CN110133286A - Medical application of the HSP60 gene as target spot in meningitis treatment - Google Patents
Medical application of the HSP60 gene as target spot in meningitis treatment Download PDFInfo
- Publication number
- CN110133286A CN110133286A CN201910418982.9A CN201910418982A CN110133286A CN 110133286 A CN110133286 A CN 110133286A CN 201910418982 A CN201910418982 A CN 201910418982A CN 110133286 A CN110133286 A CN 110133286A
- Authority
- CN
- China
- Prior art keywords
- hsp60
- meningitis
- hspd1
- eno
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/26—Infectious diseases, e.g. generalised sepsis
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Medical application the invention discloses HSP60 gene as target spot in meningitis treatment, the mechanism of action of the phenomenon that inducing brain microvessel endothelial cells in vitro apoptosis using SS2 virulence factor ENO and HSP60 interaction and HSP60 in this process discloses purposes of the HSP60 gene as target spot in meningitis treatment；The present invention for ENO induction brain microvessel endothelial cells in vitro Apoptosis mechanism illustrate help it is huge, also provide important theoretical basis for the research of Streptococcus suis meningitis therapeutic agent, be of great significance to the prevention and treatment of Streptococcus suis meningitis.
Description
Technical field
Medical application the invention discloses HSP60 gene as target spot in meningitis treatment, can using HSP60 gene
The meningitis pathogenesis for participating in SS2 induction prepares the drug for the treatment of meningococcal disease as target spot, belongs to medical domain.
Background technique
Meningitis is ten to lead to dead one of disease due to infecting greatly in the world, mainly due to that can induce
The bacterial pathogen of meningitis causes the inflammation of meninx or/and brain parenchym position with blood flow invasion blood-brain barrier, finally
Central nervous system disorder is caused, a variety of nervous symptoms are shown.Streptococcus suis 2-type (Streptococcus suis Type2,
SS2) be a kind of inducible people and pig meningitis cause of disease, meningitis patient often shows as dizziness, incoordination, headache, mouth
It foams at the mouth, tonic neck is shunk, and fever, nausea, deafness etc., the death rate is high, and prognosis is often accompanied by permanent hearing function
The neurological sequelaes such as obstacle.Bacterium can cause central nervous system by blood-brain barrier (BBB) by its exclusive mechanism
(CNS) drug for infecting, and treating infection can not reach the target area for the treatment of by barrier, this is that meningitis prevention and treatment is tired
Difficult key point, simultaneously because meningitis treatment cost is expensive, but also limitation is compared in the treatment of meningitis.
HSP60 is a kind of functional protein, almost has presence in all organisms from bacterium to the mankind.When thin
When born of the same parents are stimulated by some distress, HSP60 can be synthesized rapidly in the cell, and with the albuminate knot under stress
It closes, promotes other intracellular organelles to play a role, so that body be protected to resist pessimal stimulation.Existing research report confirmation,
HSP60 can assist in the folding of albumen in prokaryotic cell, and the physiology machine of the various albumen of body is able to maintain that in eukaryocyte
Energy and homeostasis.Meanwhile HSP60 is also closely bound up with the proliferation of cell and apoptosis, cascades with the interaction of caspase
Reaction can cause Apoptosis.
Summary of the invention
The invention discloses a kind of HSP60 gene as target spot meningitis treatment in purposes, using HSP60 gene as
Target proteins in SS2 meningitis pathogenic course are as a kind of meningitis clinical detection index；The host cell of SS2 invasion simultaneously
With HSP60 interaction occurs for virulence factor Eno in course of infection, by inhibiting the expression for reducing internal HSP60 that can significantly mention
The survival rate of high animal protects blood-brain barrier.
