CN110139952B

CN110139952B - Primer combination for constructing camelidae antibody variable region immune repertoire and application

Info

Publication number: CN110139952B
Application number: CN201680089897.7A
Authority: CN
Inventors: 李新洋; 杨乃波; 黄谧; 刘楚新; 曹丽霞; 丁权; 马莹莹; 王媚娘
Original assignee: BGI Shenzhen Co Ltd
Current assignee: BGI Shenzhen Co Ltd
Priority date: 2016-12-09
Filing date: 2016-12-09
Publication date: 2022-11-25
Anticipated expiration: 2036-12-09
Also published as: CN110139952A; WO2018103093A1

Abstract

Primer combination, kit and construction method of camelidae antibody variable region immune repertoire. The primer combination includes a primer capable of effectively annealing and binding to a leader region of the camelidae antibody V gene I family, a primer capable of effectively annealing and binding to a camelidae antibody J gene region, and a primer combination comprising these primers. After three rounds of nested polymerase chain reaction amplification are carried out by using corresponding primer combinations, a large-capacity camelid antibody immune repertoire on-machine library can be directly constructed.

Description

Primer combination for constructing camelidae antibody variable region immune repertoire and application

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a primer combination for constructing a camelidae antibody variable region immune repertoire and application thereof.

Background

Heavy chain antibodies are antibodies consisting of only heavy chains, a naturally deleted light chain found in camels by hamrs-Casterman, 1993, and are therefore referred to as heavy chain antibodies (HCAbs). The antigen binding site of such antibodies is formed only by the variable region VHH single domain of the heavy chain. VHH is one of the smallest molecular weight antibody fragments found so far with the function of binding antigen, has the molecular weight of 13-15KD, is only 1/10 of that of the conventional antibody, and is also called nanobody (nanobody). Compared with the traditional antibody, the VHH antibody has smaller molecular weight and is easy to express; the epitope is expressed with higher specificity and affinity when being recognized, and can recognize the epitope with unique conformation; meanwhile, compared with the traditional antibody, the VHH antibody has the characteristics of high solubility, high stability and the like, so that the research and development of the VHH antibody with important target molecule specificity becomes a new strategy for preparing new antibody medicines in recent years. The camelids of the present invention include, but are not limited to, bactrian camels (Camelus bactrianus, bactrian camel), dromedary camels (Camelus dromedarius), llama (llama, guanaco, alpaca), alpaca (vicuna), camels (Alpaca Suri, lamagama), vicuna (vigogyne), llama, and australian camels, etc.

The normal body B cell accounts for 10-40% of the total number of peripheral blood lymphocytes, and the diversity B cell mainly plays a role in generating antibodies to stimulate humoral immune response. The B cell antigen receptor (BCR) is an immunoglobulin for recognizing antigen on the surface of B cell, and hasHas antigen binding specificity. BCR is a tetrameric protein composed of two heavy chains, which can be divided into a variable region (V region), a constant region (C region), a transmembrane region, and a cytoplasmic region, and two light chains, which have only V and C regions. The V region consists of two structural domains, namely a heavy chain variable region (VH) and a light chain variable region (VL), which are all composed of three complementarity determining regions CDR1, CDR2 and CDR3, the arrangement sequence and the amino acid composition of the CDRs show high diversity, and the number of the B cell clone species can reach 10 in the same individual ⁹ -10 ¹⁰ The BCR library with huge capacity is formed, so that the individual has huge potential of recognizing various antigens and generating various specific antibodies. A B cell immune repertoire is constructed by using a PCR technology, a huge BCR sequence library corresponding to B cells in peripheral blood is obtained after sequencing, and screening of specific antibody sequences can be realized according to a certain biological information sequence screening standard. The capacity and composition of the immune repertoire will directly influence the subsequent screening process. The person skilled in the art therefore has endeavored to construct large-capacity immune repertoires.

Disclosure of Invention

The invention aims to provide a primer combination for constructing a camelidae antibody variable region immune repertoire and application thereof.

In a first aspect of the invention, there is provided a primer combination comprising a first upstream primer which can specifically anneal to a leader region of camelid antibody V gene family I (Clan I).

In another preferred embodiment, the first forward primer comprises one or more primer sequences selected from the group consisting of: SEQ ID No.11, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, and 44; preferably, the sequence of the first upstream primer is shown as SEQ ID NO. 11.

In another preferred embodiment, the primer combination further comprises a downstream primer; preferably, the sequence of the downstream primer is shown as SEQ ID NO. 45.

In another preferred embodiment, the primer combination further comprises a second forward primer that specifically anneals to a leader region of camelid antibody V gene family III (Clan III), preferably the second forward primer sequence is as shown in SEQ ID No. 46.

