surface of egg mother cell and donorcells parallel to two strip electrodes, at intervals of 1mm between two strip electrodes, then Electric pulse stimulation is carried out, electrofusion parameter is：120volts/mm, 30 μ s, 2 times.Reconstructed eggs are moved into embryo after electric pulse stimulation Operate liquid (9.500gTCM-199 (Gibco companies), 0.050g NaHCO₃, 0.750g Hepes (H3784), 0.050g Penicillin, 0.060gStreptomycin (S1277), 1.755g NaCl, 3.00g BSA, 1000ml Milli Q H₂O, it is that adjusting pH is 7.2-7.4, osmotic pressure 295-310mOsm after 7.2-7.4 dissolves that pH is adjusted after dissolving) in, put 39 DEG C After half an hour, check whether donorcells merges, removal does not merge reconstructed eggs and counts fusion rate., will after PZM-3 washes three times Reconstructed eggs, which are put in PZM-3, is placed in 5%CO₂, saturated humidity, cultivate under the conditions of 39 DEG C.

3) embryo transfer

Embryonic development is to 2 cell stages.Select the same day spontaneous estrus or before 2 days heat Taihu pigs., will by surgical operation , can output gene knock-in miniature pig after 114 days in the Embryonic limb bud cell fallopian tubal of 2 cell stages.

(5) method that identification positive gene knocks in cell and gene knock-in pig

Identification positive gene knocks in cell and gene knock-in pig primer sequence：

HD S:5’-GGAGAGCTGGGAGAGAATGCCAGTGTGACAGT-3’(SEQ ID No.5)

HD A:5’-GCGGCTGAGGCAGCAGCGGCTGTGCCTG-3’(SEQ ID No.6)

PCR conditions are：95 DEG C of pre-degenerations 3 minutes；95 DEG C are denatured 30 seconds, and 65 DEG C are annealed 30 seconds, and 72 DEG C extend 90 seconds, and totally 30 A circulation；Last 72 DEG C extend 2 minutes.

1) clone pig genotype identification：The overbit piercing after the birth of newborn clone pig, and remove fritter ear tissue extraction gene Group identification, comprises the following steps that：

A. ear tissue shreds, and adds 200 μ l GA solution and 20 μ l (20mg/ml) Proteinase Ks, and it is small to be placed in 56 DEG C of digestion 3 When；

B. 200 μ l GB solution are added, 7 DEG C of water-baths are extremely clarified for 10 minutes；

C. 200 μ l ethanol are added, are mixed；

D. liquid is moved into adsorption column CB3,12000 revs/min, is centrifuged 30-60 seconds.

E. pillar is cleaned with 500 μ l GD, then pillar is washed twice with 600 μ l PW；

F. the eluent TE of 100 μ l, 65 DEG C of water-bath preheatings is finally added dropwise among pillar, stands 3 minutes, 12000 turns, from The heart 2 minutes.

Using the genome of extraction as template, trade company PCR is carried out, agarose gel electrophoresis send sequencing after observing band.

2) identification of gene knock-in pig protein expression

The brain of HD KI pigs (hereinafter referred to as KI pigs) and WT wild type pigs is taken out respectively, passes through consolidating for 4% poly methanol Fixed, the dehydration of tissue experience, paraffin embedding, section etc., comprise the following steps that：

A. draw materials：2cm × 1.5cm is cut first, and thickness is no more than the tissue block of 3mm, is placed in soaking box；

B. it is dehydrated (preparing graded ethanol in advance)：70% ethanol, 80% ethanol, 90% ethanol, 95% ethanol I, 95% When ethanol II each 2 is small；In absolute ethyl alcohol I, absolute ethyl alcohol II 1 it is small when；Absolute ethyl alcohol and dimethylbenzene mixed liquor (volume ratio 1：1) in 30 minutes；

C. transparency of organization：Dimethylbenzene I, 30 minutes；30 minutes in dimethylbenzene II；

D. waxdip：Paraffin 58 DEG C of 1h, 59 DEG C of 1h, 60 DEG C of 1h；

E. embed：Oven temperature is risen to 63 DEG C, tissue is put in embedded box.

Immunohistochemistry and immunofluorescence dyeing step are as follows：A. dewaxing；B. dewax；C. aquation；D. repair；E. close；f. Primary antibody is incubated；G. clean；H. secondary antibody is incubated.

3) protein extraction and Western blotting

It is put into bio-rad transferring film instrument, 200mA, Huntingtin protein deliveries 120 minutes, selects 0.4 μm of PVDF Film.Cleaned after transferring film with TBST (i.e. containing 0.05% tween 20), add 5% skim milk, room temperature closing 1h, adds 1C2 4 DEG C of antibody overnight, is cleaned 3 times with TBST, adds 2 anti-incubation at room temperature 1h, is cleaned 3 times, you can detection.

