CN110146581B - Method for detecting alpha-fetoprotein based on RGO-CS-Fc/Au NPs nano composite material and appropriate ligand - Google Patents

Method for detecting alpha-fetoprotein based on RGO-CS-Fc/Au NPs nano composite material and appropriate ligand Download PDF

Info

Publication number
CN110146581B
CN110146581B CN201910476441.1A CN201910476441A CN110146581B CN 110146581 B CN110146581 B CN 110146581B CN 201910476441 A CN201910476441 A CN 201910476441A CN 110146581 B CN110146581 B CN 110146581B
Authority
CN
China
Prior art keywords
rgo
afp
solution
nps
electrode
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910476441.1A
Other languages
Chinese (zh)
Other versions
CN110146581A (en
Inventor
李桂银
李文湛
周治德
梁晋涛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guilin University of Electronic Technology
Original Assignee
Guilin University of Electronic Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guilin University of Electronic Technology filed Critical Guilin University of Electronic Technology
Priority to CN201910476441.1A priority Critical patent/CN110146581B/en
Publication of CN110146581A publication Critical patent/CN110146581A/en
Application granted granted Critical
Publication of CN110146581B publication Critical patent/CN110146581B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/28—Electrolytic cell components
    • G01N27/30—Electrodes, e.g. test electrodes; Half-cells
    • G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
    • G01N27/3271—Amperometric enzyme electrodes for analytes in body fluids, e.g. glucose in blood
    • G01N27/3272—Test elements therefor, i.e. disposable laminated substrates with electrodes, reagent and channels
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/28—Electrolytic cell components
    • G01N27/30—Electrodes, e.g. test electrodes; Half-cells
    • G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
    • G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
    • G01N27/3277—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction being a redox reaction, e.g. detection by cyclic voltammetry
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/28—Electrolytic cell components
    • G01N27/30—Electrodes, e.g. test electrodes; Half-cells
    • G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
    • G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
    • G01N27/3278—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction involving nanosized elements, e.g. nanogaps or nanoparticles
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/416—Systems
    • G01N27/48—Systems using polarography, i.e. measuring changes in current under a slowly-varying voltage

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Electrochemistry (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Engineering & Computer Science (AREA)
  • Nanotechnology (AREA)
  • Biophysics (AREA)
  • Hematology (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A method for detecting alpha fetoprotein based on an RGO-CS-Fc/Au NPs nano composite material and a proper ligand adopts an electrodeposition technology and an electrostatic adsorption effect to modify RGO-CS-Fc/Au NPs on the surface of a screen printing electrode. AFP aptamer is loaded on the surface of RGO-CS-Fc/Au NPs material through nanotechnology and intermolecular force, and the aptamer exists on the surface of the composite material in a form of a single-chain structure due to an unstable spatial structure of the aptamer. After AFP is added into the surface of the electrode, the AFP can be specifically combined with AFP aptamers to generate a stable spatial structure, so that the AFP can be orderly arranged on the surface of the electrode. And detecting the current value by a DPV method, and drawing a relation curve of the current and the alpha-fetoprotein concentration to realize quantitative detection of the alpha-fetoprotein. The method has the advantages of simple operation, time saving, low cost and lower detection limit.