Apoptosis occurs for the important composition cell brain microvessel endothelial cells in vitro that SS2 virulence factor Eno will lead to blood-brain barrier, together
Interaction occurs for Shi Huiyu HSP60, and increases it in expression quantity intracellular and extracellular, so that the integrality of blood-brain barrier is by broken
It is bad, it in turn results in bacterium and CNS is further infected.The present invention inhibits the expression of HSP60 in brain tissue that can significantly protect blood brain
The integrality of barrier, while the survival rate of streptococcal infection mouse can be improved, function and effect are significant, are meningitis therapeutic agent
Screening provides reference.
Following tests proves purposes of the HSP60 gene of the present invention as target spot in meningitis treatment:
1, HSP60 expression quantity changes the influence to Apoptosis
Increase the expression quantity of HSP60 by overexpression HSP60 intracellular, extracellular addition HSP60 albumen, RNA intracellular interferes HSP60
The expression quantity that HSP60 is reduced with extracellular antibody blocking detects the apoptosis situation of brain microvessel endothelial cells in vitro.
2, drop mouse HSP60 genetic test blood-brain barrier permeability is struck
(1) drop ICR mouse brain HSP60 is struck using the adeno-associated virus (AAV9) for carrying interference HSP60 tiny RNA (shHSP60)
The expression of gene.The expressing viral green fluorescent protein (EGFP) of shHSP60 is carried, the expressing viral for carrying shControl is green
Color fluorescin (EGFP), after brain is inoculated with viral interference 2 months, brain frozen section Fluirescence observation virus infection is in brain
Distribution situation, while the expression of WB analysis brain HSP60.
(2) it is utilized respectively the ICR mouse model that Eno and SS2 infection is established, dissect observation is carried out to different group mouse brains
With EB permeabilization assay.
3, SS2 infecting mouse survival rate detects
The each group ICR mouse model that SS2 infection is established, the survival rate situation of continuous observation each group mouse.
By it is above-mentioned experiments have shown that SS2 virulence factor ENO induce brain microvessel endothelial cells in vitro occur apoptosis during,
The high expression of HSPD1 can significantly promote the generation of Apoptosis, inhibit HSPD1 that can protect the integrality of blood-brain barrier, improve SS2
The survival rate of mouse after infection.
In various bacterial meningitis, HSP60 is the target molecules of bacterium surface adherency, with streptococcus pneumonia, meninx
Scorching Neisseria, haemophilus influenzae and Escherichia coli are related to the adherency and invasion of brain microvessel endothelial cells in vitro.
SS2 virulence factor Eno can destroy blood brain screen by induction brain microvessel endothelial cells in vitro apoptosis in the present invention
Hinder (BBB), as foreign protein, with the receptor HSP60 of cell surface interaction occurs for Eno, so that RPSA expression quantity significantly increases；
HSP60 plays a significant role during SS2 infects and invades host；Also disclose the expression for inhibiting RPSA in brain tissue
The integrality of blood-brain barrier can be significantly protected, while the survival rate of streptococcal infection mouse can be improved, this method function and effect are aobvious
It writes, provides reference for the screening of meningitis therapeutic agent.
The positive effect of the present invention is:
Disclose medical application of the HSP60 albumen in meningitis treatment；It is induced using SS2 virulence factor ENO and HSP60 interaction
The phenomenon that brain microvessel endothelial cells in vitro apoptosis and HSP60 mechanism of action in this process, disclose HSP60 gene as target spot
Purposes in meningitis treatment；The present invention for ENO induction brain microvessel endothelial cells in vitro Apoptosis mechanism illustrate help it is huge,
Also important theoretical basis is provided for the research of Streptococcus suis meningitis therapeutic agent, to the anti-jig of Streptococcus suis meningitis
It is of great importance.