In another preferred embodiment, the primer combination further comprises a third upstream primer that specifically anneals to a leader region of camelid antibody V gene family II (Clan II), preferably the second upstream primer sequence is as shown in SEQ ID No. 53.

In a second aspect of the invention, there is provided a primer combination, each primer in the primer combination being a downstream primer that specifically anneals to a region of a camelidae antibody J gene and the primer combination comprising one or more primer sequences selected from the group consisting of: SEQ ID NO.54, 55, 56, and 57.

In another preferred embodiment, the primer combination further comprises an upstream primer; preferably, the sequence of the upstream primer is shown as SEQ ID NO. 58.

In a preferred embodiment, the primer combination comprises one or more primer sequences selected from the group consisting of: SEQ ID NO.47, 48, 49, 50.

In another preferred embodiment, the primer combination further comprises the primer combination of the first aspect of the present invention.

In a third aspect of the invention, a kit is provided, which comprises a primer combination according to the first aspect of the invention, and/or a primer combination according to the second aspect of the invention; and, optionally, PCR amplification reagents.

In another preferred embodiment, the kit further comprises an upstream primer CALL001 (5.

In a fourth aspect of the invention, there is provided a method of constructing a camelid antibody variable region immune repertoire, the method comprising the steps of:

(1) First round amplification

Providing nucleic acid from a camelid immune cell as a template and performing a first round of PCR amplification using a primer combination according to the first aspect of the invention to obtain a first round of amplification product;

(2) Second round of amplification

And (3) performing a second round of nested PCR amplification by using the primer combination of the second aspect of the invention and using the first round of amplification products as a template to obtain second round of amplification products.

In another preferred example, in step (1), the nucleic acid is cDNA reverse-transcribed from RNA of cellular origin.

In another preferred embodiment, the method further comprises the optional steps of:

(3) And (4) constructing an illumina library by using the second round amplification product as a template.

In another preferred example, in the step (1), after the amplification is completed, a gene fragment of 600-1100bp is recovered as the first round amplification product; preferably, 700-800bp of gene fragment is recovered to be used as a template for the next round of heavy chain antibody variable region amplification; preferably, a 900-1100bp gene fragment is recovered as a template for the next round of amplification of the heavy chain variable region of the conventional antibody.

In another preferred example, in the step (2), after the amplification is completed, a gene fragment of 300-600bp is recovered as the second round amplification product; preferably, a 400-500bp gene fragment is recovered as the second round amplification product.

In another preferred example, in the step (3), PCR amplification is performed by using the second round amplification product as a template and the P1 primer and the primer containing index marker as upstream and downstream primers, respectively, to obtain a library that can be directly used for constructing a sequencer.

In a fifth aspect of the present invention, there is provided a method of screening for a heavy chain antibody, the method comprising the steps of: constructing a heavy chain antibody variable region immune repertoire using the method of the fourth aspect of the invention; and, screening said heavy chain antibody in said heavy chain antibody variable region repertoire.

In another preferred example, the method for screening heavy chain antibody is a microorganism display technology such as bacteriophage, escherichia coli and the like and/or a bioinformatics analysis method.

In another preferred embodiment, the bioinformatics analysis method is N = mutation rate 0.4+ CDR3 abundance ratio 0.3+ CDR2 abundance ratio 0.2+ CDR1 abundance ratio 0.1) 100, and when N is more than or equal to 80, the target antibody sequence is determined.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1: schematic representation of three rounds of polymerase chain reaction to construct camelidae antibody variable region immune repertoire library. The leader region refers to a region located upstream after transcription of the antibody gene into mRNA, the V, D and J genes refer to three structural constituent genes of the antibody variable region, and the CH1 region, the hinge region, the CH2 region and the like refer to structural constituent genes of the antibody constant region.

Detailed Description

The present inventors have made extensive and intensive studies to obtain an upstream primer capable of efficiently annealing to a leader region of the V gene I family of camelidae antibodies; and a downstream primer capable of efficiently annealing to a camelid antibody J gene region. Experimental results show that the primer combination provided by the invention is used for three-wheel amplification in cooperation with other primers, a large-capacity camelidae antibody immune repertoire can be constructed, and a heavy chain antibody with high specificity and high affinity can be screened on the basis. On the basis of this, the present invention has been completed.

Before the present invention is described, it is to be understood that this invention is not limited to the particular methodology and experimental conditions described, as such methodologies and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, the term "about" when used in reference to a specifically recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now exemplified.

