CN110218786A - Specific primer and its application for constipation risk profile - Google Patents
Specific primer and its application for constipation risk profile Download PDFInfo
- Publication number
- CN110218786A CN110218786A CN201910617698.4A CN201910617698A CN110218786A CN 110218786 A CN110218786 A CN 110218786A CN 201910617698 A CN201910617698 A CN 201910617698A CN 110218786 A CN110218786 A CN 110218786A
- Authority
- CN
- China
- Prior art keywords
- primer
- constipation
- bla
- bac
- cop
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses specific primer and its application for constipation risk profile, and the method for design of primers of the present invention is as follows: the whole genome sequence of Bacteroides, secondary Bacteroides, Coprecoccus, labor spy Bordetella, shiga's category bacterial strain is obtained by NCBI；The genome of each bacterial strain is divided into the segment of several 50KB, the corresponding specific gene segment belonged to is looked in primer blast, the design primer on Clone Manager, the specific strain that primer pair through the invention preferably can be enriched with flora to constipation crowd identifies, primer of the invention can be expanded for the genetic fragment of annotated genetic fragment and unknown function, the specific gene segment on other corresponding strains of this kind of Pseudomonas can be amplified, effectively increase detection accuracy, convenient for improving the prediction accuracy of clinic population's constipation forecasting risk.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to specific primer and its application for constipation risk profile.
Background technique
The research identified at present for species in microbiologic population concentrates on both direction: first is that with conservative ribosomes base
Because sequence (such as: 16S, ITS sequence) is goal in research, from the composition of integral level Shang Kan microbiologic population；Second is that with single object
Kind microorganism is goal in research, is related to by isolating and purifying, morphology and molecular biology identification, or passes through the macro base of de novo
Because a group means for sequencing interpret the genomic information of species.In short, the former only determines object by conserved sequence
Kind information is clearly inaccuracy, and the experimental implementation of the latter is both cumbersome expensive, and it is numerous micro- to be not suitable for mass simultaneous research
Biological species.
Specifically from quantitatively, have been able to now be with ribosomal gene such as 16S rRNA/ITS expand main body door,
Specific primer designs such as guiding principle and biological community structure for corresponding classification level quantifies.But it is special by designing
Property primer and the quantitative method of qPCR be difficult to realize guiding principle or less classify level microbiologic population it is quantitative.With high-flux sequence at
This reduction, high-flux sequence can solve this problem to a certain extent, now can by 16S rRNA high-flux sequence
Quickly and economical to realize quantifying for each species composition and content in microbiologic population.But, read long by high-flux sequence
Limitation, high-flux sequence can not achieve the sequencing of 16S rRNA full length gene, so category can only also be navigated to single sequence, and
Kind cannot be navigated to, this is also to be limited by the conservative of conserved sequence inherently.From the point of view of another angle, at present
Species with full-length genome information increase year by year, and many people attempt have the complete of microorganism using bioinformatics means analysis
Genomic information finds out its species specificity sequence, attempts through design probe, specially primer etc. is used for subsequent species specificity
Parsing.But these primers need often to update, because the genome sequence with more and more microorganisms is measured, in the past
The species specificity sequence thought is likely to lose its specificity, needs periodically to redesign.
For microbiologic population's molecular biology research angle, microbe research experienced by isolation and purification culture and
The Senile Mouse epoch of Morphological Identification, at present using microbial gene as the molecule epoch of goal in research.In molecular studies side
It can be divided into method and be sequenced with the generation that ribosomal library clone (such as TA clone) and Sanger sequencing are representative, with Illumina
Miseq is the two generations sequencing of representative and newest third generation high-flux sequence.TA cloning and sequencing sample size is not big enough, expense
Also not counting it is cheap, but the almost overall length of ribosomal gene may be implemented in its sequencing length, can relatively accurately determine complicated bacterium
A collection of strain in group, then according to these, more accurately species information is measured multiple species.
Constipation is one of common function of intestinal canal imbalance, and constipation shows as defecating, and stiff, times of defecation is few, difficult defecation etc.
The problems such as symptom, constipation may induce Cardial or cerebral vascular diseases, cause sexual life obstacle, dysmenorrhea, urinary tract infections simultaneously, serious shadow
Ring quality of life.
People have carried out certain research to the relationship before intestinal flora and constipation, such as:
Investigation [J] clinic medical officer's magazine of Bi Hongling, Zhang Guilan, He Qiang constipation patient intestinal flora, 2003,31 (3):
82-84. is by viable bacteria quantitative culture counting method, the dynamic observation changing rule of 58 constipation patient faecal microbiotas, and with 56
Example Healthy People compares.As a result healthy control group Bifidobacterium, bacteroid, Bacillus acidi lactici, Fusobacterium, enterobacteria, every gram of enterococcus
Viable count in excrement is respectively: 9.88 ± 0.68,9.02 ± 0.52,8.35 ± 1.21,5.52 ± 1.60,7.82 ± 2.12,
7.42 ± 2.42, the above-mentioned each viable count of constipation group is successively are as follows: 6.96 ± 0.74,7.03 ± 0.68,7.31 ± 1.32,7.68 ±
1.42,8.71 ± 1.02,7.29 ± 2.01.Two groups are compared, and the Bifidobacterium, bacteroid in constipation group excrement reduce very aobvious
It writes (P < 0.01)；Bacillus acidi lactici reduces significant (P < 0.05)；Fusobacterium increases highly significant (P < 0.01)；Enterobacteria increases
Significantly (P < 0.05), B/E value lower highly significant (P < 0.01).The microecological balance of conclusion constipation patient's intestinal flora by
It destroys, is mainly manifested in the probiotics quantity based on Bifidobacterium and substantially reduces, the conditioned pathogens quantity such as clostridium septicum is aobvious
Work increases.
Wang Lin, Jiang Jun, Ding Weiwei wait variation characteristic [J] of intractable constipation patient's colonic mucosa flora parenteral and intestines
Interior nutrition, 2014,21 (1): 12-15. obtains sigmoid mucosa sample by Sigmoidoscope biopsy, DNA is extracted, after PCR amplification
Row denaturing gradient gel electrophoresis, applied molecular biology analyze software to the similitude, principal component and diversity of Bacterial community into
Row analysis.As a result: intractable constipation patient's colonic mucosa flora is substantially change, with control group ratio, intractable constipation patient knot
Intestinal mucosa flora species richness and Shannon diversity index significantly reduce (P < 0.01).Conclusion: intractable constipation patient knot
Intestinal mucosa Flora Disturbance shows as the reduction of colonic mucosa bacterial diversity.
Zhao Xianping, Xiao Xinyun, Cai Rui wait constipation correlation enteric microorganism progress [J] China microecology magazine,
2014,26 (10): 1236-1240. is reviewed the progress of constipation correlation enteric microorganism, it is believed that constipation causes intestines
Road Tiny ecosystem changes, and main probiotics type and number are reduced, and harmful bacteria or conditioned pathogen dramatically increase.Specific manifestation
It is dramatically increased for aerobic bacteria, fungi, escherichia coli etc., anaerobic bacteria, bacteroid and Bifidobacterium etc. substantially reduce.
More and more evidences show what the generation of constipation occurred with the change of microorganism there is close relationship, constipation
Patient, microorganism are lacked of proper care, therefore the variation of flora may be as the intervention target spot of lesion before constipation or constipation.
Such as micropopulation application No. is the patent disclosure of CN201811136119.6 for constipation risk profile and application,
It specifically discloses the various mushrooms in constipation crowd, the primer designed by 16s sequencing approach, detects constipation people with this
The corresponding Pseudomonas of group's enrichment flora, but this mode detection accuracy is lower, and other in corresponding Pseudomonas can not be amplified
Strain is detected by great limitation.
Summary of the invention
In response to the problems existing in the prior art, the purpose of the present invention is to provide the specific primers for constipation risk profile
And its application.
To achieve the above object, the technical solution adopted by the present invention is that:
For the specific primer of constipation risk profile, respectively can to Bacteroides, secondary Bacteroides, Coprecoccus,
Labor spy Bordetella, shiga belong to bacterial strain on specific gene segment expand, obtain its correspond to it is multiple in Pseudomonas of the same race
The shared specific gene segment of strain, the specific gene segment include the gene piece for annotating genetic fragment and unknown function
Section, the specific primer includes following five groups:
(1) BAC-1F=5'CTTACCTGCCTTGTCCTGGG 3'；TM=60.04
BAC-1R=5'TACCGTTGGACCGTTCAGTG 3'；TM=59.97 primer size 355bp, such as sequence table SEQ
Shown in ID NO.1-2；
BAC-2F=5'CCCTCACGGTACTGGTTCAC 3'；TM=60.04
BAC-2R=5'TTGTTGGAGGCTAACGCAGG 3'；TM=60.61 primer size 342bp, such as sequence table SEQ
Shown in ID NO.3-4；
BAC-3F=5'GTTCGCTATCGGTCTCTCGG 3'；TM=60.04
BAC-3R=5'TTGTTGGAGGCTAACGCAGG 3'；TM=60.61 primer size 328bp, such as sequence table SEQ
Shown in ID NO.5-6；
(2) PAR-1F=5'GGTGGCGCATTTGAAAGACC 3'；TM=60.39
PAR-1R=5'GTCTGCCATGTTGGCACTTG 3'；TM=60.04 primer size 775bp, such as sequence table SEQ
Shown in ID NO.7-8；
PAR-2F=5'AGCCAGCTCGACCTGTAATG 3'；TM=59.82
PAR-2R=5'CGAGCCGATAGGTCTGGTTC 3'；TM=59.97 primer size 819bp, such as sequence table SEQ
Shown in ID NO.9-10；
PAR-3F=5'CCCCAAAGCATACCTTTGAACC 3'TM=59.77
PAR-3R=5'GTATGTGGGAGCTGGGAGTG 3'；TM=59.82 primer size 777bp, such as sequence table SEQ
Shown in ID NO.11-12；
(3) COP-1F=5'GCTCAATGCTCGAAGCAAAGTC 3'；TM=60.73
COP-1R=5'GGCACATAAGCTCGGCATTC 3'；TM=59.69 primer size 604bp, such as sequence table SEQ
Shown in ID NO.13-14；
COP-2F=5'GGACTGATGCAGGGCTGAG 3'；TM=60.15
COP-2R=5'ATGGTCAAGGGATGCACAGG 3'；TM=60.03 primer size 797bp, such as sequence table SEQ
Shown in ID NO.15-16；
COP-3F=5'GTTGATTTATCGGCGGGTGC 3'；TM=59.97
COP-3R=5'GCTTTCACTACATGTTCCGGC 3'；TM=59.87 primer size 730bp, such as sequence table SEQ
Shown in ID NO.17-18；
(4) BLA-1F=5'ATGGCAGAAACAACCAACGC 3'；TM=59.97
BLA-1R=5'CAGCATACGCTTCTCGTTGC 3'；TM=59.97 primer size 891bp, such as sequence table SEQ
Shown in ID NO.19-20；
BLA-2F=5'CATCACGTCTTCCCATTGCAC 3'；TM=59.87
BLA-2R=5'AGGGCCAGAGTCAGTAGGAG 3'；TM=60.03 primer size 866bp, such as sequence table SEQ
Shown in ID NO.21-22；
BLA-3F=5'TGTATGGCTGCTTCTGAGCC 3'；TM=60.11
BLA-3R=5'ACGTGAAAGCAGAGCTGACTG 3'；TM=60.87 primer size 742bp, such as sequence table SEQ
Shown in ID NO.23-24；
(5) SHI-1F=5'GCACCTGGGAAGAAAAAGGC 3'；TM=59.68
SHI-1R=5'TCCGCGTACTCACACAGTTC 3'；TM=60.04 primer size 914bp, such as sequence table SEQ
Shown in ID NO.25-26；
SHI-2F=5'ATCGTTGCGCAGTAATTGGC 3'；TM=59.90
SHI-2R=5'TCGGCATCTGATACGTCTGC 3'；TM=59.97 primer size 985bp, such as sequence table SEQ
Shown in ID NO.27-28；
SHI-3F=5'ATCGCCTGATGCAGATCCAG 3'；TM=59.96
SHI-3R=5'AATTCTCAGGAGAACCCCGC 3'TM=59.75 primer size 859bp, such as sequence table SEQ
Shown in ID NO.29-30；
The primer pair and related reagent that the present invention designs can be assembled into kit, with convenient to use.As needed
The state that the primer can be lyophilized form or be dissolved in buffer, the kit may include for PCR reaction one kind or
A variety of enzyme/reagents, and implement other compositions and apparatus required for the present invention.
The method of present invention prediction constipation risk are as follows: flora sample total DNA is enriched with as template using constipation crowd, utilizes this hair
Bright each primer pair carries out PCR amplification respectively, determines result according to agarose gel electrophoresis after reaction.
The response procedures of its PCR amplification are as follows: 94 DEG C of initial denaturation, 5min, then through 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72
DEG C extend 50s, 35 circulation, last 72 DEG C of extensions 10min.
Above-mentioned pcr amplification reaction system, the wherein concrete configuration of 20ul reaction solution are as follows:
The method of design of primers of the present invention is as follows: obtaining Bacteroides, secondary Bacteroides, Coprecoccus, labor by NCBI
Special Bordetella, shiga belong to the whole genome sequence of bacterial strain；The genome of each bacterial strain is divided into the segment of several 50KB,
Primer blast looks for the corresponding specific fragment belonged to, the design primer on Clone Manager, wherein the setting amplification of (1) group
Primer size is followed successively by 355bp, 342bp, 328bp, and (2) group setting amplified production size is followed successively by 775bp, 819bp, 777bp,
(3) group setting amplified production size is followed successively by 604bp, 797bp, 730bp, and (4) group setting amplified production size is followed successively by
891bp, 866bp, 742bp, (5) group setting amplified production size are followed successively by 914bp, 985bp, 859bp.
Compared with prior art, the beneficial effects of the present invention are:
The specific strain that primer pair through the invention preferably can be enriched with flora to constipation crowd identifies, this hair
Bright primer can be expanded for the genetic fragment of annotated genetic fragment and unknown function, can amplify this kind
Specific fragment on other corresponding strains of Pseudomonas, effectively increases detection accuracy, pre- convenient for improving clinic population's constipation
Survey the prediction accuracy of risk.
Detailed description of the invention
Fig. 1 is that the corresponding primer of each bacterial strain of the present invention distinguishes the product of four fecal samples of electrophoresis detection as a result, wherein four
The sequence from left to right of a fecal sample is BNQ, DXH, LM, YXX；In Fig. 1: the pair of primers of the Bacteroides of 1-4；
Second pair of primer of the Bacteroides of 5-8；The third of the Bacteroides of 9-12 is to primer；The secondary Bacteroides of 14-17
Pair of primers；Second pair of primer of the secondary Bacteroides of 18-21；The third of the secondary Bacteroides of 22-25 is to primer；
The pair of primers of the Coprecoccus of 26-29；Second pair of primer of the Coprecoccus of 30-33；The Coprecoccus of 34-37
Third to primer；The pair of primers of the labor spy Bordetella of 38-41；Second pair of primer of the labor spy Bordetella of 42-45；
The third of the labor spy Bordetella of 46-49 is to primer；The pair of primers of the Shigella of 50-53；The will of 54-57 is congratulated
Second pair of primer of Bordetella；The third of 58-61 Shigella is to primer.
Fig. 2-Fig. 6 is respectively Bacteroides, Coprecoccus, shiga's category Pseudomonas, labor spy Bordetella, secondary Bacteroides treatment
The abundance figure of front and back, wherein before Q is treatment, H is the sample after treatment.
Specific embodiment
Below in conjunction with the attached drawing in the present invention, technical solution of the present invention is clearly and completely described, it is clear that
Described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.Based on the implementation in the present invention
Example, those of ordinary skill in the art's all other embodiment obtained under the conditions of not making creative work belong to
The scope of protection of the invention.
Bacterial strain uses therefor of the present invention are as follows: Bacteroides (YCH46, A1C1, ATCC8482), secondary Bacteroides (ATCC 8503,
CT06), Coprecoccus (GD, ART55), labor spy Bordetella (N6H1-15, YL58, SC05B48), shiga belong to bacterial strain (Sb227,
str301、PAMC 28760)。
Embodiment 1: the design of specific primer
First NCBI finds Bacteroides, secondary Bacteroides, Coprecoccus, labor spy Bordetella, shiga belong to bacterial strain
The gene order of each bacterial strain is divided into the segment of several 50KB by whole genome sequence respectively, looks for correspondence in primer blast
The specific gene segment of category, the design primer on Clone Manager；
Wherein: the primer sequence of Bacteroides design are as follows:
(1) BAC-1F=5'CTTACCTGCCTTGTCCTGGG 3'；TM=60.04
BAC-1R=5'TACCGTTGGACCGTTCAGTG 3'；TM=59.97 primer size 355bp, such as sequence table SEQ
Shown in ID NO.1-2；
BAC-2F=5'CCCTCACGGTACTGGTTCAC 3'；TM=60.04
BAC-2R=5'TTGTTGGAGGCTAACGCAGG 3'；TM=60.61 primer size 342bp, such as sequence table SEQ
Shown in ID NO.3-4；
BAC-3F=5'GTTCGCTATCGGTCTCTCGG 3'；TM=60.04
BAC-3R=5'TTGTTGGAGGCTAACGCAGG 3'；TM=60.61 primer size 328bp, such as sequence table SEQ
Shown in ID NO.5-6；
The primer sequence of secondary Bacteroides design is as follows:
(2) PAR-1F=5'GGTGGCGCATTTGAAAGACC 3'；TM=60.39
PAR-1R=5'GTCTGCCATGTTGGCACTTG 3'；TM=60.04 primer size 775bp, such as sequence table SEQ
Shown in ID NO.7-8；
PAR-2F=5'AGCCAGCTCGACCTGTAATG 3'；TM=59.82
PAR-2R=5'CGAGCCGATAGGTCTGGTTC 3'；TM=59.97 primer size 819bp, such as sequence table SEQ
Shown in ID NO.9-10；
PAR-3F=5'CCCCAAAGCATACCTTTGAACC 3'TM=59.77
PAR-3R=5'GTATGTGGGAGCTGGGAGTG 3'；TM=59.82 primer size 777bp, such as sequence table SEQ
Shown in ID NO.11-12；
The primer of Coprecoccus design is as follows:
(3) COP-1F=5'GCTCAATGCTCGAAGCAAAGTC 3'；TM=60.73
COP-1R=5'GGCACATAAGCTCGGCATTC 3'；TM=59.69 primer size 604bp, such as sequence table SEQ
Shown in ID NO.13-14；
COP-2F=5'GGACTGATGCAGGGCTGAG 3'；TM=60.15
COP-2R=5'ATGGTCAAGGGATGCACAGG 3'；TM=60.03 primer size 797bp, such as sequence table SEQ
Shown in ID NO.15-16；
COP-3F=5'GTTGATTTATCGGCGGGTGC 3'；TM=59.97
COP-3R=5'GCTTTCACTACATGTTCCGGC 3'；TM=59.87 primer size 730bp, such as sequence table SEQ
Shown in ID NO.17-18；
The primer of labor spy Bordetella design is as follows:
(4) BLA-1F=5'ATGGCAGAAACAACCAACGC 3'；TM=59.97
BLA-1R=5'CAGCATACGCTTCTCGTTGC 3'；TM=59.97 primer size 891bp, such as sequence table SEQ
Shown in ID NO.19-20；
BLA-2F=5'CATCACGTCTTCCCATTGCAC 3'；TM=59.87
BLA-2R=5'AGGGCCAGAGTCAGTAGGAG 3'；TM=60.03 primer size 866bp, such as sequence table SEQ
Shown in ID NO.21-22；
BLA-3F=5'TGTATGGCTGCTTCTGAGCC 3'；TM=60.11
BLA-3R=5'ACGTGAAAGCAGAGCTGACTG 3'；TM=60.87 primer size 742bp, such as sequence table SEQ
Shown in ID NO.23-24；
The primer that shiga belongs to design is as follows:
(5) SHI-1F=5'GCACCTGGGAAGAAAAAGGC 3'；TM=59.68
SHI-1R=5'TCCGCGTACTCACACAGTTC 3'；TM=60.04 primer size 914bp, such as sequence table SEQ
Shown in ID NO.25-26；
SHI-2F=5'ATCGTTGCGCAGTAATTGGC 3'；TM=59.90
SHI-2R=5'TCGGCATCTGATACGTCTGC 3'；TM=59.97 primer size 985bp, such as sequence table SEQ
Shown in ID NO.27-28；
SHI-3F=5'ATCGCCTGATGCAGATCCAG 3'；TM=59.96
SHI-3R=5'AATTCTCAGGAGAACCCCGC 3'TM=59.75 primer size 859bp, such as sequence table SEQ
Shown in ID NO.29-30；
The foundation of embodiment 2:PCR amplification method
PCR reaction system is enriched with flora total DNA as template using constipation crowd, carries out PCR reaction, wherein 20ul reaction solution
Concrete configuration are as follows:
Reaction condition are as follows: 94 DEG C of initial denaturation, 5min, then through 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 50s, 35
A circulation, last 72 DEG C of extensions 10min.
Three pairs of primer pairs of above-mentioned each Pseudomonas design are expanded respectively with four sample DNAs, and four samples are followed successively by
BNQ,DXH,LM,YXX；Sample DNA uses Universal Genomic DNA Kit kit to extract (health is century)；
Amplified production determines by agarose gel electrophoresis as a result, electrophoresis detection result is as shown in Figure 1 after reaction.
Embodiment 2: prediction constipation risk
Prediction technique: being detected by 16S sequencing approach and analyzes the abundance of corresponding Pseudomonas in patient groups' fecal sample,
The software that middle 16S sequencing analysis uses analyzes prediction constipation risk, tool by Pseudomonas abundance changes of contents result for QIIME2
Body testing result such as the following table 1
Pretherapy and post-treatment Pseudomonas content results in the corresponding fecal sample of 1 constipation crowd of table
Above table data come from 15 constipation patient samples, and before wherein Q is treatment, H is the sample after treatment, each strain
As shown in figures 2-6, treatment method is conventional hydrotherapy or clinical drug therapy to pretherapy and post-treatment abundance, is not influenced of the invention
Final result, in conjunction with mass data and the above test data analyzer, it has been found that after relatively treatment before deceased subject's treatment
Occur two or more Pseudomonas contents reduction when, suffer from slight constipation, when deceased subject treatment before relatively treat after occur two kinds with
When lower Pseudomonas content reduces, then intractable constipation is suffered from, thus we are it is expected that go detection subject by our primer
Fecal sample the subject can be predicted with slight constipation when detecting two or more Pseudomonas, when detecting four kinds of Pseudomonas
When above, risk of the subject with stubborn disease is high.
It although an embodiment of the present invention has been shown and described, for the ordinary skill in the art, can be with
A variety of variations, modification, replacement can be carried out to these embodiments without departing from the principles and spirit of the present invention by understanding
And modification, the scope of the present invention is defined by the appended.
SEQUENCE LISTING
<110>Wuhan pony gallops medical science and technology Co., Ltd
<120>for the specific primer of constipation risk profile and its application
<130> 1
<160> 30
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213>artificial synthesized
<400> 1
cttacctgcc ttgtcctggg 20
<210> 2
<211> 20
<212> DNA
<213>artificial synthesized
<400> 2
taccgttgga ccgttcagtg 20
<210> 3
<211> 20
<212> DNA
<213>artificial synthesized
<400> 3
ccctcacggt actggttcac 20
<210> 4
<211> 20
<212> DNA
<213>artificial synthesized
<400> 4
ttgttggagg ctaacgcagg 20
<210> 5
<211> 20
<212> DNA
<213>artificial synthesized
<400> 5
gttcgctatc ggtctctcgg 20
<210> 6
<211> 20
<212> DNA
<213>artificial synthesized
<400> 6
ttgttggagg ctaacgcagg 20
<210> 7
<211> 20
<212> DNA
<213>artificial synthesized
<400> 7
ggtggcgcat ttgaaagacc 20
<210> 8
<211> 20
<212> DNA
<213>artificial synthesized
<400> 8
gtctgccatg ttggcacttg 20
<210> 9
<211> 20
<212> DNA
<213>artificial synthesized
<400> 9
agccagctcg acctgtaatg 20
<210> 10
<211> 20
<212> DNA
<213>artificial synthesized
<400> 10
cgagccgata ggtctggttc 20
<210> 11
<211> 22
<212> DNA
<213>artificial synthesized
<400> 11
ccccaaagca tacctttgaa cc 22
<210> 12
<211> 20
<212> DNA
<213>artificial synthesized
<400> 12
gtatgtggga gctgggagtg 20
<210> 13
<211> 22
<212> DNA
<213>artificial synthesized
<400> 13
gctcaatgct cgaagcaaag tc 22
<210> 14
<211> 20
<212> DNA
<213>artificial synthesized
<400> 14
ggcacataag ctcggcattc 20
<210> 15
<211> 19
<212> DNA
<213>artificial synthesized
<400> 15
ggactgatgc agggctgag 19
<210> 16
<211> 20
<212> DNA
<213>artificial synthesized
<400> 16
atggtcaagg gatgcacagg 20
<210> 17
<211> 20
<212> DNA
<213>artificial synthesized
<400> 17
gttgatttat cggcgggtgc 20
<210> 18
<211> 21
<212> DNA
<213>artificial synthesized
<400> 18
gctttcacta catgttccgg c 21
<210> 19
<211> 20
<212> DNA
<213>artificial synthesized
<400> 19
atggcagaaa caaccaacgc 20
<210> 20
<211> 20
<212> DNA
<213>artificial synthesized
<400> 20
cagcatacgc ttctcgttgc 20
<210> 21
<211> 21
<212> DNA
<213>artificial synthesized
<400> 21
catcacgtct tcccattgca c 21
<210> 22
<211> 20
<212> DNA
<213>artificial synthesized
<400> 22
agggccagag tcagtaggag 20
<210> 23
<211> 20
<212> DNA
<213>artificial synthesized
<400> 23
tgtatggctg cttctgagcc 20
<210> 24
<211> 21
<212> DNA
<213>artificial synthesized
<400> 24
acgtgaaagc agagctgact g 21
<210> 25
<211> 20
<212> DNA
<213>artificial synthesized
<400> 25
gcacctggga agaaaaaggc 20
<210> 26
<211> 20
<212> DNA
<213>artificial synthesized
<400> 26
tccgcgtact cacacagttc 20
<210> 27
<211> 20
<212> DNA
<213>artificial synthesized
<400> 27
atcgttgcgc agtaattggc 20
<210> 28
<211> 20
<212> DNA
<213>artificial synthesized
<400> 28
tcggcatctg atacgtctgc 20
<210> 29
<211> 20
<212> DNA
<213>artificial synthesized
<400> 29
atcgcctgat gcagatccag 20
<210> 30
<211> 20
<212> DNA
<213>artificial synthesized
<400> 30
aattctcagg agaaccccgc 20
Claims (7)
1. being used for the specific primer of constipation risk profile, which is characterized in that its respectively can to Bacteroides, secondary Bacteroides,
The specific gene segment that Coprecoccus, labor spy Bordetella, shiga belong on bacterial strain expands, and obtains it and corresponds to Pseudomonas of the same race
In the shared specific gene segment of multiple strains, the specific gene segment includes annotation genetic fragment and unknown function
Genetic fragment, the specific primer includes following five groups:
(1) BAC-1F=5'CTTACCTGCCTTGTCCTGGG3'；
BAC-1R=5'TACCGTTGGACCGTTCAGTG3'；
BAC-2F=5'CCCTCACGGTACTGGTTCAC3'；
BAC-2R=5'TTGTTGGAGGCTAACGCAGG3'；
BAC-3F=5'GTTCGCTATCGGTCTCTCGG3'；
BAC-3R=5'TTGTTGGAGGCTAACGCAGG3'；
(2) PAR-1F=5'GGTGGCGCATTTGAAAGACC3'；
PAR-1R=5'GTCTGCCATGTTGGCACTTG3'；
PAR-2F=5'AGCCAGCTCGACCTGTAATG3'；
PAR-2R=5'CGAGCCGATAGGTCTGGTTC3'；
PAR-3F=5'CCCCAAAGCATACCTTTGAACC3'
PAR-3R=5'GTATGTGGGAGCTGGGAGTG3'；
(3) COP-1F=5'GCTCAATGCTCGAAGCAAAGTC3'；
COP-1R=5'GGCACATAAGCTCGGCATTC3'；
COP-2F=5'GGACTGATGCAGGGCTGAG3'；
COP-2R=5'ATGGTCAAGGGATGCACAGG3'；
COP-3F=5'GTTGATTTATCGGCGGGTGC3'；
COP-3R=5'GCTTTCACTACATGTTCCGGC3'；
(4) BLA-1F=5'ATGGCAGAAACAACCAACGC3'；
BLA-1R=5'CAGCATACGCTTCTCGTTGC3'；
BLA-2F=5'CATCACGTCTTCCCATTGCAC3'；
BLA-2R=5'AGGGCCAGAGTCAGTAGGAG3'；
BLA-3F=5'TGTATGGCTGCTTCTGAGCC3'；
BLA-3R=5'ACGTGAAAGCAGAGCTGACTG3'；
(5) SHI-1F=5'GCACCTGGGAAGAAAAAGGC3'；
SHI-1R=5'TCCGCGTACTCACACAGTTC3'；
SHI-2F=5'ATCGTTGCGCAGTAATTGGC3'；
SHI-2R=5'TCGGCATCTGATACGTCTGC3'；
SHI-3F=5'ATCGCCTGATGCAGATCCAG3'；
SHI-3R=5'AATTCTCAGGAGAACCCCGC3'.
2. being used for the kit of constipation risk profile, which is characterized in that contain each group primer pair described in claim 1.
3. kit as claimed in claim 2, which is characterized in that it is to be enriched with flora sample total DNA as mould using constipation crowd
Plate carries out PCR amplification using each group primer pair described in claim 1, after reaction according to agarose gel electrophoresis respectively
Determine result.
4. kit as claimed in claim 2 or claim 3, which is characterized in that its operating condition are as follows: 94 DEG C of initial denaturation, 5min, then pass through
94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 50s, 35 recycle, last 72 DEG C of extensions 10min.
5. kit as claimed in claim 3, which is characterized in that the tool of the reaction system 20ul reaction solution of the PCR amplification
Body is configured that sample DNA 1ul, upstream primer 1ul, downstream primer 1ul, 2*HiffTMPCR Master MIX 10ul、ddH2O
7ul。
6. specific primer as described in claim 1, which is characterized in that the design method of the specific primer includes following
Step:
A, the full genome of Bacteroides, secondary Bacteroides, Coprecoccus, labor spy Bordetella, shiga's category bacterial strain is obtained from NCBI
Group sequence；
B, the whole genome sequence of the every kind of bacterial strain obtained in step A is divided into the segment of several 50KB, is existed according to each segment
Primer blast looks for the corresponding specific gene segment belonged to, the design primer on Clone Manager, wherein the setting of (1) group
Amplified production size is followed successively by 355bp, 342bp, 328bp, (2) group setting amplified production size be followed successively by 775bp, 819bp,
777bp, (3) group setting amplified production size are followed successively by 604bp, 797bp, 730bp, and (4) group setting amplified production size is successively
For 891bp, 866bp, 742bp, (5) group setting amplified production size is followed successively by 914bp, 985bp, 859bp.
7. primer described in claim 1 is in preparation for the application in constipation risk profile kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910617698.4A CN110218786A (en) | 2019-07-10 | 2019-07-10 | Specific primer and its application for constipation risk profile |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910617698.4A CN110218786A (en) | 2019-07-10 | 2019-07-10 | Specific primer and its application for constipation risk profile |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110218786A true CN110218786A (en) | 2019-09-10 |
Family
ID=67813066
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910617698.4A Pending CN110218786A (en) | 2019-07-10 | 2019-07-10 | Specific primer and its application for constipation risk profile |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110218786A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114250168A (en) * | 2020-09-25 | 2022-03-29 | 陕西安宁云生生物技术有限公司 | Constipation pathogenic bacteria and application thereof |
| CN114965764A (en) * | 2022-05-18 | 2022-08-30 | 陕西安宁云生生物技术有限公司 | Diagnosis and treatment of constipation |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105937053A (en) * | 2015-12-02 | 2016-09-14 | 广州赛哲生物科技股份有限公司 | Establishment method of gene library of fecal flora based on high-throughput gene sequencing |
| US20170159108A1 (en) * | 2014-05-06 | 2017-06-08 | Is-Diagnostics Ltd. | Microbial population analysis |
| CN109182502A (en) * | 2018-09-28 | 2019-01-11 | 人和未来生物科技（长沙）有限公司 | Micropopulation and application for constipation risk profile |
| CN109652571A (en) * | 2019-01-25 | 2019-04-19 | 山东大学 | A set of fast qualitative, six kinds of enteric microorganism of quantitative detection primer sets and its application |
-
2019
- 2019-07-10 CN CN201910617698.4A patent/CN110218786A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170159108A1 (en) * | 2014-05-06 | 2017-06-08 | Is-Diagnostics Ltd. | Microbial population analysis |
| CN105937053A (en) * | 2015-12-02 | 2016-09-14 | 广州赛哲生物科技股份有限公司 | Establishment method of gene library of fecal flora based on high-throughput gene sequencing |
| CN109182502A (en) * | 2018-09-28 | 2019-01-11 | 人和未来生物科技（长沙）有限公司 | Micropopulation and application for constipation risk profile |
| CN109652571A (en) * | 2019-01-25 | 2019-04-19 | 山东大学 | A set of fast qualitative, six kinds of enteric microorganism of quantitative detection primer sets and its application |
Non-Patent Citations (1)
| Title |
|---|
| 臧凯丽等: "益生菌剂调整肠道疾病人群菌群结构丰度水平的研究", 《食品科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114250168A (en) * | 2020-09-25 | 2022-03-29 | 陕西安宁云生生物技术有限公司 | Constipation pathogenic bacteria and application thereof |
| CN114965764A (en) * | 2022-05-18 | 2022-08-30 | 陕西安宁云生生物技术有限公司 | Diagnosis and treatment of constipation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Dilhari et al. | Evaluation of the impact of six different DNA extraction methods for the representation of the microbial community associated with human chronic wound infections using a gel-based DNA profiling method | |
| Scholz et al. | A novel high-resolution single locus sequence typing scheme for mixed populations of Propionibacterium acnes in vivo | |
| CN109266766B (en) | Application of intestinal microorganisms as bile duct cell cancer diagnosis marker | |
| CN109913525B (en) | Application of vibrio butyrate in identification and/or differentiation of Han population and Tibetan population in plateau region | |
| CN110903999B (en) | Fusobacterium nucleatum animal subspecies strain separated from human intestinal tract and application thereof | |
| CN112899368B (en) | Biomarker for early diagnosis of primary hepatocellular carcinoma, detection reagent and application thereof | |
| US20190032115A1 (en) | Genetic testing for predicting resistance of gram-negative proteus against antimicrobial agents | |
| CN112538545B (en) | Application of fungus microbiome as marker in preparation of treatment screening and lung cancer diagnosis | |
| Ji et al. | Development of a one-step multiplex PCR assay for differential detection of four species (Enterobacter cloacae, Enterobacter hormaechei, Enterobacter roggenkampii, and Enterobacter kobei) belonging to Enterobacter cloacae complex with clinical significance | |
| CN107937581B (en) | Amplification primer pair for lactobacillus sequencing, lactobacillus species identification method and application | |
| CN110218786A (en) | Specific primer and its application for constipation risk profile | |
| US20110287965A1 (en) | Methods and compositions to detect clostridium difficile | |
| WO2022262491A1 (en) | Bacterial 16s rrna gene sequence-based bacterial "species" level detection and analysis method | |
| CN109182502A (en) | Micropopulation and application for constipation risk profile | |
| Kispal et al. | The local microbiome after pediatric bladder augmentation: intestinal segments and the native urinary bladder host similar mucosal microbiota | |
| Yang et al. | Rapid identification of bacterial species associated with bronchiectasis via metagenomic approach | |
| CN106011154B (en) | A kind of cause hepatapostema Klebsiella Pneumoniae molecular detection kit and its application | |
| Wiscovitch-Russo et al. | An optimized approach for processing of frozen lung and lavage samples for microbiome studies | |
| CN108866220B (en) | Method and detection kit for detecting nasal flora | |
| JP2022533269A (en) | Method for detecting rare DNA sequences in stool samples | |
| CN109652493B (en) | Use of genus oscillatoria for identifying and/or differentiating individuals of different ethnic groups | |
| CN109913526B (en) | Use of microorganisms for identifying and/or differentiating different ethnic groups of individuals | |
| JP2017189166A (en) | Method for diagnosing chronic pyoderma and diagnostic kit for chronic pyoderma | |
| Rizzo et al. | Efflux pump AdeABC assessment in acinetobacter baumannii strains isolated in a teaching hospital | |
| CN115992267B (en) | Primer group, kit and method for detecting multiple pathogenic bacteria with high flux and high precision |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190910 |
|
| RJ01 | Rejection of invention patent application after publication |