Detailed description of the invention
Fig. 1 is expression and purification electrophoretogram (A: the PCR(1-3 swimming lane of expression vector establishment) and the digestion of ENO albumen of the present invention
It identifies (4-6 swimming lane)；M:DL2000 DNA marker；The SDS-PAGE of B:Eno expression is analyzed；WB points of C:Eno expression
Analysis)；
Fig. 2 be HSPD1 gene PCR amplification of the present invention and pET28a-HSPD1 PCR qualification result electrophoretogram (M:
DL2000 DNA marker；1. HSPD1 gene PCR amplification；The PCR qualification result of 2-3. pET28a-HSPD1)；
Fig. 3 is the SDS-PAGE result electrophoretogram of the protein induced expression of HSPD1 of the present invention；
Fig. 4 is that the Western blot of HSPD1 albumen of the present invention identifies electrophoretogram；
Fig. 5-1 is present invention overexpression HSPD1 Level of Apoptosis figure intracellular；
Fig. 5-2 is the extracellular addition HSPD1 albuminous cell apoptosis situation map of the present invention；
Fig. 5-3, which is that the present invention is intracellular, strikes drop HSPD1 Level of Apoptosis figure；
Fig. 5-4 is the extracellular HSPD1 antibody blocking Level of Apoptosis figure of the present invention；
Fig. 6 is the Fluirescence observation result and WB result figure that mouse brain of the present invention strikes drop HSP60；
Fig. 7 is that mouse brain of the present invention strikes drop HSP60 to the influence diagram of blood-brain barrier permeability；
Fig. 8 is the survival results figure that drop HSP60 mouse is struck in Eno of the present invention and SS2 infection.
Specific embodiment
By following implementation, further citing description is of the invention, does not limit the invention in any way, without departing substantially from this
Under the premise of the technical solution of invention, those of ordinary skill in the art made for the present invention any change easy to accomplish
Or changes and fall within scope of the presently claimed invention.
Test material
Eno albumen, HSP60 albumen are obtained by this laboratory expression and purification, HSP60 eukaryon expression plasmid, HSP60 RNA interfering
Plasmid, ICR healthy mice carry the adeno-associated virus (AAV9-shHSP60) of the shRNA of HSP60.
Test example 1:
1, the expression and purification of ENO albumen
It establishes the prokaryotic expression carrier pET23a-Eno, PCR that can stablize expression Eno and digestion qualification result shows expression vector
It constructs successfully (referring to Figure 1A), conversion to BL21(DE3), which is that BL21-Eno, SDS-PAGE and WB analyze result
Show that it can stablize expression Eno(referring to Figure 1B-C without IPTG induction；Fig. 1 A: expression vector establishment
PCR(1-3 swimming lane) and digestion identification (4-6 swimming lane)；M:DL2000 DNA marker；The SDS-PAGE of B:Eno expression
Analysis；The WB analysis of C:Eno expression)；
2, the expression and purification of HSP60 albumen
Referring to the pig HSPD1 gene order announced in NCBI, the specificity of 5.0 biological software of Primer design HSPD1 is utilized
Primer, amplification obtain the HSPD1 genetic fragment of 1719 bp；The restriction enzyme site of upstream and downstream is respectively as follows:BamHI,NdeI, upstream and downstream
Primer sequence is shown in Table 1.1:
1.1 HSPD1 gene cloning primer of table
| Name | Primer sequence(5’-3’) |
| pET28a-HSPD1-F | CGCGGATCCATGCTTCGGTTAC |
| pET28a-HSPD1-R | GGGAATTCCATATGGAACATGCCACC |
It is template that reverse transcription, which obtains cell cDNA, and using F, R as primer, specific amplification obtains HSPD1 gene (A referring to fig. 2)；Tool
The PCR amplification system of body is shown in Table 1.2:
1.2 PCR reaction system of table
| Number | Component | Quantity(ul) |
| 1 | Plasmid template | 1ul |
| 2 | pET28a-HSPD1-F | 1ul |
| 3 | pET28a-HSPD1-R | 1ul |
| 4 | dNTP | 4ul |
| 5 | rTaq | 0.5ul |
| 6 | Buffer(10×) | 5ul |
| 7 | Sterile ddH2O | 37.5ul |
| 8 | Total volume | 50ul |
The amplification program of PCR are as follows: 94 DEG C of 5 min；94 ℃ 30 s；60 ℃ 30 s；72 ℃ 90 s；72 DEG C extend 10
min；Totally 32 circulations.PCR product is identified through 0.8% agarose gel electrophoresis, recycles, purify.By the HSPD1 gene of purifying
Segment and pET28a plasmid are usedBamHI enzyme andNdeI enzyme is distinguished digestion 2 hours in 37 DEG C of water-baths, and digestion products are through 0.8% fine jade
After sepharose electroresis appraisal is correct, glue recycling is done.By glue digestion pET28a carrier after the recovery and HSPD1 segment through T4
16 DEG C of DNA ligase is connected and is converted to Escherichia coli overnightDHIn 5 α competence, linked system is shown in Table 1.3.
1.3 coupled reaction system of table
| Number | Component | Quantity (ul) |
| 1 | pET28a | 4.5 |
| 2 | HSPD1 fragments | 1.5 |
| 3 | 10×T4 DNA Ligase Buffer | 1 |
| 4 | T4 DNA Ligase | 0.5 |
| 5 | Sterile ddH2O | 2.5 |
| 6 | Total volume | 10 |
The E. coli clones containing target gene are screened by Kana resistant panel, chooses after bacterium expands culture, extracts
Plasmid simultaneously carries out PCR identification (B referring to fig. 2), and reaction system is shown in Table 1.4.The positive recombinant plasmid of identification is named as
PET28a-HSPD1:
1.4 PCR of table reaction identification
| Number | Component | Quantity (ul) |
| 1 | pET28a-HSPD1 | 4.5 |
| 2 | pET28a-HSPD1-F | 0.4 |
| 3 | pET28a-HSPD1-R | 0.4 |
| 4 | dNTP | 1.5 |
| 5 | rTaq | 0.2 |
| 6 | Buffer(10×) | 2 |
| 7 | Sterile ddH2O | 14.5 |
| 8 | Total volume | 20 |
Recombinant plasmid pET28a-HSPD1 is transferred to E. coli expression strainsBLIn 21 competence, sieved through Kana resistant panel
Select the E. coli clones containing target gene.It chooses bacterium and is added in the LB liquid medium containing Kana resistance and be incubated overnight,
The bacterium solution being incubated overnight is added in the conical flask for filling LB liquid medium in the ratio of 1:100,37 DEG C, 200 rpm training
It supports to OD600=0.6, IPTG is added, is placed in 16 DEG C of shaking tables inducing expression overnight.
After HSPD1 inducing expression, 4 DEG C thalline were collected by centrifugation.Ultrasonication after thallus is resuspended with protein purification mother liquor, because
It is soluble protein for purpose albumen HSPD1, supernatant, the supernatant protein warp of acquisition is collected by centrifugation in 4 DEG C of liquid after taking ultrasound
0.45 μm of membrane filtration removes impurity, is then added to combining 10 in the processed protein purification nickel ion chelate column of equilibrium liquid
Then min is successively washed with the imidazole wash liquid of various concentration, finally elute albumen with the equilibrium liquid containing 250 mM imidazoles,
Collect destination protein eluent.
The supernatant inclusion body of bacterium solution ultrasonication carries out respectively after full bacterium, induction after full bacterium, induction before taking IPTG to induce
There is apparent protein band at 60 kDa in SDS-PAGE analysis, coomassie brilliant blue staining observation discovery, and size is tied with expected
Fruit is consistent, it was demonstrated that HSPD1 albumen successful expression and be soluble protein (Fig 1.2).Collect the eluents of 250 mM imidazoles into
Row SDS-PAGE analysis, HSPD1 protein band is single as the result is shown, illustrates that protein purification result is good, successful purification obtains
HSPD1 albumen is (referring to Fig. 3；M. albumen Marker；1. full bacterium before inducing；2. full bacterium after induction；3. supernatant after induction；4.