Description

Method for detecting alpha-fetoprotein based on RGO-CS-Fc/Au NPs nano composite material and appropriate ligand
Technical Field
The invention belongs to the field of biological detection, and particularly relates to a method for detecting alpha-fetoprotein based on a nanocomposite material and a suitable ligand.
Background
Alpha-fetoprotein (AFP) is an acidic glycoprotein belonging to the albumin family, which is a single polypeptide chain formed of more than 500 amino acid residues. For normal adults, AFP is present in very low amounts in the human body. The AFP detection method mainly comprises a radioimmunoassay method, a fluorescence immunoassay method, an enzyme-linked immunosorbent assay method, a chemiluminescence immunoassay method, a flow immunoassay method, an electrochemical immunosensor, a piezoelectric immunosensor, a polypeptide composite protein microarray and the like. The invention patent of publication No. CN 104677889B relates to a method for detecting alpha-fetoprotein based on a luminol functionalized magnetic immunoprobe. Marking alpha fetoprotein secondary antibody by using luminol functionalized magnetic microspheres, thereby preparing the luminol functionalized magnetic immune probe. A 'alpha fetoprotein-anti/alpha fetoprotein antigen/luminol functionalized magnetic immunoprobe' type composite structure is constructed on the surface of a gold electrode, and sensitive and specific detection on alpha fetoprotein is realized by detecting electrochemiluminescence signals. The invention patent of publication No. CN 105823886B relates to a method for preparing a ferrocene dioctyl phthalate/platinum nanoparticle/DNA enzyme compound and detecting alpha fetoprotein by using the compound. The invention patent with the application number of CN104569435B discloses a preparation method of a label-free photoelectrochemical alpha fetoprotein immunosensor, which is characterized in that a dendritic crystal nanorod-shaped trimetal alloy nano material is prepared on a titanium dioxide nano particle substrate by a photoelectrochemical synthesis method, and then the label-free photoelectrochemical immunosensor for detecting alpha fetoprotein is prepared. The instruments used in these methods are expensive, complex to operate, time-consuming and technically demanding, and it is necessary to establish a fast, sensitive and easy-to-operate method for AFP detection.
Disclosure of Invention
The invention aims to provide a method for detecting alpha fetoprotein based on a reductive graphene oxide-chitosan-ferrocene/nanogold (RGO-CS-Fc/Au NPs) nanocomposite material combined with a suitable ligand, so that the sensitivity is improved, and the specificity is enhanced.
In order to solve the technical problem, an AFP nano aptamer electrochemical biosensor based on RGO-CS-Fc/Au NPs is manufactured by adopting an electrodeposition technology and electrostatic adsorption. The method is characterized in that the peak current of the AFP aptamer is recorded by utilizing the high load capacity and good electron transfer effect of graphene and nano metal on the AFP aptamer and the specific recognition effect of the AFP aptamer on AFP and adopting Differential Pulse Voltammetry (DPV) of an electrochemical workstation. The incubation temperature, incubation time, pH value of PBS and AFP aptamer concentration of AFP are optimized, a standard curve is drawn, and accurate AFP concentration is obtained by comparing with the standard working curve. Compared with the existing method, the method has the advantages of relatively simple operation, high specificity, less time and cost consumption, and capability of reaching the detection limit of 1.013 ng/mL.
The detection principle of the invention is as follows: RGO-CS-Fc/Au NPs are modified on the surface of the screen-printed electrode by adopting an electrodeposition technology and electrostatic adsorption. AFP aptamer is loaded on the surface of RGO-CS-Fc/Au NPs material through nanotechnology and intermolecular force, and the aptamer exists in a biosensing interface in a form of a single-chain structure due to an unstable spatial structure of the aptamer. After AFP is added on a biosensing interface, the AFP can be specifically combined with an AFP aptamer to generate a stable spatial structure, so that the AFP can be orderly arranged on the surface of an electrode. The electrochemical signals (the scanning speed is 0.01V/s, and the scanning voltage interval is-0.4V-1.2V) in PBS (0.2 mol/L, pH6.0) before and after AFP are detected by a DPV method, and a relation curve of the current and the AFP concentration is drawn, so that the AFP is detected.
The invention is carried out according to the following steps:
step 1: preparation of RGO-CS-Fc Material
(1) Preparation of Reduced Graphene Oxide (RGO): pouring Graphene Oxide (GO) into distilled water, and performing ultrasonic treatment by using an ultrasonic cell disruption instrument to fully and uniformly dissolve the Graphene Oxide (GO) to prepare a GO aqueous solution. And (3) putting the GO aqueous solution into a beaker, and adding Ascorbic Acid (AA) to reduce GO to obtain RGO.
(2) Preparation of Chitosan-ferrocene (CS-Fc): adding Chitosan (CS) into the acetic acid solution to obtain a chitosan solution. Mixing ferrocenecarboxylic acid (Fc) with the chitosan solution, activating by carbodiimide/N-hydroxysuccinimide (EDC/NHS), and stirring to obtain the CS-Fc complex.
(3) Preparing a reducing graphene oxide-chitosan-ferrocene (RGO-CS-Fc) composite material: adding the RGO suspension into the CS-Fc solution, activating EDC/NHS, and centrifuging to obtain RGO-CS-Fc suspension.
Step 2: electrode modification and biosensing interface construction
(1) Placing a screen-printed electrode (SPE) in H2SO4And (3) in the solution, performing cyclic voltammetry scanning to obtain an activated screen printing electrode, and washing the screen printing electrode with water.
(2) And (3) placing the activated screen printing electrode into a chloroauric acid solution, carrying out constant potential deposition, and washing the electrode clean by water after the deposition is finished to obtain the Au NPs/SPE electrode.
(3) And soaking the Au NPs/SPE electrode by glutaraldehyde, washing by PBS, drying by blowing, then dropwise adding RGO-CS-Fc suspension for incubation for a period of time, washing by PBS, and drying by airing to obtain the RGO-CS-Fc/Au NPs/SPE electrode.
(4) And (2) dropwise adding an aminated AFP aptamer (AFP aptamer) to a sensor interface, incubating for a period of time, washing the AFP aptamer which is not fixed to the interface by using a PBS (phosphate buffer solution), dropwise adding a Bovine Serum Albumin (BSA) solution for sealing to obtain an AFP aptamer/RGO-CS-Fc/Au NPs/SPE sensing interface, and airing for later use.
And step 3: drawing a standard curve of alpha-fetoprotein
(1) And (3) dropwise adding a standard AFP solution to the AFP aptamer/RGO-CS-Fc/Au NPs/SPE sensing interface obtained in the step (2), incubating for a period of time, washing with a PBS solution to obtain a working electrode, and airing for later use.
(2) The working electrode was placed in PBS solution and its peak current was recorded using DPV scanning at the electrochemical workstation.
(3) And (3) detecting alpha-fetoprotein with different concentrations respectively, drawing a standard curve, and calculating the lowest detection limit of the method.
And 4, step 4: detection of AFP in actual samples
(1) And (3) dripping an actual sample to be detected on the AFP aptamer/RGO-CS-Fc/Au NPs/SPE sensing interface obtained in the step (2), incubating for a period of time, cleaning with a PBS solution to obtain a working electrode, and airing for later use.
(2) The working electrode was placed in PBS solution and its peak current was recorded using DPV scanning at the electrochemical workstation.
(3) And (4) obtaining the concentration of the alpha fetoprotein in the actual sample to be detected according to the standard curve in the step (3).
Further, the acetic acid solution in step 1 was 100mL of 1%.
Further, the EDC/NHS concentration in the step 1 is 10 mmol/L.
Further, the prepared materials were mixed, activated with EDC/NHS, and centrifuged in step 1 to obtain an RGO-CS-Fc suspension.
Further, H in the step 22SO4The concentration of the solution was 0.5 mol/L.
Further, the scanning voltage in the step 2 is-0.4V-1.2V, and the number of scanning segments is 20.
Further, the electrode is placed in H in the step 22SO4After cyclic voltammetry scanning, the electrode is washed clean by pure water, then is put into chloroauric acid solution to be respectively subjected to cyclic voltammetry scanning, and finally is washed by pure water and dried for standby.
Further, in the step 2, the concentration of chloroauric acid is 0.01%, the deposition condition is-0.5V, and the deposition time is 120 s.
Further, in the step 2, the concentration of glutaraldehyde is 2.5%.
Further, the BSA solution had a concentration of 0.5%, PBS at a concentration of 0.2 mol/L, and pH 6.0.
Further, the AFP aptamer concentration in step 2 was 0.1. mu. mol/L.
Further, the incubation temperature of the AFP aptamer at the electrode was 37 ℃ and the incubation time was 3 hours.
Preferably, the optimal incubation temperature of the alpha-fetoprotein in the step 3 is 25 ℃, and the optimal incubation time is 30 min.
Preferably, the linear scanning range in steps 3 and 4 is-0.4V-1.2V, and the scanning rate is 0.01V/s.