Construction of immune repertoire

The general method for constructing the heavy chain antibody immune repertoire is to take peripheral blood, separate Peripheral Blood Mononuclear Cells (PBMC) by using cell separation liquid, extract total RNA of cells, and obtain cDNA by reverse transcription. The variable region sequence was amplified by nested PCR using cDNA as template, and in the first round CALL001 (5 'GTCCTGGCTCTTCTACAAGG-3', SEQ ID NO. 46) and CALL002 (5 'GGTACGTCTGTTGAACTGTTCC-3', SEQ ID NO. 45) as primers to amplify the variable region to CH2 region, CALL001 was located in the leader sequence region of camelidae BCR V gene III family, CALL002 was located in the highly conserved region of CH2 domain, CALL001 and CALL002 amplified to obtain most variable region sequences. The 700-800bp fragment was recovered as a template for a second PCR enrichment of the VHH gene sequence using a forward primer VHH-forward (5 '-ATGGCTSAKGTGCAGCTGGTGGAGTCTGG-3', SEQ ID NO. 51) in combination with a forward primer VHH-reverse (5 '-AGAGACGGTGACCTGGGGT-3', SEQ ID NO. 52) in the III family region of the V gene and a downstream primer VHH-reverse (5 '-GGAGACGGTGACCTGGGGT-3', SEQ ID NO. 52) in combination with the J gene region. Where CALL refers to the camelid (camelid) abbreviation and VHH refers to the camelid heavy chain antibody variable region.

Among them, in the first round of PCR, only partial variable region sequences of camelid V gene family III can be covered due to the limitation of CALL001 primer, and V gene family I and II sequences are lost after the first round of PCR. In the second round of PCR, with only one pair of primers for sequence-based enrichment of VHH, the immune repertoire constructed could not contain all heavy chain variable regions. Furthermore, most of the existing literature and patents focus on the V gene family III and little attention is paid to V gene family I and II sequences, but many high affinity antibodies may also be derived from camelidae V gene families I and II (Clan families I and II).

In a preferred embodiment of the invention, in the first round of PCR, a combination of any one or more primers comprising a camelid antibody V gene family I (Clan I) leader region is used, the primers designed are shown in table 1; in the second round of PCR, a combination of primers comprising the J gene region of the Camelidae antibody was used, the primers designed being shown in Table 2. The first round of PCR is used for enriching heavy chain antibody genes and traditional antibody gene sequences, and gel cutting and distinguishing, and then the first round of PCR products are used as templates, and V region primers and J region primers are used for carrying out two rounds of amplification, so that an antibody immune repertoire is formed.

Table 1: leader primer sequence set of camelidae antibody V gene family I (Clan I)

Description of the drawings: the primers shown in Table 1 are upstream primers of the first round of PCR, can anneal to leader sequence region of BCR of camelidae antibody V gene I family, when constructing the camelidae immune repertoire, any one or more primers in Table 1 and downstream primers CALL002 (5-prime GGTACGTTGCTGTTGAACTGTTCC-3', SEQ ID NO. 45) amplify camelidae antibody V gene I family gene sequence, are used in combination with CALL001 (5-prime GTCCTGGCCTTTCTACAAGCAGG 3', SEQ ID NO. 46) and SEQ ID 5 (5-prime TGGTGGCAGGTCAAGGT-3', SEQ ID NO. 53) to amplify camelidae antibody V gene I, II and III family gene sequences. CALL001, CALL5 and CALL002 combined can amplify gene sequences of V gene II and III family. Any site base substitution of the primers shown in table 1, random cutting of any section in the middle, addition of the restriction enzyme sites and the protection bases before and after, and addition of any platform sequencing adaptor to form the primers, as long as the primers can amplify the corresponding target gene sequences, all belong to the protection scope of the claims of the present application.

Table 2: primer sequence set of J gene region of camelidae antibody

Table 3: camelidae antibody J gene region primer sequence set suitable for Illumina platform

Description of the invention: the primers shown in Table 2 are downstream primers of the second round of PCR, can anneal and bind to the camelidae antibody J gene family region, and are matched with the used upstream primers: VHH-forward5'-ATGGCTSAKGTGCAGCTGGTGGAGTCTGG-3' (SEQ ID No. 58). For different sequencing platforms, the downstream primer used in the second round of PCR is added with the linker sequence of the corresponding sequencing platform on the basis of Table 2, the underlined sequence in the primer in Table 3 is the Illumina library-building linker sequence, and the upstream primer is added with the linker sequence on the basis of SEQ ID NO.58, such as 5-CAGACGTGTGCTCTTCCGATCTAGATGGCTSAKGTGCAGCTGGTGGAGTCTGG-3' (SEQ ID NO. 51), the underlined sequence is the Illumina library-building linker sequence.