It is precipitated after induction；5. HSPD1 albumen after purification)；
5 × albumen sample-loading buffer, 4 ul boiling water boiling, 10 min is added, then in 16 ul of HSPD1 protein solution for taking purifying to obtain
SDS-PAGE is carried out, runs and closes 1 h with 5% skimmed milk power under glue, transferring film, 37 DEG C of environment, be then successively incubated for primary antibody and secondary antibody,
It finally is exposed observation with exposure instrument, detects the expression of HSPD1 albumen.
His label is had on the expression vector of HSPD1 after purification, we carry out HPSD1 albumen after purification respectively
1.3 A of HSPD1(Fig) and His label (1.3 B of Fig) antibody incubation, WB, which is detected, the appearance of purpose protein band, explanation
HSPD1 albumen successful expression, and purify and obtained HSPD1 albumen (referring to fig. 4, M. albumen Marker；1. purifying protein HSPD1
Antibody test；2. purifying protein His antibody test).
Test example 2
HSP60 expression quantity changes the identification influenced on Apoptosis
1, transfection HSP60 eukaryon expression plasmid is overexpressed HSP60 intracellular.First by X-treme GENE HP DNA transfection reagent,
HSP60 eukaryon expression plasmid, opti-MEM dilution are balanced to 15 DEG C -25 DEG C, and of short duration vortex mixes X-treme GENE HP
DNA transfection reagent；DNA is diluted to final concentration of 1ug plasmid/100ulopti-MEM dilution using opti-MEM dilution
(0.01ug/ul), it is soft to mix；X-treme GENE HP DNA transfection reagent is added in above-mentioned mixed liquor, is sure not to contact
It is soft to mix to plastic tube wall；Above-mentioned transfection composite 15min is incubated at 15 DEG C -25 DEG C；Finally transfection composite is added dropwise
Enter into six orifice plate cells, transfection adds 20ug/ml Eno effect for 24 hours afterwards for 24 hours, cell flow cytometer detection Apoptosis situation
(referring to Fig. 5-1)；
2, the extracellular addition 20ug/ml extracellular HSP60 of HSP60 protein overexpression, while being separately added into 20ug/ml Eno effect
For 24 hours, cell flow cytometer detection is overexpressed influence of the intracellular and extracellular HSP60 to Apoptosis (referring to Fig. 5-2)；
3, the expression of HSP60 intracellular is reduced by transfecting the RNA interference plasmid of HSP60；First by X-treme GENE HP RNA
Transfection reagent, the RNA interference plasmid of HSP60, opti-MEM dilution are balanced to 15 DEG C -25 DEG C, and of short duration vortex mixes X-treme
GENE HP RNA transfection reagent；RNA is diluted to final concentration of 1ug RNA/100ul opti- using opti-MEM dilution
MEM dilution (0.01ug/ul) is soft to mix；X-treme GENE HP RNA transfection reagent is added to above-mentioned mixed liquor
In, it is sure not to touch plastic tube wall, it is soft to mix；Above-mentioned transfection composite 15min is incubated at 15 DEG C -25 DEG C；It finally will transfection
Complexes drop-wise is added in six orifice plate cells, and transfection adds 20ug/ml Eno effect for 24 hours afterwards for 24 hours, and cell flow cytometer detection is thin
Born of the same parents' apoptosis situation (referring to Fig. 5-3)；
4, the extracellular HSP60 of HSP60 antibody blocking of extracellular addition 0.1ug/ul, while being separately added into 20ug/ml Eno effect
For 24 hours, cell flow cytometer detection reduces influence of the intracellular and extracellular HSP60 to Apoptosis (referring to Fig. 5-4).
Test example 3
Strike drop mouse HSP60 genetic test blood-brain barrier permeability
1, low ICR mouse brain is struck using the adeno-associated virus (AAV9) for carrying interference HSP60 tiny RNA (shHSP60) first
The expression of HSP60 gene.Carry the expressing viral green fluorescent protein (EGFP) of shControl and shHSP60.Brain inoculation is dry
Virus is disturbed after 2 months, brain frozen section Fluirescence observation is the results show that virus infection is widely distributed in brain；WB analyzes brain
The expression of HSP60, the results showed that shHSP60 interference group HSP60 protein expression reduces, i.e., has successfully struck mouse brain low
The expression of HSP60 gene (referring to Fig. 6)；
2, the ICR mouse model established using Eno and SS2 difference tail vein injection infection, mouse tail vein injection after infection for 24 hours
Evans Blue(EB) dyestuff, dissect observation is carried out to different infected group mouse brains afterwards for 24 hours and analyzes the permeability of EB, dissect knot
Fruit and EB extracting interpretation of result discovery strike low HSP60 and SS2 infecting mouse brain significantly reduce (referring to figure the permeability of EB
7)；The expression for striking low HSP60 is observed simultaneously but also Eno reduces BBB extent of the destruction, the above result shows that HSP60 is mediated
Destruction of the Eno/SS2 to mouse brain.
Test example 4
Mouse survival rate detection
Eno and SS2 infects the ICR mouse model of foundation respectively, as a result the survival rate situation of each processing group mouse of continuous observation is shown
Show that SS2 infection is struck drop HSPD1 mouse survival rate and significantly improved (referring to Fig. 8).
Claims (1)
1. purposes of the HSP60 gene as target spot in meningitis treatment.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910418982.9A CN110133286A (en) | 2019-05-20 | 2019-05-20 | Medical application of the HSP60 gene as target spot in meningitis treatment |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910418982.9A CN110133286A (en) | 2019-05-20 | 2019-05-20 | Medical application of the HSP60 gene as target spot in meningitis treatment |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110133286A true CN110133286A (en) | 2019-08-16 |
Family
ID=67571586
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910418982.9A Pending CN110133286A (en) | 2019-05-20 | 2019-05-20 | Medical application of the HSP60 gene as target spot in meningitis treatment |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110133286A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1665533A (en) * | 2002-05-02 | 2005-09-07 | 康涅狄格大学健康中心 | Use of heat shock proteins to enhance efficacy of antibody therapeutics |
| US20060039922A1 (en) * | 1997-12-31 | 2006-02-23 | Stressgen Biotechnologies Corporation, A Canadian Corporation | Streptococcal heat shock proteins of the Hsp60 family |
| CN101453998A (en) * | 2006-06-01 | 2009-06-10 | 维乐罗吉克有限公司 | Pharmaceutical composition for the treatment of viral infections and/or tumor diseases by inhibiting protein folding and protein breakdown |
| CN103789422A (en) * | 2014-01-16 | 2014-05-14 | 中国农业科学院哈尔滨兽医研究所 | Primer group using vtaA9 gene as target spot and application of primer group to identification and diagnosis of haemophilus parasuis |
| US20150301058A1 (en) * | 2012-11-26 | 2015-10-22 | Caris Science, Inc. | Biomarker compositions and methods |
-
2019
- 2019-05-20 CN CN201910418982.9A patent/CN110133286A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060039922A1 (en) * | 1997-12-31 | 2006-02-23 | Stressgen Biotechnologies Corporation, A Canadian Corporation | Streptococcal heat shock proteins of the Hsp60 family |
| CN1665533A (en) * | 2002-05-02 | 2005-09-07 | 康涅狄格大学健康中心 | Use of heat shock proteins to enhance efficacy of antibody therapeutics |
| CN101453998A (en) * | 2006-06-01 | 2009-06-10 | 维乐罗吉克有限公司 | Pharmaceutical composition for the treatment of viral infections and/or tumor diseases by inhibiting protein folding and protein breakdown |
| US20150301058A1 (en) * | 2012-11-26 | 2015-10-22 | Caris Science, Inc. | Biomarker compositions and methods |
| CN103789422A (en) * | 2014-01-16 | 2014-05-14 | 中国农业科学院哈尔滨兽医研究所 | Primer group using vtaA9 gene as target spot and application of primer group to identification and diagnosis of haemophilus parasuis |
Non-Patent Citations (2)
| Title |
|---|
| MANLI LIU等: "Microarray analyses of THP-1 cells infected with Streptococcus suis serotype 2", 《VETERINARY MICROBIOLOGY》 * |
| 于岩飞: "猪链球菌2型蛋白的差异表达及翻译后修饰对其毒力的影响", 《中国博士学位论文全文数据库 农业科技辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2021184415A1 (en) | Helicobacter pylori ferritin-based novel coronavirus s protein single-region subunit nanovaccine | |
| US20200172920A1 (en) | Application of plant as host in expressing vaccine of middle east respiratory syndrome | |
| Park et al. | Development of recombinant protein-based vaccine against classical swine fever virus in pigs using transgenic Nicotiana benthamiana | |
| CN106519041A (en) | Establishing method of pig immunoglobulin Fc fragment-swine classical fever E2 fusion protein in CHO cell strain, as well as preparation method and application of fusion protein | |
| CN106148358A (en) | A kind of method utilizing escherichia expression system to prepare pig parvoviral virus sample particle subunits vaccine and application | |
| CN109880838A (en) | A kind of recombinant virus and its preparation method and application of the O-shaped foot-and-mouth disease virus multi-epitope gene of secreting, expressing pig | |
| CN112979826B (en) | Encephalitis B virus nanoparticle vaccine and preparation method and application thereof | |
| CN104211784B (en) | It is used to prepare the protein and method of Hepatitis E virus sample particle | |
| CN106866796A (en) | The recombinant protein of the type S9 gene codes of GCRV II and its application | |
| CN105646680B (en) | The application of brucella S2 vaccine GL_0002181 albumen | |
| CN106636149B (en) | Parabronema skrjabini serine/threonine protein kitase Pj_STPK gene cloning, prokaryotic expression method and application | |
| CN110133286A (en) | Medical application of the HSP60 gene as target spot in meningitis treatment | |
| CN113174407A (en) | Screening method for stably expressing CSFV complete structural protein CHO-K1 cell line | |
| CN105693831B (en) | A kind of detection reagent and its application of brucella S2 vaccine immunity antibody | |
| CN108503696A (en) | A kind of zika virus subunit vaccine of yeast cell to express | |
| CN107557347A (en) | New virus sample particle, its preparation method and the application of enterovirns type 71 | |
| CN104774249B (en) | Porcine epidemic diarrhea virus M albumen affinity peptide and its screening technique | |
| CN103830747A (en) | Genetically engineered vaccine of epsilon toxin of clostridium perfringens and application thereof | |
| CN106636122B (en) | Parabronema skrjabini cystatin Pj_CPI gene cloning, recombinant expression method and application | |
| CN106749561B (en) | A kind of stenotrophomonas maltophilia outer membrane protein and its application | |
| CN104152477A (en) | Schistosoma japonicum recombinant antigen SjPDI (schistosoma japonicum protein disulfide isomerase) and preparation method and application thereof | |
| CN107098980A (en) | A kind of fusion protein for detecting Detecting Rubella Virus Antibodies In Human Sera and preparation method thereof | |
| CN104945513B (en) | Streptococcus mutans cell surface protein antigen (SpaP) and glucosyltransferase (GtfB) amalgamation protein vaccine and preparation method thereof | |
| CN108503697A (en) | A kind of zika virus subunit vaccine of drosophila cell expression | |
| CN107325188A (en) | The construction method of the Chinese hamster ovary celI strain of pig blood Albumin Fusion pig circular ring virus Cap2 albumen and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |