CN110218782A - A kind of kit detecting the site MTRR Gene A 66G rs1801394SNP - Google Patents
A kind of kit detecting the site MTRR Gene A 66G rs1801394SNP Download PDFInfo
- Publication number
- CN110218782A CN110218782A CN201811391649.5A CN201811391649A CN110218782A CN 110218782 A CN110218782 A CN 110218782A CN 201811391649 A CN201811391649 A CN 201811391649A CN 110218782 A CN110218782 A CN 110218782A
- Authority
- CN
- China
- Prior art keywords
- mtrr gene
- probe
- mtrr
- gene
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The purpose of the application is to disclose a kind of kit for detecting the site MTRR Gene A 66G rs1801394SNP, it is characterized in that, including the primer and probe designed according to MTRR Gene A 66G rs1801394SNP loci polymorphism, sequence is as follows: MTRR Gene A 66G forward direction amplimer: GCAGGGACAGGCAAAGG;The reversed amplimer of MTRR Gene A 66G: CTGTGGTACATGGATTTTCTGC;MTRR gene 66A probe: 5 '-AAGAAATATGTGAGCAA-3 ';MTRR gene 66G probe: 5 '-AAGAAATGTGTGAGCAA-3 ';Easy to operate, replicability is strong, and as a result accurately, good compatibility, pollution risk is small.
Description
Technical field
The invention belongs to field of water quality detection, in particular to a kind of sites detection MTRR Gene A 66G rs1801394SNP
Kit.
Background technique
Folic acid belongs to water-soluble B vitamin, plays an important role in the biosynthesis of nucleic acid and protein, is cell
The material base of proliferation and body development.China is one of high-incidence country of Newborn Birth-defects, and wherein folic acid deficiency is to lead
The main reason for causing birth defect.Body folic acid deficiency mainly has two aspect reasons: first is that folic acid insufficiency of intake, second is that gene lacks
Falling into causes body low to folic acid utilization efficiency, i.e. folate metabolism disorder.
MTRR full name methionine synthetase reductase, it is to maintain the active key enzyme of methionine synthetase, first sulphur
Propylhomoserin synzyme plays an important role in folic acid metabolism and DNA methylation.Methionine synthetase reductase can pass through reduction
Type methylation regenerates the methyl propylhomoserin synzyme with functional activity.MTRR gene mutation is to cause folic acid/methyl
One of the main reason for hypovitaminosis and homocysteine, the Etiological of folic acid metabolism exception.Wherein, MTRR base
Because common mutations site A66G is mutated, substitutes methionine by isoleucine, lead to methionine synthetase reductase activity
It significantly reduces.The thus especially needed Supplement of folic acid of Pregnant women of MTRR gene defect, detection Pregnant women methionine synthesis
The mutational site enzyme MTRR Gene A 66G, can be individuation Supplement of folic acid, and prevention Newborn Birth-defects provide scientific basis.
The gene pleiomorphism detecting method of one of method as genetic polymorphism detection is PCR sequencing PCR, and this method advantage is
The detection of high-throughput multidigit point can be carried out simultaneously, but its is complicated for operation that time-consuming and sensitivity is low, be easy to appear between sample and hand over
Fork pollution and the quick detection that can not achieve sample;High-resolution solubility curve method is quick, easy, economical and practical, but it is right
It is necessary to have installing high-resolution software, temperature to use than more sensitive machine, clinical expansion exists tired instrument requirements height
It is difficult.
The method of detection folic acid metabolism ability reported at present, has:
1. a kind of " detection PCR amplification of the detection site rs1801133 of folic acid metabolism capability evaluation of CN104774943A-
A kind of primer and Single base extension primer-disclosure " " detection site of folic acid metabolism capability evaluation of CN104789669A-
Detection PCR amplification primer and Single base extension primer-disclosure of rs1801394 ".
After the amplification of this method based on PCR and Single base extension, the parting of SNP genotype is carried out with MassARRAY, but is had
Have the disadvantage that: (1) equipment is expensive, and general testing agency is difficult to be equipped with, restricted application;(2) PCR amplification and single base
After extension, it is required to wheel digestions, the investment of complex steps, manpower and reagent consumptive material is big;(3) pcr amplification product needs
Processing of uncapping because DNA concentration is big at this time easily causes indoor aerosols to pollute, and influences the accuracy of result;Therefore have certain
Limitation.
2. " CN103184269B- detect homocysteine metabolism associated SNP positions kit and its amplification method and
Detection method-authorization " utilizes two forward primers and a reverse primer, after PCR amplification, see under ultraviolet light through gel electrophoresis
To the product band distinguished according to clip size, the genotype of target SNP site is judged according to the presence or absence of band.
This method is limited in that: (1) the judgement link of result needs gel electrophoresis, and is related to glue, point
Sample runs many cumbersome links such as glue, imaging, and while being easy error, human input is bigger;(2) result is in the form of picture
It presents, interpretation process relies on subjective factor, is easy error;(3) pcr amplification product needs are uncapped processing, because of DNA concentration at this time
Greatly, easily indoor aerosols is caused to pollute, influences the accuracy of result;Therefore there is certain limitation.
Summary of the invention
The main problem that the application solves is to provide a kind of reagent for detecting the site MTRR Gene A 66G rs1801394SNP
Box, easy to operate, easy to use, objectivity is strong, it is not easy to malfunction, it is good to practice operating effect, to solve a kind of detection MTRR base
Because the kit in the site A66G rs1801394SNP is practiced, operating effect is bad, operation difficulty is high, is difficult to replicate the technology of operation
Problem.
In order to solve the above-mentioned technical problem, the invention discloses a kind of detection MTRR Gene A 66G rs1801394SNP
The kit of point, its technical solution is as follows:
A kind of kit detecting the site MTRR Gene A 66G rs1801394SNP, which is characterized in that including according to MTRR
The primer and probe of Gene A 66G rs1801394SNP loci polymorphism design, sequence are as follows:
MTRR Gene A 66G forward direction amplimer: GCAGGGACAGGCAAAGG;
The reversed amplimer of MTRR Gene A 66G: CTGTGGTACATGGATTTTCTGC;
MTRR gene 66A probe: 5 '-AAGAAATATGTGAGCAA-3 ';
MTRR gene 66G probe: 5 '-AAGAAATGTGTGAGCAA-3 '.
Preferably, the fluorophor that the MTRR gene 66A probe 5 ' is held is VIC, and the quenching group at 3 ' ends is
Quencher and MGB.
Preferably, the fluorophor that the MTRR gene 66G probe 5 ' is held is FAM, and the quenching group at 3 ' ends is
Quencher and MGB.
Preferably, MTRR Gene A 66G primed probe mixing liquid proportional are as follows: MTRR Gene A 66G forward direction amplimer: MTRR
The reversed amplimer of Gene A 66G: MTRR gene 66A probe: MTRR gene 66G probe: water=10:10:4:4:192.
This experiment makes amplified fragments that is, by respectively setting a primer in purpose SNP site upstream and downstream using Q-PCR principle
In 50~150bp, while two genotype of SNP site are directed to, separately design the probe of two specific bindings.The 5 ' of probe
End is modified by special fluorophor, for example 66A type VIC, the 66G type in the MTRR Gene A 66G mentioned in this experiment is used
FAM modification, 3 ' terminal modified Quencher and MGB, because Quencher is quenching group, it and fluorophor are existed simultaneously in one
When in DNA chain, fluorophor cannot issue fluorescence, therefore under normal circumstances, and equipment cannot detect fluorescence signal.
Only when carrying out Q-PCR reaction, it with probe specificity is integrated to SNP site, and DNA included in reaction solution polymerize
Enzyme can probe from target fragment shearing into reaction solution, and the fluorescence in correspondent probe also therewith with quenching group
Quencher separation, is captured by equipment, and detects the specific genotype of purpose SNP.
QPCR method used by this method has the advantage that 1. is simple, a QPCR, react end when
It waits, can directly carry out result interpretation;2. convenience, related equipment price is cheap, and most of mechanism can be equipped with;3. result
It presents in digital form, objectivity is strong, it is not easy to malfunction;4. it is compatible strong, it as a result can directly enter in corresponding table, carry out
Quick interpretation, sample process ability are strong;5. pollution risk is small, without processing of uncapping after PCR, aerosol will not be generated, is made
At false positive.
Specific embodiment
As used some vocabulary to censure specific components in the specification and claims.Those skilled in the art answer
It is understood that hardware manufacturer may call the same component with different nouns.This specification and claims are not with name
The difference of title is as the mode for distinguishing component, but with the difference of component functionally as the criterion of differentiation.Specification
Subsequent descriptions be implement the application better embodiment, so it is described description be for the purpose of the rule for illustrating the application,
It is not intended to limit the scope of the present application.The protection scope of the application is as defined by the appended claims.
Embodiment one:
A kind of kit detecting the site MTRR Gene A 66G rs1801394SNP, which is characterized in that including according to MTRR
The primer and probe of Gene A 66G rs1801394SNP loci polymorphism design, sequence are as follows:
MTRR Gene A 66G forward direction amplimer: GCAGGGACAGGCAAAGG;
The reversed amplimer of MTRR Gene A 66G: CTGTGGTACATGGATTTTCTGC;
MTRR gene 66A probe: 5 '-AAGAAATATGTGAGCAA-3 ';
MTRR gene 66G probe: 5 '-AAGAAATGTGTGAGCAA-3 '.
The fluorophor that the MTRR gene 66A probe 5 ' is held is VIC, and the quenching group at 3 ' ends is Quencher and MGB.
The fluorophor that the MTRR gene 66G probe 5 ' is held is FAM, and the quenching group at 3 ' ends is Quencher and MGB.
MTRR Gene A 66G primed probe mixing liquid proportional are as follows: MTRR Gene A 66G forward direction amplimer: MTRR gene
The reversed amplimer of A66G: MTRR gene 66A probe: MTRR gene 66G probe: water=10:10:4:4:192.
Specific experiment process is as follows:
1. reaction system of table
Table 2.Primer&Probe Mix system
3. response procedures of table
As a result when interpretation, CT > 32 or be Undetermined be to be not detected the fluorescence signal, the spy is not detected in expression
The corresponding genotype of needle;CT < 29 are to detect the fluorescence signal, and expression detects the corresponding genotype of the probe;29≦CT≦
32, belong to critical value, then needs to redeterminate, such as:
4. example results of table
That is fixed, S3:G66G homozygous mutant, S4 the genotype of sample are as follows: S1:A66G is mutated heterozygous, S2: are resurveyed:
It is wild that A66G is mutated heterozygous, S5:A66G mutation heterozygous, S6:A66A wild type, S7:A66G mutation heterozygous, S8:A66A
Type, S9:A66A wild type, S10:A66G mutation heterozygous, S11:A66A wild type, NTC, that is, no template control do not have probe letter
Number.
Above description shows and describes several preferred embodiments of the present application, but as previously described, it should be understood that the application
Be not limited to forms disclosed herein, should not be regarded as an exclusion of other examples, and can be used for various other combinations,
Modification and environment, and the above teachings or related fields of technology or knowledge can be passed through in application contemplated scope described herein
It is modified.And changes and modifications made by those skilled in the art do not depart from spirit and scope, then it all should be in this Shen
It please be in the protection scope of appended claims.
Claims (4)
1. a kind of kit for detecting the site MTRR Gene A 66G rs1801394SNP, which is characterized in that including according to MTRR base
Because of the primer and probe of A66G rs1801394SNP loci polymorphism design, sequence is as follows:
MTRR Gene A 66G forward direction amplimer: GCAGGGACAGGCAAAGG;
The reversed amplimer of MTRR Gene A 66G: CTGTGGTACATGGATTTTCTGC;
MTRR gene 66A probe: 5 '-AAGAAATATGTGAGCAA-3 ';
MTRR gene 66G probe: 5 '-AAGAAATGTGTGAGCAA-3 '.
2. the kit in the detection site MTRR Gene A 66G rs1801394SNP according to claim 1, feature exist
In the fluorophor that the MTRR gene 66A probe 5 ' is held is VIC, and the quenching group at 3 ' ends is Quencher and MGB.
3. the kit in the detection site MTRR Gene A 66G rs1801394SNP according to claim 2, feature exist
In the fluorophor that the MTRR gene 66G probe 5 ' is held is FAM, and the quenching group at 3 ' ends is Quencher and MGB.
4. the kit in the detection site MTRR Gene A 66G rs1801394SNP according to claim 3, feature exist
In .MTRR Gene A 66G primed probe mixing liquid proportional are as follows: MTRR Gene A 66G forward direction amplimer: MTRR Gene A 66G is anti-
To amplimer: MTRR gene 66A probe: MTRR gene 66G probe: water=10:10:4:4:192.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811391649.5A CN110218782A (en) | 2018-11-21 | 2018-11-21 | A kind of kit detecting the site MTRR Gene A 66G rs1801394SNP |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811391649.5A CN110218782A (en) | 2018-11-21 | 2018-11-21 | A kind of kit detecting the site MTRR Gene A 66G rs1801394SNP |
Publications (1)
Publication Number | Publication Date |
---|---|
CN110218782A true CN110218782A (en) | 2019-09-10 |
Family
ID=67822233
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201811391649.5A Pending CN110218782A (en) | 2018-11-21 | 2018-11-21 | A kind of kit detecting the site MTRR Gene A 66G rs1801394SNP |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN110218782A (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105002275A (en) * | 2015-07-20 | 2015-10-28 | 武汉友芝友医疗科技有限公司 | Specific sequence specific primers-polymerase chain reaction primers and kit for human MTHFR and MTRR gene polymorphism detection |
CN107034300A (en) * | 2017-06-07 | 2017-08-11 | 上海龙鼎医药科技有限公司 | Carry out the genotyping detection method of MTRR Gene A 66G pleomorphism sites |
CN107058464A (en) * | 2016-08-31 | 2017-08-18 | 苏州康吉诊断试剂有限公司 | Homocysteine metabolism related gene MTRR A66G detection kit |
CN107988353A (en) * | 2017-12-08 | 2018-05-04 | 益善生物技术股份有限公司 | A kind of mankind MTHFR and/or MTRR genetic polymorphism detection kit |
-
2018
- 2018-11-21 CN CN201811391649.5A patent/CN110218782A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105002275A (en) * | 2015-07-20 | 2015-10-28 | 武汉友芝友医疗科技有限公司 | Specific sequence specific primers-polymerase chain reaction primers and kit for human MTHFR and MTRR gene polymorphism detection |
CN107058464A (en) * | 2016-08-31 | 2017-08-18 | 苏州康吉诊断试剂有限公司 | Homocysteine metabolism related gene MTRR A66G detection kit |
CN107034300A (en) * | 2017-06-07 | 2017-08-11 | 上海龙鼎医药科技有限公司 | Carry out the genotyping detection method of MTRR Gene A 66G pleomorphism sites |
CN107988353A (en) * | 2017-12-08 | 2018-05-04 | 益善生物技术股份有限公司 | A kind of mankind MTHFR and/or MTRR genetic polymorphism detection kit |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101921834B (en) | Polymerase chain reaction-sequence based typing (PCR-SBT) method for ABO blood type genotyping and reagent | |
CN103436631B (en) | A kind of test kit and method detecting CYP3A5 gene pleiomorphism | |
CN107385024B (en) | Rice fertility restorer gene assisted breeding molecular marker and application thereof | |
CN104789672B (en) | A kind of bar code magnetic bead liquid-phase chip detection kit of thalassemia gene | |
CN114134236B (en) | Application of reagent for detecting SNP molecular markers in goat RBP4 genotyping and/or goat molecular marker assisted breeding | |
Zhang et al. | An optimized TaqMan real-time PCR method for authentication of ASINI CORII COLLA (donkey-hide gelatin) | |
CN113293227B (en) | SNP molecular marker primer for identifying color traits of waxberry fruits and application thereof | |
CN112280848A (en) | Relative quantitative detection method and kit for human motor neuron gene copy number | |
CN108048598A (en) | For detecting the SNP marker of rice sterile gene pms3 | |
CN109355358A (en) | A kind of kit and method rapidly and efficiently detecting drug induccd skin adverse reaction related gene polymorphism | |
CN109321651A (en) | A kind of composition, kit, sample treatment and application detecting people CYP2D6 gene pleiomorphism | |
CN102925560A (en) | Kit and method for detecting mutant alpha-Mediterranean anemia genes through HRM (high resolution melting) method | |
CN105063222A (en) | Human ADH2 genotype detection kit | |
CN108949929A (en) | For detecting the product and its methods and applications of MTHFR and MTRR gene pleiomorphism simultaneously | |
CN105316401A (en) | Method for measuring ABCC2 gene polymorphism | |
CN105586438B (en) | GeXP multiple rapid detection primers and detection method for detecting akabane virus, foot-and-mouth disease virus and bluetongue virus | |
CN106591485A (en) | Nucleic acid composition for detecting ALDH2 gene mutation and its application and kit | |
CN110218782A (en) | A kind of kit detecting the site MTRR Gene A 66G rs1801394SNP | |
CN109504754A (en) | A method of detection folic acid metabolism ability | |
CN107988334B (en) | Method for SNP typing by direct PCR of oral swab | |
CN109295206A (en) | The kit and method of a kind of while quick detection MTHFR and MTRR gene pleiomorphism | |
CN112592972B (en) | Early screening method and kit for diffuse toxic goiter susceptibility genes | |
CN107034300A (en) | Carry out the genotyping detection method of MTRR Gene A 66G pleomorphism sites | |
WO2022221605A2 (en) | Detection of sars-cov-2 variant | |
CN103215356A (en) | Assay kit for detecting human leukocyte antigen-B (HLA-B)*57:01 and HLA complex P5 (HCP5) alleles |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
CB02 | Change of applicant information |
Address after: 410000 Hunan province Changsha hi tech Development Zone, Lu Tin Road No. 28, Lugu Technology Park D1-D2 building 1-8 layer 101-801 Applicant after: Changsha Jinyu medical laboratory Co.,Ltd. Address before: 410000 Hunan province Changsha hi tech Development Zone, Lu Tin Road No. 28, Lugu Technology Park D1-D2 building 1-8 layer 101-801 Applicant before: CHANGSHA KINGMED MEDICAL DIAGNOSTICS INSTITUTE Co.,Ltd. |
|
CB02 | Change of applicant information | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190910 |
|
WD01 | Invention patent application deemed withdrawn after publication |