(6) probability of the animal of the gene knock-in pig obtained by after identifying positive colony progress nuclear transfer as cellular level is big Amplitude improves

Nuclear transfer is carried out using the positive cell clone screened, adds the porcine fetus fibroblasts of recovery before nuclear transfer VC is added to improve cloning efficiency, final caused positive piggy is up to 86.7% gene knock-in positive rate, has saved warp Ji cost, shortens the time, improves the efficiency of gene knock-in model animals showing positive.

(7) experimental result and analysis

By optimizing donor vehicle plasmid pBS-HD-KI, the first sgRNA carriers, the 2nd sgRNA carriers, CMV-Cas9- The ratio of neo plasmids：10 μ g, 2.5 μ g, 2.5 μ g, 10 μ g, optimize the parameter of electroporation to optimize the gene knock-in of peak efficiency Probability.By the sgRNA sequences after screening, the best proportion after the optimization of the homologous target practice plasmid of structure and electric Pignus pignoris grain, warp After G418 screening cell clones, join Fig. 2, by being detected to two homology arms, the efficiency after optimization is to have in 15 cell clones 13 positive colonies, success rate are up to 87%, and the 10 of significantly larger than traditional gene knock-in^-6And the clpp gene such as Talen, ZFN The probability entered.

Continue to join Fig. 2, carry out nuclear transfer production HD gene knock-in pigs using the cell clone screened, wherein pregnancy rate is 62.5%.

As shown in figure 3, the gene knock-in pig that the positive is identified after production is to have 6 positive genes to knock in pig in 7, probability is high Up to 85.7%.Therefore, using optimization gene knock-in cell screening and body-cell neucleus transplanting method, by the pig of gene knock-in Positive rate significantly improves, and has saved cost, has improved efficiency.

Traditional HD transgene pigs are usually just dead immediately (Yang et al., 2010) after birth, and the present embodiment Newborn HD gene knock-ins swine model is consistent normal with wild type pig performance at birth, and at 5 months, gene knock-in pig was several Similar time point starts obvious dyskinesia, weight loss etc. occur, generates progressive phenotype, conventional transgenosis Pig is often due to be overexpressed toxic protein and dead immediately, or the inactive expression quantity in site of radom insertion is relatively low.In Fig. 4 Shown in A and B figures, it can be seen that these pigs show abnormal dyskinesia such as back leg intersection, sliding steps, and especially No. 5 generate Violent movement, that is, move spasm.Put on a treadmill when these pigs, after being continued for some time with the speed of 1.5km/h, from In Fig. 4 C figure it can be seen that KI pig cannot normally at the double, quick march, rest on motionless below.D figures are shown in Fig. 4, KI-2, KI-3, KI-4, KI-6 finally die of respiratory disorder.E shows the survivorship curve and changes of weight of KI pigs in Fig. 4.

HD gene knock-ins swine model provides good material for the Htt protein expressions of detection mutation.Pass through Western Blot analysis and utilization 1C2 antibody can show the appearance of PolyQ repeated fragments, it can be seen that the Htt of the mutation of total length is not With expression (cerebral cortex, corpus straitum) and other peripheral tissues such as liver and muscle in brain area, as shown in A figures in Fig. 5.As As expecting, the Htt albumen of the mutation of degraded also observed, and these degradeds are only shown in KI pigs, it is wild Raw type pig does not show, and 1C2 dyes the neuron that is gathered in that also reveal that Htt, and produces nerve fibre aggregation etc. As shown in B figures in Fig. 5.These results are consistent with mouse before, show that the Htt fragments of N-terminal form aggregation.

As shown in fig. 6, by natural mating, wherein No. 5 pig pregnancies, are identified by PCR, wherein 3 small for positive F1 Pig, by Western Blot identifications it can be seen that it expresses the Htt albumen of mutation.

The huntingtin gene of mutation knock in pig can stablize heredity to F1 generation and stablize show mutation protein expression and Behaviouristics changes, and thus explanation is a successful model.

Each technical characteristic of embodiment described above can be combined arbitrarily, to make description succinct, not to above-mentioned reality Apply all possible combination of each technical characteristic in example to be all described, as long as however, the combination of these technical characteristics is not deposited In contradiction, the scope that this specification is recorded all is considered to be.

Embodiment described above only expresses the several embodiments of the present invention, its description is more specific and detailed, but simultaneously Cannot therefore it be construed as limiting the scope of the patent.It should be pointed out that come for those of ordinary skill in the art Say, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to the protection of the present invention Scope.Therefore, the protection domain of patent of the present invention should be determined by the appended claims.