R shown in Table 2 and Table 3 represents any one of A and G; y represents any one of C and T; m represents any one of A and C; k represents any one of G and T; s represents any one of G and C; w represents any one of A and T. Any site base substitution of the primers shown in the table, randomly intercepting any section in the middle, adding the restriction enzyme sites and the protection bases before and after, and adding any platform sequencing joints before and after to form the primers, as long as the primers can amplify the corresponding target gene sequences, all belong to the protection scope of the claims of the present application.

The PCR products after two rounds of amplification can be combined with phage, escherichia coli and other microorganism display technologies to screen antibodies, and can also be combined with information analysis methods to perform antibody analysis and screening through a high-throughput technology.

Heavy chain antibody screening

Antibody screening of the obtained immune repertoire is conventionally performed using a phage display system. Generally comprising the steps of: using restriction enzyme to enzyme-cut the phage display vector and the immune repertoire VHH DNA fragment, and connecting to obtain a connection product; the ligation products were transformed into competent cells to construct a heavy chain antibody library. Adding the constructed phage display antibody library into an enzyme label plate coupled with corresponding antigen, performing specificity enrichment, washing off nonspecific phage to obtain phage specifically combined with the corresponding antigen, generating and purifying phage for the next screening, repeating the same screening process for 3-4 rounds, and gradually obtaining the enrichment.

After 3-4 rounds of screening, 1000 single colonies were selected from the cell culture dish containing the phage and inoculated for culture. And (3) crude extracting the antibody after the culture is finished, transferring the antibody into an ELISA plate coated by the corresponding antigen, and performing positive clone screening. Culturing positive clone bacteria, extracting plasmid and sequencing to obtain specific heavy chain antibody.

The main advantages of the invention are:

(1) A primer (SEQ ID NO. 11) capable of efficiently annealing to a leader region of a Camelidae antibody V gene I family is provided; and a region capable of efficiently annealing and binding to the J gene region of the camelidae antibody (a set of primer sequences shown in Table 2, using any one or more primers of the set of primers).

(2) The primer combinations provided by the invention are respectively used for three rounds of amplification, a large-capacity heavy chain antibody immune group library can be constructed, and on the basis, the heavy chain antibody with high specificity and high affinity can be screened out.

(3) Three rounds of amplification are performed by using the primer combinations provided by the invention respectively, and more comprehensive antibody immune repertoire containing atypical nano-antibodies and the like can be amplified. An atypical heavy chain antibody variable region (Non-classical VHH) has been reported, namely nanobodies containing four characteristic amino acids of traditional antibodies, which are reported as amino acids 42, 49, 50 and 52: valine, glycine, leucine and tryptophan.

(4) The method can realize three-step PCR to directly obtain the upper computer library without the complex steps of traditional terminal repair, A addition and machine joint addition.

(5) After the antibody immune repertoire is subjected to high-throughput sequencing, an antibody sequence library with huge data volume is obtained, and antibody sequences with potential high affinity aiming at target antigens can be directly screened from the sequence library according to screening standards established based on factors such as expression difference among samples, sequence mutation rate and abundance.

The present invention will be described in further detail with reference to specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures for conditions not specified in detail in the following examples are generally carried out under conventional conditions such as those described in molecular cloning, A laboratory Manual (Huang Petang et al, beijing: scientific Press, 2002) by Sambrook. J, USA, or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.

Example 1

1. In the aspect of primer design:

the reference sequences, arabidopsis IGH V-REGION, alpaca IGH V-REGION and Alpaca IGH J-REGION, on which primers are designed are derived from the International immunological database: (

the international ImMunoGeneTics information

http: i/www.imgt.org); primer design software is primer5.0 and Oligo7, etc. The diversity of the cloned species, i.e., the antibody sequences, in the immune repertoire is as large as 10 ⁸ In the above, the construction of the repertoire often depends on the polymerase chain reaction of multiple primers in order to cover a huge variety of primersAnd (4) sample property. The structure of antibody genes on the genome is shown in figure 1, and the antibody genes show higher conservation in a leader region and a framework region and high denaturation in a complementary binding region.

The design process of the primer comprises the following steps: since IMGT does not disclose the sequences of the leader region of the embryonal V gene I family recognized by most camelids such as dromedary bactrian camel, only the partial sequence of alpaca (alpaca) can be referred to, which causes difficulty in designing primers. Primers can only be designed based on sequence similarity between species, codon degeneracy and usage bias, and a few reported leader amino acid sequences to reverse deduce their nucleic acid sequence. Primers No.1, 4, 11, and 12, etc., as in Table 1 were finally designed based on the amino acid sequence MDWSWGALFLVAAGVHS retropulation in the literature (Ikbel Achour, et al. Tetrameric and Homodimetric primers IgGs origin from the Same IgH Locus. Doi: 10.4049/jimmonl.181.3.2001. The Journal of immunology.2008 Aug 1 181 (3): 2001-9.). The primer design principle of the invention is that a, the diversity of immune repertoire sequences can be covered as much as possible; b. the number of primers is reduced as much as possible, so that the competition among the primers is reduced; c. no serious self-primer dimer, hairpin structure, non-specific amplification and the like are formed.

2. Construction of antibody immune repertoire

(1) Extracting 10mL of peripheral blood of the immune camelid, separating peripheral blood mononuclear cells, and extracting RNA of the peripheral blood mononuclear cells;

(2) In the above steps, 2ug of RNA is the initial amount of reverse transcription, and cDNA is generated by reverse transcription; the following components are prepared according to the reverse transcription system and the reaction conditions, and the samples are subjected to ice bath for 5min at 65 ℃ for 7 min.

Then, the following ingredients were added to reverse transcription, and 4. Mu.L of each well was added. Reverse transcription was performed as follows: at 25 ℃ for 10min; at 42 ℃,2h;72 ℃ for 15min.

(3) Taking the cDNA obtained in the above steps as a template, taking leader primers (such as CALL001, CALL5 and primer No.11 in Table 1) as upstream primers, taking CALL002 as downstream primers, and performing a first round of ordinary PCR; and cutting the gel after the amplification, and recovering a 700bp-800bp region and a 900-1100bp fragment as a next round of amplification template. The PCR reaction conditions and system were as follows,

(4) The DNA recovered in the above steps is used as a template, and the band of the heavy chain antibody of the 700bp-800bp region is used as a template for amplifying the nano antibody (the heavy chain antibody variable region VHH); recovering 900-1100bp fragment as template for amplifying VH of heavy chain variable region of traditional antibody, using V gene region primer (VHH-forward: 5 '-CAGACGTGTGCTTCCGATCTAGATG-GCTSAGGTGCAGCTGTGGAGTCTGG-3', SEQ ID NO. 51) as upstream primer, using J gene region primer (SEQ ID NO.47, 48, 50 in Table 3 as downstream primer), and performing second round of common PCR; the PCR reaction system and conditions were as follows,

(5) The PCR product in the above step is used as a template and contains Hiseq library recognition of labeled Index _ X primer (5' -CAAGCAGAGACGGCATACGAGATACGAGAT (SEQ ID NO. 59)XXXXXXGTGACTGGAGTTCAGAGGTGTGTCTTCCGATCT (SEQ ID NO. 60) -3', whereinXXXXXXTo distinguish between the indexes of the library) as the upstream primer and the P1 primer (5 'AATGATTACGGCGGACCACCGAAGATCTACACTTCTCCCTACCACGACCGCTCTTCCGATCT 3', SEQ ID NO. 61) containing the linker of the Hiseq library as the downstream primer, the third PCR run of the Hiseq library construction was performed, the on-machine linker was added, and the data was generated by sequencing. Wherein the PCR reaction system and conditions are as follows:

3. antibody immune repertoire sequence analysis

After the alpaca antibody immune repertoire sequence constructed by the primers is subjected to second-generation high-throughput sequencing, and bioinformatics analysis by running Imonitor software, the basic analysis idea is to analyze and compare the immune repertoire sequence with the embryo system gene of the camelidae family in an international universal immune repertoire database IMGT (http:// www.imgt. Org/vquest/refseq. Html), so as to obtain the abundance information, the length distribution information and the J gene use information of the immune repertoire, namely the V gene use condition and the J gene use condition of the antibody immune repertoire data, wherein the diversity information of the immune repertoire is related to the invention.

Use of the V Gene and use of the J Gene

To illustrate only the analysis of the heavy chain antibody variable region (VHH) repertoire, IGHV1 represents the V gene of the camelidae V gene family I, and similarly IGHV2 represents the family II and IGHV3 represents the family III, as shown in Table 4. It can be seen that the three families of genes can be effectively amplified by using the primers mentioned in Table 1 and Table 3 of our invention; as shown in Table 4, all the J region gene types were amplified.

Table 4: alpaca antibody VHH immune repertoire V gene use

Description of the drawings: the antibody germline V genes in Table 4 refer to the Camelidae V gene family germline V gene subtype species in the International Universal immune Bank database IMGT that was obtained by analytical statistics; the reading number refers to the number of detected sequences matched with the corresponding V germ line genes, which are obtained by statistics after the offline data analysis of the immune group library samples; reads ratio (%): the sequence matched with the V germ line gene accounts for the proportion of all the off-machine sequences. As can be seen from the table, the use sequences of the V gene of the three major embryonic lines of IGHV1, IGHV2 and IGHV3 all comprise up to 35 ten thousand total reads, and the use number of the identified V gene subtypes accounts for 80% of the number of all the published V gene subtype of the alpaca (67/84, 84 for the embryonic V gene subtypes of the alpaca in IMGT). Naturally, the larger the antibody sequence repertoire (immune repertoire), the greater the likelihood of containing high affinity, high specificity antibody sequences. Such high throughput, second generation sequencing of nanobody sequence libraries has been less well documented. Generally speaking, the number of clones sequenced from the reported nanobody library is usually different from dozens to hundreds, and the flux is low; and the gene subtypes of three major embryonic lines, namely IGHV1, IGHV2 and IGHV3, are some and less in coverage.

Table 4: alpaca antibody immune repertoire J gene use condition

Description of the drawings: antibody germline J genes in the table refer to all germline gene classes of the camelidae J gene family in the international universal immune repertoire database IMGT; the reading number refers to the number of detected sequences matched with the corresponding V germ line genes, which are obtained by statistics after the offline data analysis of the immune group library samples; reads ratio (%): the sequence matched with the V germ line gene accounts for the proportion of all the off-machine sequences.

As can be seen from the table, the total number of reads is up to 35 ten thousand, and all the J gene subtypes can be identified (except for IGHJ1 which is a pseudogene, all the others can be identified analytically). Such high throughput, second generation sequencing of nanobody sequence libraries has been less well documented. Generally speaking, the number of clones sequenced from the reported nanobody library usually varies from tens to hundreds, and the throughput is low.

5. Bioinformatic screening of potential high affinity antibody sequences

The VHH immune repertoire of the heavy chain antibody variable region is sequenced, the quantity is large, a plurality of sets of strict and reasonable sequence screening standards are established for the VHH immune repertoire, and screening priority scoring sequencing is carried out on all sequences. As mentioned above, the number of sequence libraries in this example reaches 350000, and here, only one set of screening criteria (scoring formula) is taken as an example, and the total score = (mutation rate 0.4+ CDR3 abundance ratio 0.3+ CDR2 abundance ratio 0.2+ CDR1 abundance ratio) 100. The length of all matched sequences is compared with the inconsistent base number when the antibody sequence obtained by mutation rate sequencing is matched with the IMGT embryonic system reference gene. Sequencing the sequences according to the fraction calculated by the formula can screen out antibody sequences with a score higher than 80 in a high-throughput manner, and the antibodies expressed by the sequences are considered to have potential high affinity.

Discussion:

the B cells for constructing the immune repertoire mainly come from active immunization of organisms through target antigens or memory B cells infected by pathogens in vivo, the larger the capacity of the immune repertoire is, the more beneficial to screening antibody sequences with high affinity is, once the construction of the related antibody repertoire is completed, the screening of specific antibodies can be carried out, and meanwhile, the high-throughput screening of the antibodies can be realized depending on corresponding screening equipment. Therefore, by integrating the advantages of screening VHH antibodies and immune repertoires, a large-capacity camelidae antibody sequence database can be quickly and directly obtained after sequencing by virtue of the camelidae primer and the three-step library construction scheme, the database has the advantages of comprehensive germ line V gene subtypes, reasonable structure, capability of covering atypical nano antibodies and the like, provides an enough antibody sequence library for screening out high-affinity antibodies, and lays a foundation for screening specific VHH antibodies.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Shenzhen Hua Dagene institute

<130> P2019-0418

<160> 61

<170> PatentIn version 3.5

<210> 1

<211> 34

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

tcctggtggc agtggctgca ggtgtccact cgca 34

<210> 2

<211> 26

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

ggtccagctg gtgcagccag gggctg 26

<210> 3

<211> 27

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

atggactgga gctggggagc cctcttc 27

<210> 4

<211> 30

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

ctggtggcag tggctgcagg tgtccactcg 30

<210> 5

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

gggagccctc ttcctggt 18

<210> 6

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

ttcctggtgg cagtggct 18

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

caggtgtcca ctcgcaggtc 20

<210> 8

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

ccctcttcct ggtggcagt 19

<210> 9

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

ggcagtggct gcaggtgt 18

<210> 10

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

tggctgcagg tgtccactc 19

<210> 11

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 11

caggtgtcca ctcgcaggt 19

<210> 12

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 12

gtgtccactc gcaggtcca 19

<210> 13

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 13

ttcttggtgg cagtagccgc agt 23

<210> 14

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 14

cttcctggtg gcagtggct 19

<210> 15

<211> 26

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 15

gactggagct ggggagccct cttcct 26

<210> 16

<211> 32

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 16

gccctcttcc tggtggcagt ggctgcaggt gt 32

<210> 17

<211> 28

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 17

ctggtggcag tggctgcagg tgtccact 28

<210> 18

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 18

ctggagctgg ggagccctct tcctg 25

<210> 19

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 19

gctgcaggtg tccactcgca ggtcc 25

<210> 20

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 20

tggagctggg gagccctctt cct 23

<210> 21

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 21

gggagccctc ttcctggtgg cag 23

<210> 22

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 22

gtggcagtgg ctgcaggtgt cca 23

<210> 23

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 23

atggactgga gctgggga 18

<210> 24

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 24

ggagccctct tcctggtg 18

<210> 25

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 25

tcctggtggc agtggctg 18

<210> 26

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 26

tggtggcagt ggctgcag 18

<210> 27

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 27

ggtgtccact cgcaggtcc 19

<210> 28

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 28

tggctgcagg tgtccact 18

<210> 29

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 29

tgcaggtgtc cactcgca 18

<210> 30

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 30

ggtgtccact cgcaggtc 18

<210> 31

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 31

tccactcgca ggtccagc 18

<210> 32

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 32

tggactggag ctgggg 16

<210> 33

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 33

gagctgggga gccctc 16

<210> 34

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 34

ctggggagcc ctcttc 16

<210> 35

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 35

agccctcttc ctggtg 16

<210> 36

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 36

tcttcctggt ggcagt 16

<210> 37

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 37

cctggtggca gtggct 16

<210> 38

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 38

gtggcagtgg ctgcag 16

<210> 39

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 39

gcagtggctg caggtg 16

<210> 40

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 40

tggctgcagg tgtcca 16

<210> 41

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 41

ctgcaggtgt ccactc 16

<210> 42

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 42

caggtgtcca ctcgca 16

<210> 43

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 43

ccactcgcag gtccag 16

<210> 44

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 44

ggctgcaggt gtccactcgc ag 22

<210> 45

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 45

ggtacgtgct gttgaactgt tcc 23

<210> 46

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 46

gtcctggctg ctcttctaca agg 23

<210> 47

<211> 41

<212> DNA

<213> Artificial sequence (Artificial sequence)

<220>

<221> misc_feature

<222> (26)..(26)

<223> m is a or c

<220>

<221> misc_feature

<222> (27)..(27)

<223> r is a or g

<220>

<221> misc_feature

<222> (40)..(40)

<223> w is a or t

<400> 47

ctacacgacg ctcttccgat ctctgmrgag acggtgaccw g 41

<210> 48

<211> 40

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 48

ctacacgacg ctcttccgat ctggagacgg tgacctgggt 40

<210> 49

<211> 56

<212> DNA

<213> Artificial sequence (Artificial sequence)

<220>

<221> misc_feature

<222> (26)..(26)

<223> m is a or c

<220>

<221> misc_feature

<222> (27)..(27)

<223> r is a or g

<220>

<221> misc_feature

<222> (45)..(45)

<223> s is g or c

<220>

<221> misc_feature

<222> (48)..(48)

<223> y is c or t

<220>

<221> misc_feature

<222> (50)..(50)

<223> k is g or t

<400> 49

ctacacgacg ctcttccgat ctctgmrgag acggtgaccw gggtsccytk gcccca 56

<210> 50

<211> 40

<212> DNA

<213> Artificial sequence (Artificial sequence)

<220>

<221> misc_feature

<222> (23)..(23)

<223> k is g or t

<400> 50

ctacacgacg ctcttccgat ctkgagacag tgaccagggt 40

<210> 51

<211> 53

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 51

cagacgtgtg ctcttccgat ctagatggct sakgtgcagc tggtggagtc tgg 53

<210> 52

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 52

ggagacggtg acctgggt 18

<210> 53

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 53

tggtggcagg tccccaaggt 20

<210> 54

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<220>

<221> misc_feature

<222> (4)..(4)

<223> m is a or c

<220>

<221> misc_feature

<222> (5)..(5)

<223> r is a or g

<220>

<221> misc_feature

<222> (18)..(18)

<223> w is a or t

<400> 54

ctgmrgagac ggtgaccwg 19

<210> 55

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 55

ggagacggtg acctgggt 18

<210> 56

<211> 34

<212> DNA

<213> Artificial sequence (Artificial sequence)

<220>

<221> misc_feature

<222> (4)..(4)

<223> m is a or c

<220>

<221> misc_feature

<222> (5)..(5)

<223> r is a or g

<220>

<221> misc_feature

<222> (18)..(18)

<223> w is a or t

<220>

<221> misc_feature

<222> (26)..(26)

<223> y is c or t

<220>

<221> misc_feature

<222> (28)..(28)

<223> k is g or t

<400> 56

ctgmrgagac ggtgaccwgg gtsccytkgc ccca 34

<210> 57

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<220>

<221> misc_feature

<222> (1)..(1)

<223> k is g or t

<400> 57

kgagacagtg accagggt 18

<210> 58

<211> 53

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 58

cagacgtgtg ctcttccgat ctagatggct sakgtgcagc tggtggagtc tgg 53

<210> 59

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 59

caagcagaag acggcatacg agat 24

<210> 60

<211> 34

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 60

gtgactggag ttcagacgtg tgctcttccg atct 34

<210> 61

<211> 58

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 61

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatct 58

Claims

1. A primer combination comprising a first upstream primer and a downstream primer that can specifically anneal to a leader region of camelid antibody V gene family I (Clan I), wherein the first upstream primer comprises the following primer sequences: SEQ ID No.11, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, and 44, said primer combination further comprising a second upstream and downstream primer that specifically anneals to a leader region of camelidae antibody V gene family III (Clan III), said second upstream primer sequence being set forth in SEQ ID No.46, a third upstream and downstream primer that specifically anneals to a leader region of camelidae antibody V gene family II (Clan II), said third upstream primer sequence being set forth in SEQ ID No.53, and said downstream primer sequence being set forth in SEQ ID No. 45;

and the primer combination also comprises a downstream primer and an upstream primer which are specifically annealed and combined with the J gene region of the camelidae antibody, the sequence of the downstream primer is shown as SEQ ID NO.54, 55, 56 and 57, and the sequence of the upstream primer is shown as SEQ ID NO. 58.

2. The primer combination of claim 1, wherein the primer combination comprises an upstream primer and a downstream primer for amplifying VH of a heavy chain variable region of a traditional antibody, wherein the upstream primer is a V gene region primer with a sequence of SEQ ID No.51, and the downstream primer is a J gene region primer with a sequence of SEQ ID No.47, 48, 50.

3. A kit comprising the primer combination of claim 1, wherein the kit optionally comprises PCR amplification reagents.

4. A method of constructing a camelid antibody variable region immune repertoire using the primer combination of claim 1, comprising the steps of:

(1) First round amplification

Providing nucleic acid from a camelid immune cell as a template, performing a first round of PCR amplification using a primer combination comprising a first upstream primer and a downstream primer that can specifically anneal to a leader region of camelid antibody V gene family I (Clan I), wherein the first upstream primer comprises the following primer sequences: SEQ ID No.11, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, and 44, said primer combination further comprising a second upstream and downstream primer that specifically anneals to a leader region of camelidae antibody V gene family III (Clan III), said second upstream primer sequence being set forth in SEQ ID No.46, a third upstream and downstream primer that specifically anneals to a leader region of camelidae antibody V gene family II (Clan II), said third upstream primer sequence being set forth in SEQ ID No.53, and said downstream primer sequence being set forth in SEQ ID No. 45;

(2) Second round of amplification

And (2) performing second round nested PCR amplification by using the first round amplification product as a template and a primer combination to obtain a second round amplification product, wherein the primer combination comprises a downstream primer and an upstream primer which are specifically annealed and combined to a gene region of a camelidae antibody J, the sequence of the downstream primer is shown as SEQ ID No.54, 55, 56 and 57, and the sequence of the upstream primer is shown as SEQ ID No. 58.

5. The method of claim 4, wherein in step (1), the nucleic acid is cDNA reverse-transcribed from RNA derived from the cell.

6. The method of claim 4, further comprising the optional step of:

(3) And (3) constructing an illumina library by taking the second round amplification product as a template.

7. The method of claim 4, wherein in step (1), after the amplification is completed, a gene fragment of 600-1100bp is recovered as the first round amplification product.

8. The method according to claim 4, wherein in the step (2), after the amplification is completed, a gene fragment of 300-600bp is recovered as the second round amplification product.

9. The method of claim 6, wherein in the step (3), PCR amplification is performed by using the second round amplification product as a template and the P1 primer and the index-labeled primer as an upstream primer and a downstream primer respectively to obtain a library which can be directly used for constructing a sequencer.

10. A method of screening for heavy chain antibodies using the method of claim 4, comprising the steps of: screening the heavy chain antibody variable region repertoire constructed by the method of claim 4 for the heavy chain antibody.

11. The method of claim 10, wherein the heavy chain antibody is selected by a display technique using a microorganism such as phage or E.coli.