CN110144320A - A kind of genetic engineering bacterium and its zymotechnique producing maltotetraose forming amylase - Google Patents
A kind of genetic engineering bacterium and its zymotechnique producing maltotetraose forming amylase Download PDFInfo
- Publication number
- CN110144320A CN110144320A CN201910408975.0A CN201910408975A CN110144320A CN 110144320 A CN110144320 A CN 110144320A CN 201910408975 A CN201910408975 A CN 201910408975A CN 110144320 A CN110144320 A CN 110144320A
- Authority
- CN
- China
- Prior art keywords
- forming amylase
- genetic engineering
- maltotetraose forming
- engineering bacterium
- maltotetraose
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/0106—Glucan 1,4-alpha-maltotetraohydrolase (3.2.1.60)
Abstract
The invention discloses a kind of genetic engineering bacteriums and its zymotechnique for producing maltotetraose forming amylase, belong to genetic engineering and fermentation engineering field.The present invention is host with Bacillus subtilis WS11, constructs the genetic engineering bacterium Bacillus subtilis WS11 (g4/pHY300PLK) for producing maltotetraose forming amylase.The strain enzyme-producing is horizontal high, lower production costs.It is that production bacterial strain carries out enzymatic production in fermentor with the bacterial strain, enzyme activity is up to 1900U/mL.Present invention reduces maltotetraose forming amylase production cost, it can be achieved that the industrialized production of maltotetraose forming amylase.
Description
Technical field
The present invention relates to it is a kind of produce maltotetraose forming amylase genetic engineering bacterium and its zymotechnique, belong to genetic engineering and
Fermentation engineering field.
Background technique
Bacillus subtilis (Bacillus subtilis) belongs to gram-positive bacteria, because it is easily isolated culture, has
More visible genetic background and good secretory, but the features such as no pathogenicity, it has also become important industrial strain, by increasingly
Mostly for producing antibiotic, pharmaceutical protein and industrial enzyme preparation etc..The wild bacillus subtilis reported at present can at least produce
Raw eight kinds of extracellular proteases: neutral proteinase (nprE and nprB), alkali protease (aprE), serine protease (epr, bpr
And vpr), metalloproteinases (mpr) and cell wall protein enzyme (wprA).Extracellular protease plays nutrition suction in bacillus subtilis
It receives, the important function such as normal physiological metabolism and wrong protein degradation.Correct folded protein is difficult due to its protease resistant conformation
It is easily degraded by proteases.Folding is slower when non-homogeneous albumen is due to its cross-film, easier than homologous protein to be easily degraded by proteases.Protease
The quality of secreted albumen ensure that the degradation of foreign protein to a certain extent, but also reduce protein expression level,
The main function finally risen according to the folded state of secreted albumen is different.For not allowing the albumen of foldable, protease can
With incorrect folded protein of degrading, guarantee its quality on folded.And for folding easier albumen, folded state is relatively good, egg
The albumen that white enzyme degradation correctly folds, influences protein expression level.
Maltotetraose forming amylase (EC 3.2.1.60) is one kind of circumscribed kind of starch enzyme, it can be from the non-reduced of starch
End, special the 4th α-Isosorbide-5-Nitrae glycosidic bond of successively cutting generate the malto-oligosaccharide based on maltotetraose.Maltotetraose forms sediment
Powder enzyme has important application value in starch processing industry, can compound production with amylase such as carbohydrase, Pullulanases
The products such as glucose, maltose, maltotriose, maltotetraose shorten the reaction time, improve the conversion ratio of starch, reduce other
The usage amount of enzyme preparation is used in saccharification, to achieve the purpose that increase yield, improve utilization rate of equipment and installations, reduce production cost.Although
Maltotetraose forming amylase will be used wider and wider industrially, still, China is still not carried out industrialization so far
Production.
China is few about the research report of maltotetraose forming amylase.Currently, maltotetraose forming amylase is mainly by from thin
Separation and Extraction obtains in bacterium, high production cost, and environmental pollution cost is big, and price is expensive, is not able to satisfy the market demand.And it is existing
Genetic engineering bacterium is constructed come the method for fermenting and producing maltotetraose forming amylase by microbial method, and result is all undesirable.Big
There is report in heterogenous expression maltotetraose forming amylase in enterobacteria and bacillus subtilis, but haveed the defects that certain.
Maltotetraose forming amylase albumen easily forms inclusion body such as in Escherichia coli, is unfavorable for the isolation and purification in downstream, and malt four
Saccharogenic amylase has inhibiting effect to the growth of Escherichia coli, causes secretory volume very low.Bacillus subtilis is as food safety
The bacterial strain that bacterial strain becomes the preferred of industrial applications, however industrially uses such as Bacillus subtilis WB600 and
Bacillus subtilis WB800 is derived from Bacillus subtilis 168, knocks out transformation through protease and gets.
The fermented and cultured for the above-mentioned type strain reported at present cannot all reach higher cell density, and type strain is relative to certain
The exogenous protein expression amount of wild strain is low.2014, the clonal expression in bacillus subtilis 1A747 such as Wei Yunping
The maltotetraose forming amylase in the source Pseudomonas saccharophilaIAM1504, it was demonstrated that it hydrolyzes the product that starch generates
Based on maltotetraose, but the enzyme activity of maltotetraose forming amylase and expressing quantity be not significant in bacillus subtilis, and
It is not suitable for industrialized production.It is also unreal although domestic make some progress in maltotetraose forming amylase research
Existing industrialized production, commercially produced product in the market is mainly import enzyme preparation.Therefore, bacillus subtilis had into high density
The characteristic of fermentation plays the role of the industrialized production of maltotetraose forming amylase vital.
Summary of the invention
The present invention using Bacillus subtilisWS11 as the expressive host of maltotetraose forming amylase, constructs for the first time
The genetic engineering bacterium of one plant of production maltotetraose forming amylase, shake flask fermentation yield is up to 147U/mL, ferment tank highest enzyme activity
Power reduces maltotetraose forming amylase production cost up to 1900U/mL, realizes its industrialized production.
The first purpose of the invention is to provide a kind of genetic engineering bacteriums for producing maltotetraose forming amylase, with bacillus subtilis
Bacterium is host, and using pHY300PLK as expression vector, expression derives from Pseudomonas saccharophila Pseudomonas
The maltotetraose forming amylase of saccharophila, amino acid sequence is as shown in SEQ ID NO.6.
It in one embodiment of the invention, is host with Bacillus subtilisWS11.
In one embodiment of the invention, the nucleotide sequence of the maltotetraose forming amylase such as SEQ ID NO.1
It is shown.
A second object of the present invention is to provide a kind of construction methods of above-mentioned genetic engineering bacterium, which is characterized in that is
The maltotetraose forming amylase gene that nucleotides sequence is classified as SEQ ID NO.1 is connected on expression vector, then be transformed into it is withered
In careless bacillus, correct transformant is screened to get genetic engineering bacterium is arrived.
In one embodiment of the invention, the conversion is carried out by chemical transformation.
Third object of the present invention is to provide a kind of method for producing maltotetraose forming amylase, the method is using upper
The genetic engineering bacterium stated ferments.
In one embodiment of the invention, the method is that seed culture fluid is accessed fermentor, with 25-35% ammonia
Water management pH 6.5-7.5,33-37 DEG C of cultivation temperature.
In one embodiment of the invention, dissolved oxygen is maintained into 30-50% when fermentation, when dissolved oxygen rises rapidly,
Start flow feeding culture medium, terminates to cultivate when maltotetraose forming amylase enzyme activity is begun to decline.
In one embodiment of the invention, the supplemented medium (g/L) are as follows: glucose 240-260, industrial proteins
Peptone 170-190, bean cake powder 65-75, liquid microelement TES 18-23mL；Liquid microelement TES (g/L): CaCl20.5,
ZnSO4·7H2O 0.18, MnSO4·H2O 0.1, Na2- EDTA 10.05, FeCl38.35 CuSO4·5H2O 0.16,
CoCl2·6H2The mass ratio of O 0.18, the industrial proteins peptone and bean cake powder is 2-3:1.
In one embodiment of the invention, the fermentation medium (g/L) are as follows: industrial proteins peptone 25, bean cake powder 25,
Glucose 12, ammonium citrate 1, Na2SO32, (NH4)2SO42.68 K2HPO4·3H2O 19.2, NaH2PO4·2H2O 4,
MgSO4·7H2O 1, liquid microelement TES 3mL；Liquid microelement TES (g/L): CaCl20.5, ZnSO4·7H2O 0.18,
MnSO4·H2O 0.1, Na2- EDTA 10.05, FeCl38.35 CuSO4·5H2O 0.16, CoCl2·6H2O 0.18。
Fourth object of the present invention is to provide above-mentioned genetic engineering bacterium and is preparing maltotetraose forming amylase or containing malt
Application in the product of four saccharogenic amylases.
Beneficial effects of the present invention:
(1) the genetic engineering bacterium Bacillus subtilis WS11 (g4/pHY300PLK) that the present invention constructs has and produces
The property of maltotetraose forming amylase, produces for fermentor, and highest enzyme activity is able to solve existing fermentation work up to 1900U/mL
The problem of enzyme activity is lower in skill, high production cost is suitable for industrialized production；
(2) present invention studies engineering bacteria fermentation production medium, finds with 180g/L industrial proteins peptone
It is that nitrogen source of feed supplement fermenting and producing can obtain the high maltotetraose forming amylase of yield with lower cost with 70g/L bean cake powder.
Detailed description of the invention
Fig. 1: genetic engineering bacterium Bacillus subtilis WS11 (g4/pHY300PLK) digestion verification nucleic acid electrophoresis figure,
Wherein, M: standard nucleic acid molecules amount；1 and 2:g4/pHY300PLK sample.
Fig. 2: genetic engineering bacterium Bacillus subtilis WS11 (g4/pHY300PLK) shake flask fermentation culture SDS-
PAGE figure, wherein M: standard protein molecular weight；1:Bacillus subtilis WS11 (g4/pHY300PLK) sample；2: nothing
The fermentation supernatant of the host strain of maltotetraose forming amylase gene.
Fig. 3: bacillus subtilis WS11 recombinantly expresses the SDS- of maltotetraose forming amylase 3L tank fermented and cultured for host
PAGE figure, wherein M: standard protein molecular weight.
Fig. 4: the bacillus subtilis WS11 fermentation for recombinantly expressing maltotetraose forming amylase 3L tank fermented and cultured for host produces
Enzyme curve.
Specific embodiment
(1) culture medium and agent prescription
LB solid medium: molecular level peptone 9-11g/L, molecular level yeast powder 4-6g/L, NaCl 9-11g/L, agar
Powder 1.5-2%.
LB liquid medium: molecular level peptone 9-11g/L, molecular level yeast powder 4-6g/L, NaCl 9-11g/L, pH
6.8-7.2。
TB fermentation medium: glycerol 4-6g/L, technical grade yeast powder 23-25g/L, technical grade peptone 11-13g/L,
KH2PO42.2-2.4g/L, K2HPO4 16-17g/L。
Seed culture medium: the Fourth Ring technical grade peptone 10g/L, technical grade yeast powder 5g/L, NaCL 10g/L, 100mg/L
Element, pH 7.00
Fermentation medium (g/L): industrial proteins peptone 25, bean cake powder 25, glucose 12, ammonium citrate 1, Na2SO32,
(NH4)2SO42.68 K2HPO4·3H2O 19.2, NaH2PO4·2H2O 4, MgSO47H2O 1, liquid microelement TES
3mL.100 μ g/mL tetracyclines can also be added.
Liquid microelement TES (g/L): CaCl20.5, ZnSO4·7H2O 0.18, MnSO4·H2O 0.1, Na2-EDTA
10.05 FeCl38.35 CuSO4·5H2O 0.16, CoCl2·6H2O 0.18。
Supplemented medium 1 (g/L): glucose 250, industrial proteins peptone 250, liquid microelement 20mL.
Supplemented medium 2 (g/L): glucose 250, industrial proteins peptone 180, bean cake powder 70, liquid microelement 20mL.
Supplemented medium 3 (g/L): glucose 250, industrial proteins peptone 156.25, bean cake powder 93.75, liquid microelement
20mL。
10 × minimum salting liquid: K2HPO4 14g(K2HPO4·3H2O 18.34g), KH2PO46g, (NH4)2SO42g, lemon
Lemon acid sodium (Na3C6H5O7·2H2O) 1g, MgSO4·7H2O 0.2g, successively dissolves in distilled water, adds water to 100mL.
L-trp solution: 2mg/mL is stored in brown bottle, and 113 DEG C of sterilizing 30min are wrapped up in black paper bag.
I solution of GM: 1 × minimum salting liquid 95mL, 50% glucose 1mL, 5% caseinhydrolysate 0.4mL, 10% yeast juice
1mL, 2mg/mL L-trp 2.5mL.
II solution of GM: 1 × minimum salting liquid 97.5mL, 50% glucose 1mL, 5% caseinhydrolysate 0.08mL, 10% ferment
Female juice 0.04mL, 0.5M MgCl20.5mL (2.5mM), 0.1M CaCl20.5mL (0.5mM), 2mg/mL L-trp 0.5mL
(5ug/mL)。
(2) definition and measuring method of enzyme activity
Enzyme activity determination method: measurement system is 15mL: the soluble starch that the mass-volume concentration with 1mL is 1% is
Buffer (the Na of 50mM of 0.9mL is added in substrate2HPO4Citric acid, pH 7.0), the buffering of 1.0mL is added in blank control
Liquid keeps the temperature 10min in 55 DEG C of water-baths, the enzyme solution of 0.1mL is added, reacts 10min, is added 3mL DNS solution, boiling water bath 7min,
Ice water is cooling, 15mL is settled to, in OD540Lower survey absorbance value.
Enzyme activity definition: enzyme amount required for 1 μm of ol maltotetraose is generated per minute and is defined as 1 enzyme-activity unit (U).
(3) bacillus subtilis method for transformation
The bacillus subtilis WS frozen is dipped with oese, is then crossed on LB plate, 37 DEG C of overnight incubation activation.
Picking single colonie is inoculated in 5mL LB liquid medium, 37 DEG C of overnight incubation culture 18h.A certain amount of overnight culture is taken to arrive
In the GM I of 4.5mL, make OD600Value reaches 0.1-0.2, leaves 4.5mL mixed bacteria liquid.37 DEG C of 200rpm shaken cultivations, each
20min surveys an OD600, work as OD600It reaches 0.4-0.6 (taking around 60-90min)；Continue shaken cultivation 90min, draws
0.05mL bacterium solution is into the sterile test tube for the GM II for having 0.45mL preheating；37 DEG C of oscillation 90min have in culture many at this time
Competent cell is formed；Add the plasmid (15-20 μ L) of 1 μ g, 37 DEG C of shaken cultivation 30min；Centrifugation removes most supernatant,
Cell is resuspended, is coated in the screening flat board containing corresponding antibiotic, 37 DEG C of overnight incubations.
The building of 1 source Pseudomonas saccharophila maltotetraose forming amylase genetic engineering bacterium of embodiment
Under the premise of ensuring that amino acid sequence is constant, software is analyzed using codon usage frequency and combines withered grass gemma
The influence factors such as bacillus codon-bias, mRNA secondary structure and G/C content, to from Pseudomonas
The original gene sequence (the Genbank number of logging in: P22963) of four saccharogenic amylase of native malt of saccharophila carries out password
Son optimization, the rare codon of remaining sequence in addition to signal peptide is substituted with the preference codon in bacillus subtilis, together
When to take into account the stability of mRNA secondary structure.Chemical synthesis obtains the gene of maltotetraose forming amylase, and by NcoI and
HindIII restriction enzyme site is connected on pET20b (+) (Takara, Dalian, China) carrier, obtains plasmid g4/pET20b (+).
Plasmid for constructing bacillus subtilis expression vector is pHY300PLK, is had
The source Bacillusamyloliquefaciens amyQ promoter.Respectively with plasmid pHY300PLK and plasmid g4/pET20b (+)
For template, go out to have the carrier segments and genetic fragment of 15bp homologous sequence with primer P1/P2 and P3/P4 (being shown in Table 2) PCR amplification
(PCR reaction system is shown in Table 1), then (it is (big to be purchased from precious bioengineering with In-Fusion HD Cloning Plus kit ligase
Even) Co., Ltd, article No.: 639648) connecting, connection product Transformed E .coli JM109 competent cell, through 37 DEG C of culture 8h,
Choose transformant shaken cultivation in the LB containing 100mg/L ampicillin liquid, extract plasmid, electrophoresis result as shown in Figure 1,
Sequence verification is correct, obtains expression plasmid g4/pHY300PLK.
1 PCR reaction system of table
| 5×Phusion HF Reaction Buffer | 10μL |
| dNTP(10mmol/l) | 4μL |
| Template (50pmol/l) | 0.5μL |
| PCR primer 1 | 0.5μL |
| PCR primer 2 | 0.5μL |
| Primerstar DNA | 0.5μL |
| ddH2O | System is supplied into 50 μ L |
Response procedures are as follows: 94 DEG C of initial denaturation 4min；98 DEG C, 10s, 55 DEG C, 10s, 72 DEG C, 2min, carry out 30 circulations；
72 DEG C of extension 10min, are cooled to 4 DEG C.
2 primer sequence of table
| Primer | Sequence (3 ' -5 ') |
| P1 | AAGCTTGGTAATAAAAAAACACCTCC |
| P2 | CATGGCTACGGCTGATGTTT |
| P3 | AGTGCTGAAGCCATGGATCAAGCGGGAAAAAGCCCC |
| P4 | TTTATTACCAAGCTTTTAAAATGAGCCGCTCGTAGACGC |
Plasmid g4/PHY300PLK is converted into Bacillus subtilisWS11 host strain, is coated with (the 20mg/ containing tetracycline
L on LB plate), 37 DEG C of culture 8h.It chooses single bacterium to drop down onto LB liquid medium, 37 DEG C of overnight incubations, saves glycerol tube.
2 shake flask fermentation producing enzyme of embodiment
Bacillus subtilis WS11 (g4/pHY300PLK) the bacterial strain switching LB culture that -80 DEG C of glycerol tubes are saved
36-38 DEG C of culture 8-10h in base, after by gained culture solution by 4-6% inoculum concentration access TB fermentation medium in, 36-38 DEG C,
200r/min cultivates 1.5-2.5h, and then 33 DEG C, 200r/min cultivates 48h.Measure extracellular maltotetraose forming amylase enzyme activity.
The SDS-PAGE protein electrophoresis figure of Fig. 2 extracellular supernatant when being shake flask fermentation 48h, protein electrophoresis is as the result is shown about
There are one and the consistent band of theoretical molecular weight at 57kDa.At this point, recombination maltotetraose forming amylase enzyme activity is 147U/mL.
3 maltotetraose forming amylase genetic engineering bacterium 3L fermentation tank culture of embodiment
3L fermentation tank culture is carried out to the maltotetraose forming amylase genetic engineering bacterium built in above-described embodiment 1, is examined
The expression of maltotetraose forming amylase.Incubation is as follows: the glycerol tube bacterium solution for drawing 200 μ L is inoculated in equipped with 100mL kind
In the 500mL triangular flask of sub- culture medium, 30 DEG C, 200r/min is cultivated for 24 hours, the 3L for being 0.9L by above-mentioned culture solution access liquid amount
Fermentor controls pH 7 with 25% ammonium hydroxide, 30 DEG C of cultivation temperature, is tieed up dissolved oxygen by the way that ventilatory capacity is coupled and adjusted with speed of agitator
It holds 30% or so, when dissolved oxygen rises rapidly, shows that the glucose in culture medium has exhausted, start 1 (g/ of flow feeding culture medium
L): glucose 250, industrial proteins peptone 250, liquid microelement 20mL terminate to cultivate when the decline of maltotetraose forming amylase enzyme activity.
Protein electrophoresis figure is as shown in Figure 3.
When fermented and cultured 78h, maltotetraose forming amylase enzyme activity reaches 1984U/mL, and cost is 4.1RMB/L crude enzyme liquid.
4 maltotetraose forming amylase genetic engineering bacterium 3L fermentation tank culture of embodiment
3L fermentation tank culture is carried out to the maltotetraose forming amylase genetic engineering bacterium built in above-described embodiment 1, is examined
The expression of maltotetraose forming amylase.Incubation is as follows: the glycerol tube bacterium solution for drawing 200 μ L is inoculated in equipped with 100mL kind
In the 500mL triangular flask of sub- culture medium, 30 DEG C, 200r/min is cultivated for 24 hours, the 3L for being 0.9L by above-mentioned culture solution access liquid amount
Fermentor controls pH 7 with 25% ammonium hydroxide, 30 DEG C of cultivation temperature, is tieed up dissolved oxygen by the way that ventilatory capacity is coupled and adjusted with speed of agitator
It holds 30% or so, when dissolved oxygen rises rapidly, shows that the glucose in culture medium has exhausted, start 2 (g/ of flow feeding culture medium
L): glucose 250, industrial proteins peptone 180, bean cake powder 70, liquid microelement 20mL, when the decline of maltotetraose forming amylase enzyme activity
Terminate culture.
When fermented and cultured 78h, maltotetraose forming amylase enzyme activity reaches 1900U/mL, and cost is 3.3RMB/L crude enzyme liquid.
5 maltotetraose forming amylase genetic engineering bacterium 3L fermentation tank culture of embodiment
3L fermentation tank culture is carried out to the maltotetraose forming amylase genetic engineering bacterium built in above-described embodiment 1, is examined
The expression of maltotetraose forming amylase.Incubation is as follows: the glycerol tube bacterium solution for drawing 200 μ L is inoculated in equipped with 100mL kind
In the 500mL triangular flask of sub- culture medium, 30 DEG C, 200r/min is cultivated for 24 hours, the 3L for being 0.9L by above-mentioned culture solution access liquid amount
Fermentor controls pH 7 with 25% ammonium hydroxide, 30 DEG C of cultivation temperature, is tieed up dissolved oxygen by the way that ventilatory capacity is coupled and adjusted with speed of agitator
It holds 30% or so, when dissolved oxygen rises rapidly, shows that the glucose in culture medium has exhausted, start 3 (g/ of flow feeding culture medium
L): glucose 250, industrial proteins peptone 156.25, bean cake powder 93.75, liquid microelement 20mL, when maltotetraose forming amylase enzyme activity
Terminate to cultivate when decline.
When fermented and cultured 60h, maltotetraose forming amylase enzyme activity reaches 1395U/mL, and cost is 2.9RMB/L crude enzyme liquid.
As shown in figure 4, utilizing supplemented medium 2 (g/L): glucose 250, industrial proteins peptone 180, bean cake powder 70 are micro
When element liquid 20mL, fermented and cultured 78h, maltotetraose forming amylase enzyme activity reaches 1900U/mL, and cost is 3.3RMB/L crude enzyme liquid.
It is the highest of the source the Pseudomonas saccharophila maltotetraose forming amylase reported at present in bacillus subtilis
Level shows that Bacillus subtilis WS11 (g4/pHY300PLK) can carry out High Density Cultivation, has very high work
Industry application value.
Comparative example
It is expressed as expression vector and in bacillus subtilis WB600 using pBSMuL3, the same Examples 1 and 2 of remaining condition.
The result shows that maltotetraose forming amylase is hardly expressed.
Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill
The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention
Enclosing subject to the definition of the claims.
SEQUENCE LISTING
<110>Southern Yangtze University
<120>a kind of genetic engineering bacterium and its zymotechnique for producing maltotetraose forming amylase
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 1593
<212> DNA
<213>artificial sequence
<400> 1
gatcaagcgg gaaaaagccc cgccggagtt cggtatcatg gtggcgatga aattatctta 60
caaggctttc attggaatgt tgttcgtgaa gcacctaatg attggtataa tattctgaga 120
caacaagcat ctacgatcgc agcagatggc tttagcgcga tctggatgcc tgtcccgtgg 180
agagatttta gctcttggac ggatggagga aaatcaggtg gcggagaagg atatttttgg 240
catgatttta acaaaaatgg ccgctatggc tctgatgcac aacttcgtca agcagcgggc 300
gcactgggag gcgcgggtgt taaagtgctg tatgatgtgg tcccgaatca catgaataga 360
ggctatccgg ataaagaaat taacctacca gctggccaag gcttttggcg taatgattgc 420
gcagatccgg gcaattatcc gaatgattgc gatgatggcg atcgctttat cggcggcgaa 480
tctgatctta atacgggaca tcctcaaatc tatggcatgt ttagagatga acttgcgaat 540
cttcgttctg gatatggcgc gggaggcttt cggtttgatt ttgtccgtgg ctatgcacct 600
gaacgggtcg atagctggat gtctgattct gctgatagct cattttgcgt cggagaactg 660
tggaaaggac cgtcagaata tcctagctgg gattggcgta atacagcatc ttggcaacaa 720
attattaaag attggtcaga tcgtgcgaaa tgccctgtgt ttgattttgc acttaaagaa 780
cgtatgcaaa atggctctgt tgcagattgg aaacatggac ttaatggcaa tcctgatcct 840
cggtggcgtg aagtcgcagt gacgtttgtc gataatcatg atacaggata ttcgcccggc 900
caaaatggcg gccaacatca ttgggcactt caagatggac ttatccgcca agcctatgcg 960
tatattctta cgagccctgg aacgccggtg gtgtattggt cacacatgta tgattggggc 1020
tatggcgatt ttattagaca acttattcaa gtccgccgta cagcgggagt tagagcagat 1080
tctgcaatta gctttcatag cggctatagc ggccttgtcg cgacagtctc aggaagccaa 1140
caaacgctgg ttgtcgcgtt aaactcggat cttgcgaatc cgggccaagt cgcatcagga 1200
tcgttttcag aagcagtgaa tgcgtctaac ggccaagtcc gtgtgtggcg ctcaggctca 1260
ggcgatggcg gaggcaatga tggcggagaa ggtggccttg tcaatgttaa ttttcggtgc 1320
gataacggcg ttacacaaat gggagattca gtgtatgcag tcggcaatgt gagccaactg 1380
ggcaactggt cacctgcgag cgcggttaga ctgacggata cgtctagcta tccgacttgg 1440
aaaggctcta tcgcactgcc ggatggacaa aatgttgagt ggaaatgcct tattcgtaac 1500
gaggcggatg cgacgttagt gagacaatgg caatctggcg gcaacaatca agttcaagca 1560
gcagcgggcg cgtctacgag cggctcattt taa 1593
<210> 2
<211> 26
<212> DNA
<213>artificial sequence
<400> 2
aagcttggta ataaaaaaac acctcc 26
<210> 3
<211> 20
<212> DNA
<213>artificial sequence
<400> 3
catggctacg gctgatgttt 20
<210> 4
<211> 36
<212> DNA
<213>artificial sequence
<400> 4
agtgctgaag ccatggatca agcgggaaaa agcccc 36
<210> 5
<211> 39
<212> DNA
<213>artificial sequence
<400> 5
tttattacca agcttttaaa atgagccgct cgtagacgc 39
<210> 6
<211> 530
<212> PRT
<213> Pseudomonas saccharophila
<400> 6
Asp Gln Ala Gly Lys Ser Pro Ala Gly Val Arg Tyr His Gly Gly Asp
1 5 10 15
Glu Ile Ile Leu Gln Gly Phe His Trp Asn Val Val Arg Glu Ala Pro
20 25 30
Asn Asp Trp Tyr Asn Ile Leu Arg Gln Gln Ala Ser Thr Ile Ala Ala
35 40 45
Asp Gly Phe Ser Ala Ile Trp Met Pro Val Pro Trp Arg Asp Phe Ser
50 55 60
Ser Trp Thr Asp Gly Gly Lys Ser Gly Gly Gly Glu Gly Tyr Phe Trp
65 70 75 80
His Asp Phe Asn Lys Asn Gly Arg Tyr Gly Ser Asp Ala Gln Leu Arg
85 90 95
Gln Ala Ala Gly Ala Leu Gly Gly Ala Gly Val Lys Val Leu Tyr Asp
100 105 110
Val Val Pro Asn His Met Asn Arg Gly Tyr Pro Asp Lys Glu Ile Asn
115 120 125
Leu Pro Ala Gly Gln Gly Phe Trp Arg Asn Asp Cys Ala Asp Pro Gly
130 135 140
Asn Tyr Pro Asn Asp Cys Asp Asp Gly Asp Arg Phe Ile Gly Gly Glu
145 150 155 160
Ser Asp Leu Asn Thr Gly His Pro Gln Ile Tyr Gly Met Phe Arg Asp
165 170 175
Glu Leu Ala Asn Leu Arg Ser Gly Tyr Gly Ala Gly Gly Phe Arg Phe
180 185 190
Asp Phe Val Arg Gly Tyr Ala Pro Glu Arg Val Asp Ser Trp Met Ser
195 200 205
Asp Ser Ala Asp Ser Ser Phe Cys Val Gly Glu Leu Trp Lys Gly Pro
210 215 220
Ser Glu Tyr Pro Ser Trp Asp Trp Arg Asn Thr Ala Ser Trp Gln Gln
225 230 235 240
Ile Ile Lys Asp Trp Ser Asp Arg Ala Lys Cys Pro Val Phe Asp Phe
245 250 255
Ala Leu Lys Glu Arg Met Gln Asn Gly Ser Val Ala Asp Trp Lys His
260 265 270
Gly Leu Asn Gly Asn Pro Asp Pro Arg Trp Arg Glu Val Ala Val Thr
275 280 285
Phe Val Asp Asn His Asp Thr Gly Tyr Ser Pro Gly Gln Asn Gly Gly
290 295 300
Gln His His Trp Ala Leu Gln Asp Gly Leu Ile Arg Gln Ala Tyr Ala
305 310 315 320
Tyr Ile Leu Thr Ser Pro Gly Thr Pro Val Val Tyr Trp Ser His Met
325 330 335
Tyr Asp Trp Gly Tyr Gly Asp Phe Ile Arg Gln Leu Ile Gln Val Arg
340 345 350
Arg Thr Ala Gly Val Arg Ala Asp Ser Ala Ile Ser Phe His Ser Gly
355 360 365
Tyr Ser Gly Leu Val Ala Thr Val Ser Gly Ser Gln Gln Thr Leu Val
370 375 380
Val Ala Leu Asn Ser Asp Leu Ala Asn Pro Gly Gln Val Ala Ser Gly
385 390 395 400
Ser Phe Ser Glu Ala Val Asn Ala Ser Asn Gly Gln Val Arg Val Trp
405 410 415
Arg Ser Gly Ser Gly Asp Gly Gly Gly Asn Asp Gly Gly Glu Gly Gly
420 425 430
Leu Val Asn Val Asn Phe Arg Cys Asp Asn Gly Val Thr Gln Met Gly
435 440 445
Asp Ser Val Tyr Ala Val Gly Asn Val Ser Gln Leu Gly Asn Trp Ser
450 455 460
Pro Ala Ser Ala Val Arg Leu Thr Asp Thr Ser Ser Tyr Pro Thr Trp
465 470 475 480
Lys Gly Ser Ile Ala Leu Pro Asp Gly Gln Asn Val Glu Trp Lys Cys
485 490 495
Leu Ile Arg Asn Glu Ala Asp Ala Thr Leu Val Arg Gln Trp Gln Ser
500 505 510
Gly Gly Asn Asn Gln Val Gln Ala Ala Ala Gly Ala Ser Thr Ser Gly
515 520 525
Ser Phe
530
Claims (10)
1. a kind of genetic engineering bacterium for producing maltotetraose forming amylase, which is characterized in that it with bacillus subtilis is host, with
PHY300PLK is expression vector, express amino acid sequence maltotetraose forming amylase as shown in SEQ ID NO.6.
2. genetic engineering bacterium as described in claim 1, which is characterized in that with Bacillus subtilisWS11 be host.
3. genetic engineering bacterium as claimed in claim 1 or 2, which is characterized in that the nucleotides sequence of the maltotetraose forming amylase
Column are as shown in SEQ ID NO.1.
4. a kind of construction method of any genetic engineering bacterium of claim 1-3, which is characterized in that be by nucleotide sequence
Maltotetraose forming amylase gene for SEQ ID NO.1 is connected on expression vector, then in being transformed into bacillus subtilis,
Correct transformant is screened to get genetic engineering bacterium is arrived.
5. construction method as claimed in claim 4, which is characterized in that the conversion is carried out by chemical transformation.
6. a kind of method for producing maltotetraose forming amylase, which is characterized in that the method is using any institute of claim 1-3
The genetic engineering bacterium stated ferments.
7. method as claimed in claim 6, which is characterized in that the method is that seed culture fluid is accessed fermentor, with 25-
35% ammonium hydroxide control pH6.5-7.5,33-37 DEG C of cultivation temperature.
8. the method for claim 7, which is characterized in that dissolved oxygen is maintained 30-50% when fermentation, on dissolved oxygen is rapid
When rising, starts flow feeding culture medium, terminate to cultivate when maltotetraose forming amylase enzyme activity is begun to decline.
9. the method for claim 7, which is characterized in that the supplemented medium (g/L) are as follows: glucose 240-260, work
Industry peptone 170-190, bean cake powder 65-75, liquid microelement TES 18-23mL；Liquid microelement TES (g/L):
CaCl20.5, ZnSO4·7H2O 0.18, MnSO4·H2O 0.1, Na2- EDTA 10.05, FeCl38.35 CuSO4·5H2O
0.16, CoCl2·6H2The mass ratio of O 0.18, the industrial proteins peptone and bean cake powder is 2-3:1.
10. any genetic engineering bacterium of claim 1-3 is preparing maltotetraose forming amylase or is containing maltotetraose forming amylase
Product in application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910408975.0A CN110144320A (en) | 2019-05-16 | 2019-05-16 | A kind of genetic engineering bacterium and its zymotechnique producing maltotetraose forming amylase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910408975.0A CN110144320A (en) | 2019-05-16 | 2019-05-16 | A kind of genetic engineering bacterium and its zymotechnique producing maltotetraose forming amylase |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110144320A true CN110144320A (en) | 2019-08-20 |
Family
ID=67595485
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910408975.0A Pending CN110144320A (en) | 2019-05-16 | 2019-05-16 | A kind of genetic engineering bacterium and its zymotechnique producing maltotetraose forming amylase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110144320A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113493812A (en) * | 2020-04-08 | 2021-10-12 | 无锡秋可生物科技有限公司 | Preparation process of oligomeric maltose syrup with high maltotetraose content |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754466A (en) * | 2016-11-22 | 2017-05-31 | 江南大学 | It is a kind of for efficient exogenous protein expression and the bacillus subtilis of High Density Cultivation |
| CN108102996A (en) * | 2018-02-12 | 2018-06-01 | 江南大学 | A kind of method of the high efficient expression maltogenic amylase in bacillus subtilis |
| CN108102997A (en) * | 2017-10-25 | 2018-06-01 | 江南大学 | A kind of bacillus subtilis for Pullulanase high efficient expression and High Density Cultivation |
-
2019
- 2019-05-16 CN CN201910408975.0A patent/CN110144320A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754466A (en) * | 2016-11-22 | 2017-05-31 | 江南大学 | It is a kind of for efficient exogenous protein expression and the bacillus subtilis of High Density Cultivation |
| CN108102997A (en) * | 2017-10-25 | 2018-06-01 | 江南大学 | A kind of bacillus subtilis for Pullulanase high efficient expression and High Density Cultivation |
| CN108102996A (en) * | 2018-02-12 | 2018-06-01 | 江南大学 | A kind of method of the high efficient expression maltogenic amylase in bacillus subtilis |
Non-Patent Citations (3)
| Title |
|---|
| KANG ZHANG等: "Enhanced extracellular pullulanase production in Bacillus subtilis using protease-deficient strains and optimal feeding", 《APPLIED MICROBIOLOGY AND BIOTECHNOLOGY》 * |
| 徐锐主编: "《发酵技术》", 31 January 2016, 重庆大学出版社 * |
| 杨亚楠等: "重组Bacillus subtilis 产麦芽四糖淀粉酶的发酵优化及麦芽四糖制备", 《食品与发酵工业-网络首发论文》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113493812A (en) * | 2020-04-08 | 2021-10-12 | 无锡秋可生物科技有限公司 | Preparation process of oligomeric maltose syrup with high maltotetraose content |
| CN113493812B (en) * | 2020-04-08 | 2024-01-09 | 无锡秋可生物科技有限公司 | Preparation process of low-polymer maltose syrup with high maltotetraose content |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107574159B (en) | Mutant of glutamine transaminase expressed in active form | |
| US10294466B2 (en) | Alpha-glucosidase, compositions and methods | |
| US7122365B2 (en) | Glucoamylase variants | |
| CN107739734B (en) | Glutamine transaminase mutant with improved enzyme activity | |
| CN110582563B (en) | Cell-linked heterologous food and/or feed enzymes | |
| CN109321552B (en) | Novel pullulanase, gene thereof, engineering bacteria and preparation method | |
| CN102787130B (en) | Acid and high temperature resistant alpha-amylase, and its gene, engineering bacterium and preparation method | |
| CN107099565B (en) | Preparation method of gentiooligosaccharide | |
| CN109385413B (en) | Glucoamylase TlGA1931 and gene and application thereof | |
| CN110713996B (en) | Trehalase, and carrier and application thereof | |
| CN111471666A (en) | Glucoamylase mutant GA3 with improved specific activity and thermal stability as well as gene and application thereof | |
| CN108102997A (en) | A kind of bacillus subtilis for Pullulanase high efficient expression and High Density Cultivation | |
| US20220056496A1 (en) | Preparation of Thermophilic beta-Glucosidase and Application Thereof | |
| CN109022396B (en) | Alpha-amylase mutant with improved enzyme activity and application thereof | |
| CN110373403A (en) | High temperature resistant neutrality Pullulanase and its application | |
| CN110144320A (en) | A kind of genetic engineering bacterium and its zymotechnique producing maltotetraose forming amylase | |
| CN105969713B (en) | Genetic engineering bacterium for high yield of maltooligosyl trehalose hydrolase and application thereof | |
| CN107746836A (en) | A kind of glutamine transaminage mutant expressed in an active | |
| CN112592910A (en) | Glyceride lipase mutant and application thereof | |
| CN103981163A (en) | Fermentation process for promoting recombinant protein exocytosis | |
| CN107058263A (en) | A kind of high efficiency preparation method of new beta amylase | |
| CN102851266A (en) | Heat-resistant alpha-amylase and construction method of gene engineering bacteria thereof | |
| CN109825489A (en) | A kind of beta amylase and its application with hypersecretion ability | |
| CN101457230A (en) | High efficiency preparation method of high temperature alpha-amylase and mutant thereof | |
| CN115197924B (en) | Pullulanase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190820 |