Wherein, step 1 provides a high-conductivity nanocomposite material for step 2. And 2, forming a biosensing interface for specifically recognizing alpha fetoprotein, and facilitating the transfer of electrons. The construction of the biosensing interface in step 2 is an essential key step in the electrochemical detection of alpha fetoprotein in step 3 and step 4. The working curve of alpha fetoprotein in step 3 provides a calculation basis for the determination of the AFP concentration in the actual sample in step 4. It can be seen that the steps 1-4 are mutually supported and act together to realize the detection of alpha-fetoprotein by using the RGO-CS-Fc/Au NPs composite material and the alpha-fetoprotein aptamer as recognition probes.
Compared with the prior art, the invention has the following advantages:
1. the RGO-CS-Fc/Au NPs composite nano material has large specific surface area and strong conductivity, and can effectively improve the detection rate; the specific surface area of the graphene and the nanogold is large, the adsorption capacity is strong, and the AFP aptamer can be effectively fixed on the surface of an electrode, so that the stability of the sensor is ensured, and the detection capacity is improved; the AFP can generate specific binding reaction with AFP aptamer to generate stable spatial structure. Compared with the traditional sensor, the novel nano material sensor has the advantages of smaller volume, higher speed, higher precision and higher reliability.
2. The AFP aptamer is used as a recognition probe to detect the alpha fetoprotein, so that the background interference is small, and the detection limit of 1.013ng/mL can be reached. The affinity between the aptamer and the target is often stronger than the affinity between the antigen and the antibody. Furthermore, aptamers are more easily labelled and modified by chemical means than antibodies, and these treatments facilitate the functionalization of nanoparticles and their surfaces.
Drawings
FIG. 1 is a schematic diagram of a nano-aptamer sensor based on RGO-CS-Fc/Au NPs for detecting AFP;
FIG. 2 Transmission Electron micrographs of RGO (A) and RGO-CS-Fc (B);
FIG. 3 is a scanning electron microscope characterization of various modification processes on the electrode surface;
FIG. 4 working curves of AFP nanoaptamer sensors based on RGO-CS-Fc/Au NPs; fig. 4A is a DPV curve for different AFP concentrations, and fig. 4B is a working curve for an AFP aptamer sensor.
Detailed Description
The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.
A method for detecting alpha-fetoprotein based on RGO-CS-Fc/Au NPs nano composite material and suitable ligand is disclosed, and the detection principle is shown in figure 1. RGO-CS-Fc/Au NPs are modified on the surface of the screen-printed electrode by adopting an electrodeposition technology and electrostatic adsorption. AFP aptamer is loaded on the surface of RGO-CS-Fc/Au NPs material through nanotechnology and intermolecular force, and the aptamer exists on a biosensing interface in a form of a single-chain structure due to an unstable spatial structure. After AFP is added into a biosensing interface, the AFP can be specifically combined with an AFP aptamer to generate a stable spatial structure, so that the AFP can be orderly arranged on the surface of an electrode. The electrochemical signals (the scanning speed is 0.01V/s, and the scanning voltage interval is-0.4V-1.2V) in PBS (0.2 mol/L, pH6.0) before and after AFP are detected by a DPV method, and a relation curve of the current and the AFP concentration is drawn, so that the AFP is detected.
The implementation steps are as follows:
preparation of RGO-CS-Fc composite nanomaterial: weighing 5mg of Graphene Oxide (GO), pouring the GO into 50 mL of distilled water, and carrying out ultrasonic treatment for 2h by using an ultrasonic cell disruptor to fully and uniformly dissolve the GO to prepare a 0.1 mg/mL GO aqueous solution. Placing 10 mL of the GO aqueous solution in a beaker, adding 10mg of Ascorbic Acid (AA) to reduce GO, and placing on a constant-temperature digital display magnetic heating stirrer to continuously stir for 12 hours to obtain RGO; 2 mg of Chitosan (CS) was added to 100mL of 1% acetic acid solution and stirred continuously with a glass rod until no bubbles were observed in the solution, resulting in a uniform and stable 2.0 mg/mL CS solution. Weighing 2 mg of ferrocenecarboxylic acid (Fc) to be mixed with the 10 mL of chitosan, activating by 10 mmol/L EDC/NHS, and stirring for 24 hours to obtain a chitosan-ferrocene compound; adding 10 mL of RGO suspension into 10 mL of ferrocene-chitosan (CS-Fc) solution, activating with EDC/NHS with the concentration of 10 mmol/L for 30min, and centrifuging at 20000 r/min to obtain RGO-CS-Fc suspension. The RGO-CS-Fc was characterized by Transmission Electron Microscopy (TEM) as shown in FIG. 2. FIG. 2A is a TEM image of RGO which has a lamellar structure and is very flat and smooth, with folds at the partial folds. FIG. 2B is a TEM image of RGO-CS-Fc, which also exhibits a lamellar structure, but RGO is dispersed into a more distinct platelet by chitosan, with many darker colored platelets appearing due to ferrocene binding to it.
2. Pretreatment of the electrode: the screen-printed electrode (SPE) was first soaked in 0.5mol/L H before use2SO4Performing Cyclic Voltammetry (CV) scanning in the solution, and scanning for 20 sections in a voltage range of-0.4V-1.2V; after completion of the scan, the resulting mixture was washed with water and air-dried to obtain an activated SPE.
3. Modification of the electrode and construction of a biosensing interface: and (3) putting the activated SPE electrode into 4mL of 0.01% chloroauric acid solution, depositing for 120s at a constant potential of-0.5V, washing for 3 times by using pure water after deposition is finished, and drying to obtain the Au NPs/SPE electrode. And soaking the Au NPs/SPE electrode in 2.5% glutaraldehyde for 15 min, washing with PBS (pH 7.0) for 3 times, drying, dropwise adding 5 mu L RGO-CS-Fc suspension, incubating for 30min, washing with PBS for 3 times, and drying in the air to obtain the RGO-CS-Fc/Au NPs/SPE. Providing 2 μ L of aminated AFP aptamer (AP 273, 5' -GTGACGCTCCTAACGCTGACTCAGGTGCAGTTCTCGACTCGGTCTTGATGTGGGT CCTGTCCGTCCGAACCAATC-NH)2-3') dropwise onto RGO-CS-Fc/Au NPs/SPEAnd incubating for 3 h on a sensing interface, washing the aptamer which cannot be fixed on the interface, dripping 6 mu L of 0.5% BSA solution for sealing, and naturally airing to obtain an AFP aptamer/RGO-CS-Fc/Au NPs/SPE sensing interface. Scanning Electron Microscopy (SEM) was used to characterize the different modification processes on the electrode surface, as shown in fig. 3. FIG. 3A is an SEM image of a bare electrode (SPE) whose surface exhibits a uniform arrangement of particles due to its inherent carbon particles; FIG. 3B is an SEM image of the electrode (Au NPs/SPE) after deposition of gold nanoparticles, and due to the presence of the gold nanoparticles, it can be seen that many bright white spherical particles are uniformly distributed on the surface layer of the carbon particles, which indicates that Au NPs of the gold nanoparticles are successfully deposited on the surface of the electrode; FIG. 3C is an SEM image of the electrode after modification of the RGO-CS-Fc composite nanomaterial, wherein RGO-CS-Fc is a nano-scale nanocomposite, so that the gold surface becomes smaller in gap, the electrode surface becomes significantly darker, and a layer of black covering is added; in FIG. 3D, it can be seen that the composite surface was covered with a thin film, indicating that AFP aptamer was successfully immobilized on the electrode surface.
4. Drawing a standard curve of alpha-fetoprotein: dropwise adding 2 mu L of alpha fetoprotein solution on an AFP aptamer/RGO-CS-Fc/Au NPs/SPE sensing interface, incubating at the temperature of 25 ℃ for 30min, washing with a PBS solution with the pH of 7.0 and distilled water, and drying to obtain the working electrode. FIG. 3E is an SEM image of AFP adsorbed at the biosensing interface, and comparing FIG. 3D, it is seen that AFP is aligned on the electrode surface in an ordered structure after specific binding to AFP aptamers. The working electrode obtained above was then placed in a PBS support solution (0.2 mol/L, pH 6.0) and the peak current was recorded using a DPV scan from the electrochemical workstation. The DPV profile for different AFP concentrations is shown in fig. 3A. When the AFP concentration is in the range of 0.001-10 mug/mL, the relationship between the sensor current response value (Y) and the AFP concentration (X) is linear, a standard curve is shown in figure 3B, the linear regression equation is Y =7.2106+2.8699X, and the correlation coefficient is 0.9856. Three times the standard deviation of the blank was defined as the lower detection limit, and the lowest detection limit for alpha-fetoprotein was calculated to be 1.013 ng/mL.
5. Detection of AFP in actual serum samples: mu.L of an AFP solution of known concentration (1. mu.g/mL, 5. mu.g/mL, 10. mu.g/mL) was added dropwise to the AFP aptamer/RGO-CS-Fc/Au NPs/SPE electrode surface, while 100. mu.L of a human serum sample was added to 5 mL of PBS support solution (0.2 mol/L, pH 6.0). And (4) placing the working electrode in the PBS supporting solution for DPV scanning, and recording the current value. According to the standard curve Y =7.2106+2.8699X of step 4, the corresponding AFP solution concentration in the actual sample can be calculated, and the detection result is shown in Table 1.
TABLE 1 AFP assay results in actual serum samples
Figure 790868DEST_PATH_IMAGE001
(Note: the concentration of AFP in the serum sample was determined by chemiluminescence immunoassay in the ninth and fourth hospitals of the United nations Provisions of the people Release force of China).
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not intended to limit the present invention in any way, and all simple modifications, equivalent variations and modifications made to the above embodiments according to the technical spirit of the present invention are within the scope of the present invention.

Claims (1)

1. A method for detecting alpha-fetoprotein based on RGO-CS-Fc/Au NPs nano composite material and proper ligand as a recognition probe comprises the following steps:
step 1: preparation of RGO-CS-Fc composite nano material
Weighing 5mg of GO, pouring the GO into 50 mL of distilled water, and carrying out ultrasonic treatment for 2h by using an ultrasonic cell disruption instrument to fully and uniformly dissolve the GO to prepare a 0.1 mg/mL GO aqueous solution;
adding 10mg of AA into 10 mL of GO water solution to reduce GO, and continuously stirring for 12 hours on a constant-temperature digital-display magnetic heating stirrer to obtain RGO;
adding 2 mg of CS into 100mL of 1% acetic acid solution, and uniformly stirring until no bubbles are observed in the solution, so as to obtain a uniform and stable 2.0 mg/mL CS solution;
weighing 2 mg of Fc, mixing with 10 mL of chitosan, activating with 10 mmol/L of EDC/NHS, and stirring for 24 h to obtain CS-Fc;
adding 10 mL of RGO suspension into 10 mL of CS-Fc solution, activating with 10 mmol/L EDC/NHS for 30min, and centrifuging at 20000 r/min to obtain RGO-CS-Fc suspension;
step 2: electrode modification and biosensing interface construction
SPE is soaked in 0.5mol/L H solution before use2SO4Performing CV scanning in the solution, and scanning for 20 sections in a voltage range of-0.4V-1.2V; after scanning, washing with water, and airing to obtain an activated SPE;
putting the activated SPE electrode into 4mL of 0.01% chloroauric acid solution, depositing for 120s at a constant potential of-0.5V, washing for 3 times by using pure water after deposition is finished, and drying by blowing to obtain an Au NPs/SPE electrode;
soaking Au NPs/SPE electrode in 2.5% glutaraldehyde for 15 min, washing with PBS (pH7.0) for 3 times, and blow-drying; dropwise adding 5 mu L of RGO-CS-Fc suspension for incubation for 30min, washing with PBS for 3 times, and air drying to obtain RGO-CS-Fc/Au NPs/SPE;
dripping 2 mu L of aminated AFP aptamer on an RGO-CS-Fc/Au NPs/SPE sensing interface, incubating for 3 h, washing the aptamer which cannot be fixed on the interface, dripping 6 mu L of 0.5% BSA solution for sealing, and airing to obtain an AFP aptamer/RGO-CS-Fc/Au NPs/SPE sensing interface;
and step 3: drawing of alpha-fetoprotein standard curve
Dropwise adding 2 mu L of alpha fetoprotein solution on an AFP aptamer/RGO-CS-Fc/Au NPs/SPE sensing interface, incubating at 25 ℃ for 30min, washing with PBS (phosphate buffer solution) with pH of 7.0 and distilled water, and drying to obtain a working electrode;
putting the working electrode into PBS supporting liquid with the concentration of 0.2 mol/L and the pH value of 6.0, adopting DPV scanning of an electrochemical workstation, and recording the peak current of the working electrode;
when the DPVAFP concentration of different AFP concentrations is within the range of 0.001-10 mug/mL, the relation between the current response value Y of the sensor and the AFP concentration X is linear, the linear regression equation is Y =7.2106+2.8699X, and the correlation coefficient is 0.9856;
and 4, step 4: detection of AFP in actual serum samples
Dripping 2 mu L of AFP solution with known concentration on the surface of an AFP aptamer/RGO-CS-Fc/Au NPs/SPE electrode, and simultaneously adding 100 mu L of human serum sample into 5 mL of PBS supporting solution; according to the step 3, the working electrode is placed in a PBS supporting solution for DPV scanning, and the current value is recorded; and (4) obtaining the concentration of the alpha fetoprotein in the actual sample to be detected according to the standard curve in the step (3).
CN201910476441.1A 2019-06-03 2019-06-03 Method for detecting alpha-fetoprotein based on RGO-CS-Fc/Au NPs nano composite material and appropriate ligand Active CN110146581B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910476441.1A CN110146581B (en) 2019-06-03 2019-06-03 Method for detecting alpha-fetoprotein based on RGO-CS-Fc/Au NPs nano composite material and appropriate ligand

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910476441.1A CN110146581B (en) 2019-06-03 2019-06-03 Method for detecting alpha-fetoprotein based on RGO-CS-Fc/Au NPs nano composite material and appropriate ligand

Publications (2)

Publication Number Publication Date
CN110146581A CN110146581A (en) 2019-08-20
CN110146581B true CN110146581B (en) 2022-03-29

Family

ID=67590064

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910476441.1A Active CN110146581B (en) 2019-06-03 2019-06-03 Method for detecting alpha-fetoprotein based on RGO-CS-Fc/Au NPs nano composite material and appropriate ligand

Country Status (1)

Country Link
CN (1) CN110146581B (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111413385B (en) * 2020-04-26 2023-09-19 桂林电子科技大学 GPC3 detection method based on RGO-CS-Fc/Pt-Pd NPs nanocomposite
CN111505077B (en) * 2020-04-26 2022-10-18 桂林电子科技大学 Method for detecting GPC3 based on RGO-Hemin/Au NPs nano composite material
CN111413384B (en) * 2020-04-26 2024-03-15 桂林电子科技大学 GPC3 detection method based on RGO-CS-Hemin/Au NPs nanocomposite
CN111638326B (en) * 2020-05-20 2023-05-09 江苏大学 Enzyme-free polymer immune probe and preparation method and application thereof
CN112014450B (en) * 2020-09-08 2022-08-30 桂林电子科技大学 Method for detecting C-reactive protein based on Fc-ECG/MEL/AuNPs/SPE modified electrode
CN112763563B (en) * 2021-02-03 2022-11-29 桂林电子科技大学 Method for detecting 1, 5-anhydroglucitol based on composite material modified LAPS chip
CN113009159A (en) * 2021-02-26 2021-06-22 长沙市信励致和科技有限责任公司 Human chorionic gonadotropin detection method based on human chorionic gonadotropin peptide aptamer

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107677719B (en) * 2017-09-07 2019-10-18 桂林电子科技大学 A method of alpha-fetoprotein is detected based on graphene, thionine and aptamer
CN108375612B (en) * 2018-02-08 2019-07-30 桂林电子科技大学 A kind of method of composite nano materials Electrochemical Detection alpha-fetoprotein
CN109369974B (en) * 2018-11-08 2021-03-30 西北师范大学 Preparation method of reduced graphene oxide-ferrocene-chitosan composite material

Also Published As

Publication number Publication date
CN110146581A (en) 2019-08-20

Similar Documents

Publication Publication Date Title
CN110146581B (en) Method for detecting alpha-fetoprotein based on RGO-CS-Fc/Au NPs nano composite material and appropriate ligand
CN111413385B (en) GPC3 detection method based on RGO-CS-Fc/Pt-Pd NPs nanocomposite
CN111505077B (en) Method for detecting GPC3 based on RGO-Hemin/Au NPs nano composite material
CN111307908B (en) Method for detecting GPC3 based on H-rGO-Pt @ Pd NPs nano composite material
CN111413384B (en) GPC3 detection method based on RGO-CS-Hemin/Au NPs nanocomposite
CN110823980B (en) Method for detecting GPC3 based on catalysis of silver deposition by peroxidase-like enzyme
Zhu et al. Amperometric immunosensor for simultaneous detection of three analytes in one interface using dual functionalized graphene sheets integrated with redox-probes as tracer matrixes
Yang et al. Hollow platinum decorated Fe3O4 nanoparticles as peroxidase mimetic couple with glucose oxidase for pseudobienzyme electrochemical immunosensor
CN111693571B (en) Method for detecting GPC3 based on light addressing potential sensor
CN113203781B (en) Method for detecting GPC3 based on RGO-CS-Hemin @ Pt NPs nano material and aptamer for non-diagnosis purpose
Xiang et al. A redox cycling-amplified electrochemical immunosensor for α-fetoprotein sensitive detection via polydopamine nanolabels
CN110376380B (en) Electrochemical enzyme-linked immunosensor and preparation and application thereof to antigen detection
Zhu et al. Simultaneous detection of four biomarkers with one sensing surface based on redox probe tagging strategy
Yang et al. Electrochemical immunosensor for detecting carcinoembryonic antigen using hollow Pt nanospheres-labeled multiple enzyme-linked antibodies as labels for signal amplification
CN112964763B (en) Electrochemical immunosensor of electroactive substance modified MOF composite material and preparation and application thereof
CN108918853B (en) Pd @ Ag @ CeO2Preparation method and application of labeled immunosensor
CN109613244B (en) Preparation method and application of Ag @ Pt-CuS labeled immunosensor
Wang et al. Graphene-Prussian blue/gold nanoparticles based electrochemical immunoassay of carcinoembryonic antigen
CN109444240B (en) Prussian blue-based electrochemical immunosensor, electrochemical immunosensing method established based on sensor and application
CN101923092A (en) Method for preparing carcinoembryonic antigen working electrode for screen printing electrode
CN112305053B (en) Indium sulfide nanoparticle modified labeled electrochemical immunosensor and electrochemical immunoassay method thereof
KR20200136908A (en) Improved electrodes for electrochemical devices
Lu et al. A novel electrochemical immunosensor based on Au nanoparticles and horseradish peroxidase signal amplification for ultrasensitive detection of α-fetoprotein
CN112014450B (en) Method for detecting C-reactive protein based on Fc-ECG/MEL/AuNPs/SPE modified electrode
Ren et al. Development of a new and simple method for the detection of histidine-tagged proteins based on thionine-chitosan/gold nanoparticles/horseradish peroxidase

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant