CN110157711B

CN110157711B - Method for cloning full-length segment of coding region of human srebp1 gene

Info

Publication number: CN110157711B
Application number: CN201910104768.6A
Authority: CN
Inventors: 付常振; 刘庆平; 王仁军; 路遥; 兰佳欣
Original assignee: Dalian University
Current assignee: Dalian University
Priority date: 2019-02-01
Filing date: 2019-02-01
Publication date: 2023-10-24
Anticipated expiration: 2039-02-01
Also published as: CN110157711A

Abstract

The invention discloses a method for cloning a human srebp1 gene coding region in full length and in a segmented mode, which comprises the following steps: a1, designing a PCR primer for CDS (coding sequence) differential amplification of srebp1 genes; a2, PCR amplification of srebp1 gene fragments S1 and S2; a3, cloning S1 and S2 fragments; a4, double enzyme digestion and purification of T-S1 and T-S2; a5, connecting the E-S1 and the fragment of the ET-S2; the invention provides an effective method for the over-expression of srebp1 gene, the screening of interference sequence and the like based on the CDS region gene sequence of srebp1 gene.

Description

Method for cloning full-length segment of coding region of human srebp1 gene

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for cloning a coding region of a human srebp1 gene in full length and in a segmented manner.

Background

Sterol regulatory element binding protein-1c (Sterol reg. Mu. latory element binding protein-1c: SREBP-1 c) is a member of the SREBPs family, is highly expressed in human liver, white adipose tissue, etc., has a typical basic helix-loop-helix leucine zipper domain, and is primarily responsible for activating de novo synthesis of fatty acids and triglycerides (Eberle et al, 2004; muller-Wieland et al, 2012;Shimomura etal.,1997; wang et al, 1994), and studies indicate that SREBP-1c regulates de novo synthesis of fatty acids and triglycerides, primarily through binding to the SRE (5 '-TCACNCCAC-3') sequence in the downstream target gene promoter, thereby regulating transcription of the target gene (Shimano, 2001). The target genes include enzymes such as Fatty Acid Synthase (FASN), acetyl-CoA carboxylase alpha (ACCA), stearoyl-CoA desaturase 1 (SCD 1), fatty acid binding protein 3 (FABP 3), key rate-limiting enzyme genes responsible for the de novo synthesis of fatty acids, key protein genes responsible for the transport of fatty acids, etc. (Kim and Spiegelman,1996; liang et al, 2002; muller-Wieland et al, 2012;Shao and Espenshade,2012;Xiao and Song,2013). In addition, SREBP-1C can also regulate adipocyte differentiation in conjunction with PPARgamma and the CCAAT enhancer binding protein family (CCAAT enhancer binding proteins, C/EBPs) (Kim et al, 1998). Numerous studies have found that lipid metabolism disorders resulting from abnormal expression of srebp-1c have a significant correlation with a number of diseases such as nonalcoholic fatty liver, obesity, dyslipidemia, atherosclerosis, diabetes, cancer, etc., even the major causative agents of disease occurrence (Shimano and Sato,2017; tao et al, 2019;Varghese et al, 2018; wang et al, 2018; zhang et al, 2017).

The human srebp-1C gene is located on chromosome 17, the CDS region is 3525nt, the coding of 1174 amino acid residues, the G/C content is 65.3%, the total length of the srebp-1C mRNA CDS region is obtained by PCR amplification, which is the basis for the function research, because the CDS region is longer and the GC content is relatively higher, the amplification has a certain difficulty, even if various high-fidelity amplification enzymes are not successful, but some common enzyme amplification can realize amplification, after the vector is connected, the mutation of the base is found by sequencing, and therefore, the effective srebp1 gene sequence can not be obtained by using a direct amplification method, and the one-time amplification of the total length of the CDS region is difficult to realize.

Disclosure of Invention

In order to make up for the defects of the prior art, the invention obtains the full length of the coding region (CDS) sequence of the human srebp1 gene by reducing the single amplification length and applying a segmentation cloning method, and constructs the full length on a cloning vector, thereby providing an effective method for the researches and the application based on the CDS region sequence of the srebp1 gene, such as overexpression of the srebp1 gene, interference sequence screening and the like.

In order to achieve the above object, the present invention adopts the following technical solutions:

a method for human srebp1 gene CDS region-by-region cloning, comprising the steps of:

a1, designing a PCR primer for CDS (coding sequence) differential amplification of srebp1 genes;

a2, PCR amplification of srebp1 gene fragments S1 and S2;

a3, cloning S1 and S2 fragments;

a4, double enzyme digestion and purification of T-S1 and T-S2;

a5, connecting the E-S1 and the fragment of the ET-S2;

the step A1, the specific steps of designing the srebp1 gene CDS region-by-region amplification PCR primer are as follows:

downloading human srebp1 (Accession No. nm_ 004176) mRNA sequence from GenBank, analyzing restriction enzyme cutting site in CDS region sequence, finding that the 2149-2154 site of CDS region is BglII enzyme cutting site, using the enzyme cutting site as demarcation point, designing segment amplification primer, the primer sequence is as follows:

(1) s1 fragment primer

S1-F：TAT gcggcc gc CACC ATGGACGAGCCACCCTTCAGC

NotI Kozak

S1-R：CAAGGCCCGTGGGAGACTGGTC

(2) S2 fragment primers

S2-F：AAGGAAAAAA gcggccgc AGGGGATGCCGTGTCTGTG

NotI

S2-R：GC tctaga GGGGACACGGGGTCTACCTG

XbaI

Further, the step A2 specifically includes:

a2.1, extracting and reverse transcribing total RNA of the HepG2 cells;

a2.2, PCR amplification of the S1 fragment;

a2.3, PCR amplification of the S2 fragment;

wherein: a2.1, extracting and reverse transcribing total RNA of the HepG2 cells;

extracting total RNA of HepG2 cells by a TRIZOL method, and reversing the total RNA into cDNA, wherein a reverse transcription system and conditions are as follows: 5X g DNA Eraser Buffer. Mu.l, gDNA Eraser 1. Mu.l, torr RNA 1. Mu.g, RNase Free dH ₂ O to 10. Mu.l, gently mixing by blowing, incubating at 42℃for 2min on a PCR apparatus, and then adding PrimeScriptRT Enzyme Mix I. Mu.l, RT Primer Mix 1. Mu.l, 5X PrimeScript Buffer 2 4. Mu.l, RNase Free dH to the reaction solution ₂ O4. Mu.l, 20. Mu.l total, the temperature is kept at 37 ℃ for 15min on a PCR instrument, the temperature is kept at 85 ℃ for 5s, and the cDNA liquid is taken out after the temperature is reduced to 4 ℃ and kept at-20 ℃ for standby.

A2.2, PCR amplification of the S1 fragment;

the S1 fragment of the srebp1 gene is amplified by a KOD-Plus-Ver.2 kit in a PCR reaction system of: cD (cD)NA (50-100 ng/. Mu.l) 1.2. Mu.l, primers S1-F and S1-R each 0.6. Mu.l, 10 XPCR Buffer 2. Mu.l, 25mM MgSO ₄ 1.2. Mu.l, 2mM dNTPs 2. Mu.l, KOD-Plus- (1U/. Mu.l) 1. Mu.l, supplemented with ddH ₂ O to 20. Mu.l; the PCR amplification conditions were: pre-denaturation at 95 ℃ for 3min,33 cyclic reactions (95 ℃ for 30S,66 ℃ for 30S,72 ℃ for 90S), 72 ℃ for 10min, taking 3 μl of reaction solution, detecting by agarose gel electrophoresis, recovering and purifying S1 fragment by agarose gel, and preserving at-20 ℃ for later use.

A2.3, PCR amplification of the S2 fragment;

the PCR reaction conditions were 95℃for 3min of pre-denaturation, 33 cycles of reaction (95℃30s,65℃30s,72℃90 s), 72℃for 10min, and other steps of operation were the same as those of A2.2.

Further, the cloning of the S1 and S2 fragments in the step A3 comprises the following steps:

a3.1, cloning T-A of the S1 fragment;

a3.2, cloning T-A of the S2 fragment;

wherein, in the A3.1 step, the T-A clone of the S1 fragment;

taking 5 μl (100-500 ng/. Mu.l) of S1 fragment recovered by gel, adding 5 μl of 2 xTaq PCR Mix, reacting at 72 deg.C for 10min, and adding 2 μl into the ligation system19-T Simple Vector 1μl，Solution I 5μl，ddH ₂ O2 μl), overnight ligation at 16deg.C, transformation of DH5 a competent cells by heat shock, coating on solid LB plate containing ampicillin (100 ng/. Mu.l), picking up monoclonal colony after 12-16h, shaking overnight, extracting plasmid, double enzyme digestion of plasmid with BglII and NotI, electrophoresis detection, and further identification by sequencing company to obtain T-A cloning vector T-S1 of S1 fragment.

A3.2, cloning T-A of the S2 fragment;

taking 5 mu l of S2 fragment recovered by gel, adding 5 mu l of 2 xTaq PCR Mix, reacting for 10min at 72 ℃, and adding 2 mu l into a connecting system after finishing19-T Simple Vector 1μl，Solution I 5μl，ddH ₂ O2. Mu.l), transformation of DH 5. Alpha. Competent cells by heat shock at 16℃overnight, spreading on solid LB plate containing ampicillin (100 ng/. Mu.l), picking up monoclonal colony after 12-16h overnight, shaking, extracting plasmid, double enzyme digestion of plasmid with NotI and XbaI, electrophoresis detection, and sequencing by sequencing company to further identify T-A clone vector T-S2 to obtain S2 fragment.

Further, the step A4, the double digestion and purification of the T-S1 and the T-S2 comprises the steps of;

a4.1, double enzyme digestion and purification of T-S1;

a4.2, double enzyme digestion and purification of T-S2;

wherein, in the step A4.1, T-S1 is subjected to double enzyme digestion and purification; the specific operation is as follows:

taking 10 mu g T-S1 plasmid, carrying out overnight digestion with BglII and NotI restriction enzymes, and recovering a 2200bp DNA fragment, namely a target product of T-S1 after double digestion, namely E-S1, and storing at-20 ℃ for later use.

A4.2, double enzyme digestion and purification of T-S2; the specific operation is as follows:

taking 10 mu g T-S2 plasmid, carrying out overnight digestion with BglII and NotI restriction enzymes, and recovering a DNA fragment containing the T vector and the S2 fragment and having the total length of about 4000bp, namely a target product of double digestion of T-S2, which is named as ET-S2, and preserving at-20 ℃ for later use.

The step A5, the connection of E-S1 and ET-S2 fragments; the specific operation steps are as follows:

50ng of each of E-S1 and ET-S2 was taken, and 1. Mu.l of T4 DNA Ligase, 10×T DNA Ligase Buffer 1. Mu.l, and ddH was then added thereto ₂ O to 10 μl,16 ℃ overnight connection, heat shock method transformation DH5 alpha competent cells, coating on solid LB plate containing ampicillin (100 ng/. Mu.l), after 12-16h, picking up monoclonal colony overnight shaking, extracting plasmid, using XbaI and NotI restriction enzyme to cut plasmid, electrophoresis detection, enzyme cutting identification correct plasmid for sequencing company. And (3) obtaining the T cloning vector (T-srebp 1) containing the total length of the CDS region of the srebp1 gene after the identification is correct.

The beneficial effects are that: in order to overcome the defects that the CDS region of the human SREBP-1c gene is longer and the GC content is relatively higher in the prior art, and the one-time amplification of the total length of the CDS region is difficult to realize under general conditions, the invention obtains the total length of the CDS region sequence of the human SREBP1 gene by designing enzyme cutting sites and applying a segmented cloning method, constructs the total length on a cloning vector, and provides an effective method for the researches and the application of over-expression of the SREBP1 gene, interference sequence screening and the like based on the CDS region sequence of the SREBP1 gene.

Drawings

FIG. 1 is an electrophoretic detection of total RNA of HepG2 cells.

FIG. 2 is a schematic flow chart of PCR amplification technique.

FIG. 3 shows the electrophoretic detection of PCR amplification products of S1 and S2 fragments.

FIG. 4 is a double restriction identification of T-S1 and T-S2 plasmids.

FIG. 5 is a representation of recovery and identification of T-S1 and T-S2 double enzyme-digested gels.

FIG. 6 is a double restriction identification of T-srebp1.

FIG. 7 is a partial sequencing diagram.

FIG. 8 is a graph of an alignment of partial sequencing results with NCBI published sequences.

Detailed Description

The present invention will be described in detail with reference to the drawings and examples, in which materials are known in the art unless otherwise specified.

Examples

a2, PCR amplification of srebp1 gene fragments S1 and S2;

a3, cloning S1 and S2 fragments;

a4, double enzyme digestion and purification of T-S1 and T-S2;

and A5, connecting E-S1 and the fragment of ET-S2.

The first step: design of PCR primer for CDS (coding sequence) differential amplification of srebp1 gene

Downloading human srebp1 (Accession No. nm_ 004176) mRNA sequence from GenBank, analyzing restriction enzyme cutting site in CDS region sequence, finding that the 2149-2154 site of CDS region is BglII enzyme cutting site, using the enzyme cutting site as demarcation point, designing segment PCR amplification primer, the primer sequence is as follows:

(1) s1 fragment primer

S1-F：TAT gcggcc gc CACC ATGGACGAGCCACCCTTCAGC

NotI Kozak

S1-R：CAAGGCCCGTGGGAGACTGGTC

(2) S2 fragment primers

S2-F：AAGGAAAAAA gcggccgc AGGGGATGCCGTGTCTGTG

NotI

S2-R：GC tctaga GGGGACACGGGGTCTACCTG

XbaI

Because the technical problem of the segmentation method amplification is how to segment and the number of segments, the invention firstly divides the srebp1 into two segments and then connects the two segments into a complete srebp1 sequence, restriction enzymes are needed to be used in the process, the restriction enzymes are selected to play a key role, bglII is a single restriction site for srebp1 and is in the middle or near the middle position, and therefore BglII is selected as a demarcation point.

And a second step of: PCR amplification of srebp1 Gene fragments S1 and S2

2.1 extraction and reverse transcription of total RNA of HepG2 cells;

extracting total RNA of HepG2 cells by using a TRIZOL method, and specifically comprises the following steps:

1) Taking HepG2 cells with good growth state in a 35mm culture dish, removing the culture solution, and washing the culture solution once by using 1 XPBS;

2) Adding 1ml of RNAiso Plus into the dish, slightly shaking to ensure that the RNAiso Plus is uniformly distributed on the surface of the cell, standing for 2min at room temperature, and repeatedly blowing the cell for 2min by using a pipetting gun;

3) Transferring the lysate to a centrifuge tube; standing at room temperature for 5min;

4) Adding 200 μl of chloroform, shaking and mixing until the color is milky;

5) Centrifuging at 12000 Xg and 4 ℃ for 15min;

6) Transferring the supernatant to another new centrifuge tube;

7) Adding equal volume of isopropanol into the supernatant, mixing the mixture upside down, and standing the mixture at room temperature for 10min;

8) Centrifuging at 12000 Xg and 4 ℃ for 10min, and obtaining white precipitate which is RNA;

9) Carefully discard the supernatant, add 1ml of 75% ethanol, invert it up and down several times, centrifuge at 7500 Xg 4℃for 5min, discard the supernatant, repeat this step 1 times;

10 Opening the lid of the centrifuge tube, drying the pellet at room temperature for several minutes, and adding 50. Mu.l of RNase-free ddH ₂ O dissolves RNA;

11 2. Mu.l of the sample is used for agarose gel electrophoresis detection, 2. Mu.l of the sample is additionally used for measuring the concentration by a multifunctional enzyme-labeled instrument, and the rest of the sample is placed for standby.

The extracted total RNA is reversely transcribed into cDNA, and the specific operation steps are as follows:

the genomic DNA removal system is shown in Table 1.1-1,

TABLE 1.1-1 genomic DNA removal reaction

RNase Free ddH supplement ₂ O to a total volume of 10. Mu.L, gently stirring and mixing, incubating at 42℃for 2min on a PCR instrument, taking out and placing on ice, and then adding 10. Mu.L of a reverse transcription system (tables 1.1-2) to the system;

TABLE 1.1-2 reverse transcription System

The total volume is 20 mu L, the temperature is kept at 37 ℃ for 15min on a PCR instrument, the temperature is kept at 85 ℃ for 5s, the cDNA is taken out after the temperature is reduced to 4 ℃, and the cDNA is placed at-20 ℃ for standby.

2.2 The PCR amplification of the S1 fragment comprises the following specific operation steps;

amplifying the S1 fragment of the srebp1 gene by using KOD-Plus-Ver.2 kit in a PCR reaction system shown in Table 2.2-1;

TABLE 2.2-1 PCR reaction System

The PCR reaction system was then amplified on a PCR instrument according to specific reaction conditions (Table 2.2-2).

TABLE 2.2-2 PCR reaction conditions

Taking 3 μl of PCR reaction product, performing agarose gel electrophoresis detection, and preserving at-20deg.C for use.

PCR amplification of 2.3S2 fragment;

the PCR amplification reaction system of the S2 fragment is the same as that of the S1 fragment, and the reaction conditions are shown in the table 2.3-1;

TABLE 2.3-1PCR reaction conditions

Third, cloning of S1 and S2 fragments includes:

t-a cloning of 3.1S1 fragment;

the S1 fragment is purified by a gel recovery method, and the operation steps are as follows

1) Electrophoresis of the PCR product with 1% agarose gel for about 40min, S1 band separated from the impurity band;

2) Cutting agarose containing S1 band under ultraviolet lamp, weighing, mashing, placing into a 1.5mL centrifuge tube, and adding a proper amount of Binding Buffer (XP 2) according to the mass of agarose (XP 2) =1g:1ml;

3) After mixing, carrying out water bath at 50-60 ℃ and mixing uniformly in a reversed way every 2-3min until agarose gel blocks are completely dissolved;

4) Sucking the mixed solution in the step 3, transferring to a DNA adsorption column, and centrifuging 10000 Xg for 1min;

5) Adding 300 μL of Binding Buffer (XP 2), centrifuging with 13000 Xg for 1min;

6) Removing liquid in the sleeve, adding 700 mu L SPW Wash Buffer and 12000 Xg for centrifugation for 30s;

7) Repeating step 6) once;

8) Placing the adsorption column in a new sleeve, centrifuging for 2min at 12000 Xg, and discarding the sleeve;

9) The column was placed in a new 1.5ml centrifuge tube and ddH preheated at 65℃was added ₂ O (30-50. Mu.L) was allowed to stand at room temperature for 2min, centrifuged at 12000 Xg for 1min, and the purified S1 fragment was obtained as a clear solution in a 1.5ml centrifuge tube.

Taking 5 μl (100-500 ng/. Mu.l) of purified S1 fragment, adding 5 μl of 2×Taq PCR Mix, adding "A" at 72 ℃ for reaction for 10min, and then connecting, wherein the connection system is shown in Table 3.1-1;

TABLE 3.1-1 connection System

Overnight connection at 16 ℃, DH5 alpha competent cells are transformed by a heat shock method, then the cells are coated on a solid LB plate containing ampicillin (100 ng/. Mu.l), a monoclonal colony is picked up for shaking overnight after 12-16 hours, plasmids are extracted, after the concentration is measured by a multifunctional enzyme-labeling instrument, 1 mug is taken and identified by double enzyme digestion of BglII and NotI, and the enzyme digestion reaction system is shown in tables 3.1-2;

TABLE 3.1-2 cleavage System

The temperature is kept at 37 ℃ for 2 hours, electrophoresis detection is carried out, and plasmids with correct enzyme digestion identification are sent to sequencing companies for sequencing. And obtaining the cloning vector of the S1 fragment after the sequencing result is correct, and the cloning vector is named as T-S1.

T-a cloning of 3.2S2 fragment;

the T-A cloning method of the S2 fragment is the same as that of the S1 fragment, but the restriction enzymes used in the cloning vector identification are NotI and XbaI.

Fourthly, double enzyme digestion and purification of T-S1 and T-S2;

4.1 double cleavage and purification of T-S1;

taking 10 mug of T-S1 plasmid, carrying out double enzyme digestion by using BglII and NotI, wherein the enzyme digestion system is shown in Table 4.1-1,

TABLE 4.1-1T-S1 double cleavage reaction System

The temperature is kept at 37 ℃ for 2 hours, a DNA fragment of about 2200bp is recovered by gel, and the DNA fragment is named as E-S1 and is preserved at-20 ℃ for standby.

4.2 double enzyme digestion and purification of T-S2;

taking 10 mug of T-S2 plasmid, carrying out double enzyme digestion by using BglII and NotI, wherein the enzyme digestion system is shown in Table 4.2-1,

TABLE 4.2-1T-S2 double enzyme digestion reaction system

The enzyme digestion reaction is carried out for 2 hours at 37 ℃, a DNA fragment of about 4000bp is recovered by gel, and the DNA fragment is named as ET-S2 and is preserved at-20 ℃ for standby.

Fifth step E-S1 is connected with ET-S2;

50-100ng of E-S1 and ET-S2 are respectively taken and connected, and the connection system is shown in the table 5-1;

TABLE 5-1E-S1 and ET-S2 connection System

DH5 alpha competent cells are transformed by a heat shock method after overnight connection at 16 ℃, the cells are coated on a solid LB plate containing ampicillin (100 ng/. Mu.l), a monoclonal colony is picked up after 12-16 hours and shaken overnight, plasmids are extracted and digested with XbaI and NotI, electrophoresis detection is carried out, and plasmids with correct digestion identification are sent to sequencing company for sequencing. The plasmid with correct sequence is the T cloning vector containing the total length of the CDS region of the srebp1 gene and is named as T-srebp1.

Sixth step result verification

6.1 extraction and reverse transcription of total RNA of HepG2 cells;

total RNA of HepG2 cells was extracted by TRIZOL method, and the apparent 3 bands were observed by electrophoresis, which were 5.8s,18s,28s in order from bottom to top (FIG. 1). Then reverse to cDNA, and store at-20 deg.C for standby.

PCR amplification of 6.2S1 and S2 fragments;

the S1 fragment and the S2 fragment of the srebp1 gene are amplified by PCR, the PCR amplification technical flow is shown in figure 2, the agarose gel electrophoresis detection of the PCR product (figure 3) is shown in the specification, the 1 and 2 holes in figure 3 are the electrophoresis result of the S1 fragment, the 2200bp part is the S1 fragment, and the band at the lower 1000bp part is the impurity band; wells 3 and 4 of fig. 3 are the results of the S2 fragment electrophoresis, with the S2 fragment at 1300bp, consistent with the expected results.

T-a cloning of 6.3S1 and S2 fragments:

recovering S1 and S2 fragments from the gel, adding A, and respectively mixing withThe 19-T Simple Vector is connected to construct T-S1 and T-S2 cloning vectors. T-S1 is identified by BglII/NotI double digestion, T-S2 is identified by BglII/XbaI double digestion, the electrophoresis results of double digestion products are shown in FIG. 4, holes 1 and 2 in FIG. 4 are the electrophoresis results of the T-S2 double digestion products, and a band is respectively shown at 2692bp and 1312bp and is consistent with the expected result; in FIG. 4, the electrophoresis results of the T-S1 double enzyme digestion products are shown in 3 and 4 holes, and a band is respectively shown at 2692bp and 2164bp, which are consistent with the expected results.

6.4T-S1 and T-S2 double cleavage detection and purification

T-S1 and T-S2 were digested with BglII and NotI, and the digested products were subjected to agarose gel electrophoresis, and the results are shown in FIG. 5. In FIG. 5, wells 1 and 2 are the results of double cleavage of T-S2, a band of about 4000bp was seen, which was expected to be consistent with the expectation, and the band was recovered and purified by gel recovery, ET-S2. In FIG. 5, the results of double enzyme digestion of T-S1 are shown in the 3 and 4 wells, and it can be seen that a band of about 2700bp and a band of about 2200bp are matched with the expectations, and the band of 2200bp is recovered and purified by gel, namely E-S1;

6.5 ligation of E-S1 fragment with ET-S2 fragment

E-S1 and ET-S2 are connected and transformed to DH5 alpha competent cells, plasmids are extracted through picking and shaking, notI and XbaI double enzyme digestion identification (shown in figure 6) is carried out, the number 1 hole and the number 2 hole in figure 6 are respectively plasmids after E-S1 and ET-S2 are connected, a band is respectively shown between about 3500bp and 2700bp, 3500bp bands comprise the total length of a CDS region of srebp1 gene, and finally T-srebp1 is successfully constructed.

In the experimental process, the construction of each step of vector needs sequencing and identification after the double restriction enzyme digestion and identification of the extracted plasmid are correct, so as to ensure that the CDS region sequence of the obtained srebp1 gene is consistent with NCBI published. The results of partial sequencing are shown in FIG. 7, and the results of the comparison of the results of partial sequencing with NCBI published sequences are shown in FIG. 8.

While the invention has been described with reference to the preferred embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.

Claims

1. A method for sectional cloning of a coding region of a human srebp1 gene, which is characterized by comprising the following steps:

a2, PCR amplification of srebp1 gene fragments S1 and S2;

a3, cloning S1 and S2 fragments;

a4, double enzyme digestion and purification of T-S1 and T-S2;

a5, connecting the E-S1 and the fragment of the ET-S2;

in the step A1, a human srebp1 mRNA sequence is downloaded from GenBank, bglII cleavage sites are located at 2149-2154 of the CDS region, and the cleavage sites are used as demarcation points, so that a segmented amplification primer is designed, wherein the primer sequence is as follows:

(1) s1 fragment primer

S1-F：TAT gcggcc gc CACC ATGGACGAGCCACCCTTCAGC

NotI Kozak

S1-R：CAAGGCCCGTGGGAGACTGGTC

(2) S2 fragment primers

S2-F：AAGGAAAAAA gcggccgc AGGGGATGCCGTGTCTGTG

NotI

S2-R：GC tctaga GGGGACACGGGGTCTACCTG

XbaI

The step A2 comprises the following steps:

a2.1 step, extraction and reverse transcription of total RNA of HepG2 cells:

extracting total RNA of HepG2 cells by a TRIZOL method, and reversing the total RNA into cDNA, wherein a reverse transcription system and conditions are as follows: 5X g DNA Eraser Buffer. Mu.l, gDNA Eraser 1. Mu.l, torr RNA 1. Mu.g, RNase Free dH ₂ O to 10. Mu.l; the PCR apparatus was incubated at 42℃for 2min, and PrimeScriptRT Enzyme Mix I. Mu.l, RT Primer Mix 1. Mu.l, 5X PrimeScript Buffer. Mu.l, RNase Free dH were added to the reaction solution ₂ O4 μl, 20 μl total, holding at 37deg.C for 15min on a PCR instrument, holding at 85deg.C for 5s, and taking out cDNA solution after the temperature is reduced to 4deg.C, and preserving at-20deg.C;

a2.2 step, PCR amplification of S1 fragment:

the S1 fragment of the srebp1 gene is amplified by a KOD-Plus-Ver.2 kit in a PCR reaction system of: cDNA 1.2. Mu.l, primers S1-F and S1-R0.6. Mu.l each, 10 XPCR buffer 2. Mu.l, 25mM MgSO ₄ 1.2. Mu.l, 2mM dNTPs 2. Mu.l, KOD-Plus- (1U/. Mu.l) 1. Mu.l, supplemented with ddH ₂ O to 20. Mu.l; the PCR amplification conditions were: pre-denaturing at 95 ℃ for 3min, sequentially carrying out 33 cyclic reactions at 95 ℃ for 30S,66 ℃ for 30S and 72 ℃ for 90S, then carrying out 10min at 72 ℃, taking 3 μl of reaction solution, carrying out agarose gel electrophoresis detection, recovering and purifying S1 fragments by agarose gel, and preserving at-20 ℃ for later use;

a2.3 step, PCR amplification of S2 fragment:

the S2 fragment of the srebp1 gene is amplified by a KOD-Plus-Ver.2 kit in a PCR reaction system of: cDNA1.2. Mu.l, primers S2-F and S2-R each 0.6. Mu.l, 10 XPCR Buffer 2. Mu.l, 25mM MgSO ₄ 1.2. Mu.l, 2mM dNTPs 2. Mu.l, KOD-Plus- (1U/. Mu.l) 1. Mu.l, supplemented with ddH ₂ O to 20. Mu.l; the PCR amplification conditions were: pre-denaturation at 95 ℃ for 3min,33 cyclic reactions (95 ℃ for 30S,65 ℃ for 30S,72 ℃ for 90S), 72 ℃ for 10min, taking 3 μl of reaction solution, performing agarose gel electrophoresis detection, recovering and purifying S2 fragments by agarose gel, and preserving at-20 ℃ for later use;

the step A3 comprises the following steps:

a3.1 step, T-A cloning of S1 fragment:

taking 5 μl of S1 fragment recovered by glue, adding 5 μl of 2 xTaq PCR Mix, reacting for 10min at 72 ℃, adding 2 μl into a connecting system after finishing, connecting overnight at 16 ℃, converting DH5 alpha competent cells by a heat shock method, coating on a solid LB plate containing 100 ng/. Mu.l of ampicillin, picking up a monoclonal colony overnight for shaking after 12-16 hours, extracting plasmids, carrying out double enzyme digestion on plasmids by BglII and NotI, carrying out electrophoresis detection, and carrying out sequencing by a sequencing company for further identification to obtain a T-A cloning carrier T-S1 of the S1 fragment;

a3.2 step, T-A cloning of S2 fragment:

taking 5 μl of S2 fragment recovered by glue, adding 5 μl of 2 xTaq PCR Mix, reacting for 10min at 72 ℃, adding 2 μl into a connecting system after finishing, connecting overnight at 16 ℃, converting DH5 alpha competent cells by a heat shock method, coating on a solid LB plate containing 100 ng/. Mu.l of ampicillin, picking up a monoclonal colony overnight for shaking after 12-16 hours, extracting plasmids, carrying out double enzyme digestion on plasmids by NotI and XbaI, carrying out electrophoresis detection, and carrying out sequencing by a sequencing company to further identify T-A cloning carrier T-S2 of the S2 fragment;

the step A4 comprises the following steps:

a4.1, double enzyme digestion and purification of T-S1: taking 10 mu g T-S1 plasmid, carrying out overnight digestion with BglII and NotI restriction enzymes, and recovering a 2200bp DNA fragment by gel, namely a target product of T-S1 after double digestion, namely E-S1, and preserving at-20 ℃ for later use;

a4.2, double enzyme digestion and purification of T-S2: taking 10 mu g T-S2 plasmid, carrying out overnight digestion with BglII and NotI restriction enzymes, and recovering a DNA fragment containing a T vector and an S2 fragment of about 4000bp by glue, namely a target product after double digestion of T-S2, namely, the target product is named as ET-S2, and preserving at minus 20 ℃ for later use;

the step A5 specifically executes the following operations:

50ng of each of E-S1 and ET-S2 was taken, and 1. Mu.l of T4 DNA Ligase, 10×T DNA Ligase Buffer 1. Mu.l, and ddH was then added thereto ₂ O to 10 μl, overnight ligation at 16deg.C, transformation of DH 5. Alpha. Competent cells by heat shock, spreading on solid LB plate containing ampicillin, picking up monoclonal colony after 12-16h, shaking overnight, extracting plasmid, and restriction with XbaI and NotIAnd (3) enzyme cutting plasmid, detecting by electrophoresis, sequencing the enzyme-cut and identification correct plasmid by a sequencing company, and obtaining the T clone vector T-srebp1 containing the total length of the CDS region of the srebp1 gene after the identification is correct.

2. The method according to claim 1, wherein in the steps A3.1 and A3.2, the linking system is19-T Simple Vector 1μl，Solution I 5μl，ddH ₂ O 2μl。