Sequence table

<110>Ji'nan University

Chinese Academy of Sciences Guangzhou Institute of Biomedicine and Health

<120>Human Huntington gene knock-in recombinant vector and its construction method and the application in swine model structure

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 17

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 1

gcaccgaccg tgagtgc 17

<210> 2

<211> 17

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 2

gcggtgacgt catgcct 17

<210> 3

<211> 25

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

acgaattctg catgaaggct ggcat 25

<210> 4

<211> 24

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

ttggtaccct cccgcagcat atgg 24

<210> 5

<211> 32

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

ggagagctgg gagagaatgc cagtgtgaca gt 32

<210> 6

<211> 28

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

gcggctgagg cagcagcggc tgtgcctg 28

<210> 7

<211> 37

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

gagccgctgc accgaccgtg agtgcgggcc ccctgca 37

<210> 8

<211> 37

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

gcggggcagc ggtgacgtca tgcctcgggg cgggggc 37

<210> 9

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 9

atagcaccga ccgtgagtgc gt 22

<210> 10

<211> 23

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

taaaacgcac tcacggtcgg tgc 23

<210> 11

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 11

atagcggtga cgtcatgcct gt 22

<210> 12

<211> 25

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 12

taaaacacag gcatgacgtc accgc 25

<210> 13

<211> 665

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 13

ccatggcgac cctggaaaag ctgatgaagg ccttcgagtc cctcaagtcc ttccagcagc 60

agcagcagca gcagcagcag cagcagcagc agcagcagca gcagcagcag cagcagcagc 120

agcagcagca gcagcagcag cagcagcagc agcagcagca gcagcagcag cagcagcagc 180

agcagcagca gcagcagcag cagcagcagc agcagcagca gcagcagcag cagcagcagc 240

agcagcagca gcagcagcag cagcagcagc agcagcagca gcagcagcag cagcagcagc 300

agcagcagca gcagcagcag cagcagcagc agcagcagca gcagcagcag cagcagcagc 360

agcagcagca gcagcagcag cagcagcagc agcagcagca gcagcagcag cagcagcagc 420

agcagcagca gcagcagcag cagcagcagc agcagcagca gcagcagcag cagcagcagc 480

agcagcagca gcagcagcaa cagccgccac cgccgccgcc gccgccgccg cctcctcagc 540

ttcctcagcc gccgccgcag gcacagccgc tgctgcctca gccgcagccg cccccgccgc 600

cgcccccgcc gccacccggc ccggctgtgg ctgaggagcc gctgcaccga ccgtgagttt 660

gggcc 665

Claims

1. a kind of recombinant vector of human Huntington gene knock-in, it is characterised in that inserted with knocking in piece in the recombinant vector Section, the fragment of knocking in include the huntingtin gene fragment of people's mutation and respectively positioned at the huntingtin gene piece of people mutation The homology arm homologous with the huntingtin gene of miniature pig of the upstream and downstream of section, the huntingtin gene fragment of people's mutation are The sequence fragment that CAG repetitive sequences are mutated in the First Exon of gene containing human Huntington.

2. the construction method of the recombinant vector of human Huntington gene knock-in as claimed in claim 1, it is characterised in that described The quantity of CAG repetitive sequences in the huntingtin gene fragment of people's mutation is preferably 150 more than 36, and more preferably people is mutated Huntingtin gene fragment sequence as shown in SEQ ID No.13.

3. a kind of construction method of recombinant vector as claimed in claim 1 or 2, it is characterised in that include the following steps：Structure The huntingtin gene fragment of the mutation containing someone knocks in fragment, and the huntingtin gene fragment of people's mutation is base containing human Huntington Because of the sequence fragment that CAG repetitive sequences are mutated in First Exon, and knocked at this in fragment, the Huntingdon base of people's mutation Because the upstream and downstream of fragment is connected to the homology arm homologous with the huntingtin gene of miniature pig, the fragment of knocking in is connected It is connected on carrier, obtains the recombinant vector.

4. the construction method of recombinant vector as claimed in claim 3, it is characterised in that described to be connected to the fragment of knocking in Following steps are further included on carrier：Drawn using DNA fragmentation of the sequence as shown in SEQ ID No.3 and SEQ ID No.4 as upstream and downstream Thing, two homology arms of miniature pig are obtained and in two homology arms using the genomic DNA of miniature pig as template amplification Between pig huntingtin gene First Exon fragment, which is connected to after EcoRI and KpnI digestions through in same Made from enzyme cutting cutting on pBluescript KS (-) carrier, pBS-HD plasmids, the Huntingdon for being then mutated the people are formed Genetic fragment is inserted into the middle of two homology arms and replaces pig huntingtin gene First Exon fragment, obtains pBS-HD-KI weights Group carrier.

5. the construction method of recombinant vector as claimed in claim 4, it is characterised in that the Huntingdon for being mutated the people The middle pig huntingtin gene First Exon fragment of replacing that genetic fragment is inserted into two homology arms includes the following steps：

Using the huntingtin gene fragment of people's mutation as masterplate, and NcoI and ApaI restriction enzyme sites are designed at its both ends, PCR amplification goes out It is connected with the huntingtin gene fragment of people's mutation of restriction enzyme site；

PBS-HD plasmids and the huntingtin gene fragment for the people's mutation for being connected to restriction enzyme site are subjected to the double enzymes of NcoI and ApaI respectively Cut；

The huntingtin gene fragment that people is mutated is connected in pBS-HD plasmids using T4DNA ligases, obtains the pBS-HD- KI recombinant vectors.

6. a kind of construction method of the reconstructed eggs of human Huntington gene knock-in swine model, it is characterised in that include the following steps：

Step 1：Meet G (N) for the intron sequences after the First Exon of the huntingtin gene of miniature pig₁₆NGG sequence moulds The positive strand sequence part of formula separately designs the knowledge of sgRNA of two sequences respectively as shown in SEQ ID No.1 and SEQ ID No.2 Other sequence, is denoted as the first sgRNA identification sequences and the 2nd sgRNA identification sequences, the first sgRNA identification sequences and institute respectively State the 2nd sgRNA identification sequence with corresponding introne positive strand sequence G (N)₁₆Unanimously, N A, T, C or G, subscript 16 represent N's Number；

Step 2：Identify that sequence and the 2nd sgRNA identify sequence design complementary series to the first sgRNA respectively, described the One sgRNA identifies sequence and its complementary series forms the first double-stranded DNA, the 2nd sgRNA identification sequences and its complementary series Form the second double-stranded DNA；

Step 3：SgRNA transcription vectors are designed according to first double-stranded DNA and second double-stranded DNA respectively, are denoted as first SgRNA carriers and the 2nd sgRNA carriers, wherein, contain first double-stranded DNA in the first sgRNA carriers, described second Contain second double-stranded DNA in sgRNA carriers；

Step 4：By the first sgRNA carriers, the 2nd sgRNA carriers, donor vehicle and carrier containing Cas9 notch enzyme genes The fibroblast of cotransfection miniature pig, filters out the positive monocytes clone of human Huntington gene knock-in, the donor vehicle Such as right is used for the recombinant vector of human Huntington gene knock-in as claimed in claim 1 or 2, or the donor vehicle It is required that the construction method of the recombinant vector any one of 3~5 builds to obtain；

Step 5：By the positive monocytes Clone Digestion into individual cells, it is injected into the enucleation oocyte of miniature pig, shape Into reconstructed eggs.

7. the construction method of the reconstructed eggs of human Huntington gene knock-in swine model as claimed in claim 6, it is characterised in that In the step 3, the first sgRNA carriers and the 2nd sgRNA carriers are the transcription vector that U6 promoters start.

8. the construction method of the reconstructed eggs of the human Huntington gene knock-in swine model as any one of claim 6~7, its It is characterized in that, in the step 4, the cotransfection is the method using electrotransfection, the parameter of electrotransfection：1400V、10ms、 1pulse。

9. the construction method of the reconstructed eggs of the human Huntington gene knock-in swine model as any one of claim 6~7, its It is characterized in that, in the step 4, the fibroblast of the miniature pig after cotransfection is that culture is being 25 μ added with concentration In the ascorbic culture medium of g/ml.

A kind of 10. structure side of the reconstructed eggs of human Huntington gene knock-in swine model as any one of claim 6~9 The reconstructed eggs that method is built.

11. a kind of people's gene knocks in the construction method of swine model, it is characterised in that includes the following steps：

According to the construction method structure of the reconstructed eggs of the human Huntington gene knock-in swine model any one of claim 6~9 Build reconstructed eggs；

By the reconstructed eggs of the activation as in the fallopian tubal of replace-conceive sow, or the reconstructed eggs of the activation are carried out in vitro Culture, forms reconstructed embryo, then the reconstructed embryo is transplanted to the intrauterine of replace-conceive sow again；

12. the construction method of human Huntington gene knock-in swine model as claimed in claim 11, it is characterised in that described to institute State reconstructed eggs and carry out cell fusion and activation, the reconstructed eggs activated, specifically comprise the following steps：

The reconstructed eggs are transferred to fusion liquid activation liquid to be balanced, the reconstructed eggs balanced are moved into converged container, gently Gently stir reconstructed eggs, make the contact surface of egg mother cell and the cell of injection parallel to two strip electrodes, between two strip electrodes at intervals of 1mm, then carries out electric pulse stimulation, and electrofusion parameter is：120volts/mm, 30 μ s, 2 times；