CN104945513B - Streptococcus mutans cell surface protein antigen (SpaP) and glucosyltransferase (GtfB) amalgamation protein vaccine and preparation method thereof - Google Patents
Streptococcus mutans cell surface protein antigen (SpaP) and glucosyltransferase (GtfB) amalgamation protein vaccine and preparation method thereof Download PDFInfo
- Publication number
- CN104945513B CN104945513B CN201510390458.7A CN201510390458A CN104945513B CN 104945513 B CN104945513 B CN 104945513B CN 201510390458 A CN201510390458 A CN 201510390458A CN 104945513 B CN104945513 B CN 104945513B
- Authority
- CN
- China
- Prior art keywords
- spap
- gtfb
- protein
- streptococcus mutans
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The present invention relates to a kind of Region of Surface Protein of Streptococcus Mutans antigen SpaP and glucosyltransferase GtfB fusion proteins and preparation method and application, the amino acid sequence of the fusion protein is SEQ ID NO：1.Region of Surface Protein of Streptococcus Mutans antigen SpaP genes with glucosyltransferase GtfB genes by Lingker sequences are connect and obtain fusion protein by the present invention, are used to prepare anti-caries protein vaccine.The genetic engineering subunit vaccine immunogenicity is good, can efficiently cause the immune response of inoculum.
Description
Technical field
The invention belongs to biotechnologies, and in particular to a kind of streptococcus mutans cell surface protein antigen (SpaP) and
Glucosyltransferase (GtfB) amalgamation protein vaccine and preparation method thereof.
Background technology
Saprodontia, angiocardiopathy and cancer and referred to as three big disease of the mankind.In China, 80% children, 50% adult,
98% the elderly is perplexed by it in various degree.Reach effective prevention of saprodontia, in addition to reducing carbohydrate intake, profit
Enhance tooth to the resistance of acid with fluoride and sealant is used to reduce pathogenic bacteria except the field planting of roller seating space, use antibacterial
It is the emphasis that scientist studies for decades that matter, which reduces or eliminate cariogenic microorganism, and the research and development of dental caries vaccine are even more it in weight
Weight, but up to the present, it still can be in clinical practice without a kind of vaccine.
The research and development of dental caries vaccine are carried out with gradual recognize to cariogenic microorganism, and streptococcus mutans are main
Cariogenic microorganism, cariogenicity are mainly manifested in the sticking of facing, produce sour, acidproof and generate the side such as polysaccharide and bacteriocin
Face, it is more for the Vaccines classes of streptococcus mutans.In early days, scientists trial inactivates complete streptococcus mutans, as
The vaccine of peroral route uses, but can intersect instead with myocardium particularly cardiolipin and sarcolemma sheath because streptococcus mutans have
The antigen answered leads to the potential danger of inoculator's death without being received.Then, DNA recombinant techniques are used to cariogenic micro- life
In the antigenic component recombination to non-cariogenic, no cross reaction benign bacterium (such as Bacillus acidi lactici) of object, but do not demonstrate,prove enough
According to can ensure so-called benign bacterium safe enough.Meanwhile the research of DNA vaccination is also in widespread attention, also because of people
It delays clinically to apply to the worry of its biological safety.This seminar is in terms of anti-caries DNA vaccine
Row research, develops 3 generation anti-caries DNA vaccines, comes into the pilot scale stage, but DNA vaccination still has many barriers applied to clinic
Hinder, because of misgivings for security, any DNA vaccination there is no to go through to apply at present.
It is recently, higher than DNA vaccination on safety theory since protein subunit and polypeptide vaccine do not contain nucleic acid,
Multiple protein class vaccine has been successfully applied to clinical (such as hepatitis B vaccine).The eighties, people were with each to mutans streptococcus cell wall
The gradual understanding of the antigenic polymer of kind, immune anticaries are transferred to prepares subunit's anti-caries vaccine with the single antigenic component of mutans streptococcus
Research.The focus of research concentrates on two kinds of candidate vaccines, i.e. mutans streptococcus major surface protein antigen SpaP and glucosyltransferase
GtfB, they play an important role in mediation mutans streptococcus to the adherency of facing and during colonizing.The numerous studies card of nearly 10 years
It is real, it can apparent Inhibition test animal and the adherency of volunteer's facing mutans streptococcus and dental caries hair with SpaP and GtfB active immunities
Raw rate, and the antigen purified will not mediate cardiac cross reaction.Streptococcus mutans surface protein antigen (SpaP) is otherwise known as egg
White P1 (protein P1), antigens I/II (antigen I/II, Ag I/II) etc., are a kind of macromoleculars for being present in cell wall
It is main on surface glycoprotein and Streptococcus mutans thalline cell wall to cohere one of albumen, the initial of facing is sticked in bacterium
Important mediation is played in accumulation process between (non-sucrose dependence is sticked) and promotion thalline, is cariogenic variation hammer
One of important virulence factor of bacterium.GtfB has been found to be the important Effective Antigens of anti-caries vaccine, it includes two functional areas：Ammonia
Cardinal extremity catalytic activity area CAT and c-terminus glucan binding domian area GLU.At present at the surface antigen of streptococcus mutans (SpaP)
Achieve preliminary as a result, finding that both polypeptide vaccines can carry in terms of research and development with GtfB (GlU areas) polypeptide vaccine
For certain anti-caries protecting effect, but its immune effect how is further improved, be a major challenge.
Invention content
The present invention relates to it is a kind of by streptococcus mutans SpaP and GtfB by flexible connection, construct simultaneously comprising SpaP with
The fusion protein of GtfB enhances the efficiency of mucosa-immune, the generation of significantly more efficient pre- anti-caries.Flexible joint linker
(G4S) 3 mainly make two albumen of fusion spatially can freely stretch using gly and ser spatial flexibles, do not cause activity
The mutual cover in site.To the correct fusion protein of structure that can be easily expressed.
One aspect of the invention is related to a kind of fusion protein, and amino acid sequence is SEQ ID NO：1.
It is a further object to provide the preparation methods of more than fusion protein, mainly include step：
1) the design synthesis of primer
From NCBI:Streptococcus mutans UA159 (Streptococcus mutans UA159) genome sequence in BLAST
Middle surface protein SpaP sequences (Genbank Gene ID:And β -1,3- dextranase GtfB coded sequences 102805)
(Gene ID:1028336), two pairs of specific primers of design synthesis, the sequence and number of primer are as follows:
(1) GtfB gene PCRs amplimer
Sense primer P1 (SEQ ID NO.2)
5′-CGC GGATCC ATGGGCTATCAAGCCAAAG-3′
Downstream primer P2 (SEQ ID NO.3)
5′-CCG CTCGAG AATCCGAACTCGTTCTCCAG-3′
(containing XhoI sites containing BamHI sites, 3 ' ends in the end of amplified production 5 ')
(2) 3 gene PCR amplimers of SpaP- (G4S)
Sense primer P3 (SEQ ID NO.4)
5′-CTA GCTAGC ATGACCAATGCTGCCAATC-3′
Downstream primer P4 (SEQ ID NO.5)
5′-CGC GGATCC GCTTCCTCCTCCTCCGCTTCCTCCTCCTCCGCTTCCTCCTCCTCCCTCTGCTTCA
TAGCTTGGC-3′
(containing BamHI sites containing NheI sites, 3 ' ends in the end of amplified production 5 ')
2) the GtfB genetic fragments, 3 genetic fragments of SpaP- (G4S) are building up to respectively containing 6-His histidine tags
Expression vector on, obtain recombinant plasmid, conversion to expression bacterium, digestion identification；
3) recombinant protein of induced expression solubility；
4) recombinant protein that purification step 3 obtains, ice bath stirring dialysis change liquid, remove imidazoles；
The expression vector of the histidine tag containing 6-His in the step (2) is pET28a plasmids, and expression bacterium is E.coli
DH5α；
Preferably, step (3) is specially：Picking contains the monoclonal of the recon of destination protein, is transferred to kanamycins sun
Property LB fluid nutrient mediums, 37 DEG C of overnight shake cultures；It inoculates to the LB Liquid Cultures of the kanamycins positive of Fresh
In base, the concussion of 37 DEG C of shaking tables overnight, increases bacterium, when A600OD values are 0.5-0.6, adds in the final concentration of 1.0mmol/L of IPTG, and 37
DEG C continue culture 4 hours.
Preferably, step (4) is specially：4 DEG C, 8000rpm centrifuges 5 minutes thalline collected after induction, removes supernatant, uses
Binding buffer washed once, and according to the amount of thalline, select suitable binding buffer that thalline is resuspended；Ice bath environment
Under, the thick liquid of albumen is collected in ultrasonication；10000rpm, 30min, 4 DEG C of centrifugal breaking liquid collect supernatant, and through 0.45 μm of filtering
Device filters, and ice bath is spare；It is purified using 1ml HisTrap FF nickel columns and 10 instruments of AKTA purifier, SDS-
PAGE electrophoresis, the purity of analysis purpose albumen；Liquid is changed in ice bath stirring dialysis, removes imidazoles.
The fusion protein of the present invention is used to prepare preventing decayed tooth protein vaccine.
The present invention connects Region of Surface Protein of Streptococcus Mutans antigen SpaP and glucosyltransferase GtfB by Lingker sequences
Obtain to obtain fusion protein.Primary immunization operation can just make object of inoculation obtain Double immune protection.The genetic engineering of the present invention
Subunit vaccine immunogenicity is good, safe and efficient, has good development and application prospect.Constructed by of the invention and purify
The recombination fusion protein vaccine arrived will provide sufficient material base for the immunological effect of follow-up study protein vaccine.
Description of the drawings
Fig. 1 is SpaP, GtfB gene, 3 gene PCR amplification figures of SpaP- (G4S)
A figure M are DNA marker, and 1 is SpaP gene target fragments, and 2 be GtfB gene target fragments, and B figures M is DNA
Marker, 1 is 3 gene target fragments of SpaP- (G4S)；
Fig. 2 is XholI, NheI and BamHI digested plasmid, GtfB genes, 3 gene PCR amplified fragments knots of SpaP- (G4S)
Fruit is schemed
M is DNAmarker in figure, and 1 is pET28a, and 2 be GtfB, and 3 be SpaP- (G4S) 3
Fig. 3 is recombinant protein SDS-PAGE electrophoresis
1 merges recombinant protein for SpaP- (G4S) 3-GtfB, and 2 be SpaP recombinant proteins；
Fig. 4, which is immunized after mouse for protein vaccine in saliva, to be generated specific antibody level and compares figure
A is PBS blank controls, and B is SpaP protein immunizations, and C is PAc protein immunizations, and D is SpaP- (g4s) 3-GtfB, E
For PCIA-P DNA vaccination immune groups；
Specific embodiment
By following detailed description combination attached drawing it will be further appreciated that the features and advantages of the invention.The implementation provided
Example is only explanation to the method for the present invention, remaining content without limiting the invention in any way announcement.In the following example
The specific experiment condition and method being not specified, usually according to normal condition such as：J. the chief editors such as Pehanorm Brooker, Science Press,
1992, Molecular Cloning:A Laboratory guide (third edition)；D.L. Spector etc., Science Press, 2001, the books such as cell experiment guide
Described in condition or according to the normal condition proposed by manufacturer.
【Embodiment 1】The structure of Spap and SpaP- (G4S) 3-GtfB recombinant proteins
1. the design synthesis of primer
From NCBI:Streptococcus mutans UA159 (Streptococcus mutans UA159) genome sequence in BLAST
Middle surface protein SpaP sequences (Genbank Gene ID:And β -1,3- dextranase GtfB coded sequences 102805)
(Gene ID:1028336), three pairs of specific primers of design synthesis, primer are closed by Shanghai Sheng Gong biotechnologies Co., Ltd
Into the sequence and number of primer are as follows:
1) GtfB gene PCRs amplimer
Sense primer P1 (SEQ ID NO.2)
5′-CGC GGATCC ATGGGCTATCAAGCCAAAG-3′
Downstream primer P2 (SEQ ID NO.3)
5′-CCG CTCGAG AATCCGAACTCGTTCTCCAG-3′
(containing XhoI sites containing BamHI sites, 3 ' ends in the end of amplified production 5 ')
2) 3 gene PCR amplimers of SpaP- (G4S)
Sense primer P3 (SEQ ID NO.4)
5′-CTA GCTAGC ATGACCAATGCTGCCAATC-3′
Downstream primer P4 (SEQ ID NO.5)
5′-CGC GGATCC GCTTCCTCCTCCTCCGCTTCCTCCTCCTCCGCTTCCTCCTCCTCCCTCTGCTTCA
TAGCTTGGC-3′
(containing BamHI sites containing NheI sites, 3 ' ends in the end of amplified production 5 ')
3) SpaP gene PCRs amplimer
Sense primer P5 (SEQ ID NO.6)
5′-CTA GCTAGC ATGACCAATGCTGCCAATC-3′
Downstream primer P6 (SEQ ID NO.7)
5′-CGC GGATCC CTCTGCTTCATAGCTTGGC-3′
(containing BamHI sites containing NheI sites, 3 ' ends in the end of amplified production 5 ')
2. the extraction of streptococcus mutans UA159 complete genome DNAs
Streptococcus mutans UA159 (American Type Culture collection warehousing ATCC purchases) (using BHI fluid nutrient mediums) is cultivated,
37 DEG C, 220rpm is placed in shaking table concussion overnight.4ml bacterium solution collection bacterium are taken, 10000rpm is centrifuged 1 minute, abandons supernatant.Add in 500 μ l
TE is washed, and concussion is resuspended, and 14000rpm is centrifuged 3 minutes, abandons supernatant.Add in 300 μ l histiocyte lysates, ultrasound 5 seconds.Add
Enter and incubate 1 hour for 37 DEG C after 10 μ l lysozymes, 10 μ l Proteinase Ks, 2 μ l mutanolysin, turned upside down mixing 5- every 15 minutes
10 times.65 DEG C incubate 1 hour, 5-10 rear placement of the concussion mixing that was vortexed every 15 minutes to room temperature.Add in 2.5 μ l trypsase
37 DEG C incubate 30 minutes.Add in 400 μ l MPC lysates, abundant mixing, 14000rpm is centrifuged 10 minutes, and transfer supernatant is to sterile
Centrifuge tube.Add in 600 μ l phenol/chloroform/isoamyl alcohol (24:25:1), mixing, 14000rpm are centrifuged 10 minutes, transfer supernatant to nothing
Bacterium centrifuge tube.250 μ l chloroforms, mixing are added in, 14000rpm is centrifuged 10 minutes, transfer supernatant to sterile centrifugation tube.Add in 350 μ l
Isopropanol, mixing place precipitation 2 hours, and 4 DEG C of 14000rpm are centrifuged 10 minutes, abandon supernatant.70% ethyl alcohol washing precipitation, 4 DEG C
14000rpm is centrifuged 10 minutes, abandons supernatant.50 μ l TE, 2 hours abundant dissolving DNAs of room temperature are added in after vacuum drying DNA precipitations.
Detect DNA concentration and purity, -20 DEG C of preservations.
3.PCR (polymerase chain reaction) amplifications target fragment, purifying
1) PCR reaction systems are established：
With pipettor by said components mixing, the following reaction of progress on PCR thermal cyclers：98 DEG C of denaturation 5min, then 98
DEG C 10Sec, 59 DEG C of 20Sec, 72 DEG C of 1min carry out 30 cycles, 72 DEG C of 10min.
2% agarose gel electrophoresis is carried out using 5 μ l pcr amplification products, using 2KdDNA ladder as molecular weight reference
Standard, gel imaging system scanning, analysis result (Figure 1A).
2) PCR product recovery purifying
PCR product is purified using OMEGA Cycle-Pure Kit purification kits (article No. D64922-01), specific steps
It is as follows：
A PCR products add in 4-5 times of volume buffer CP, shake mixing.
B adds in centrifugal column centrifugation (room temperature, 10000g are centrifuged 1 minute).
C adds in 700 μ l of DNA wash buffer (room temperature, 10000g are centrifuged 1 minute).
D repeats previous step.
E blank pipes centrifugation (room temperature, 13000g are centrifuged 2 minutes)
F adds in sterile water 20-30 μ l, stands 1-2 minutes.
G is collected by centrifugation (room temperature, 13000g are centrifuged 1 minute)
H surveys the concentration and purity of recovery product.
3) digestion Preliminary Identification (Fig. 2)
PCR purifying carries out preliminary digestion identification, and digestion condition is as follows：
Remarks：37 DEG C of constant temperature digestions 3-5 hours.0.8% agarose gel electrophoresis is carried out to digestion products
4. build prokaryotic expression carrier
1) carrier pET28a plasmid extractions
By in the LB solid mediums of pET28a glycerol stocks (kalamycin resistance), 37 DEG C are cultivated 12-16 hours, choose single bacterium
It falls and is inoculated in the 5-10ml LB fluid nutrient mediums containing corresponding antibiotic (kalamycin resistance), 37 DEG C of shaking table concussion trainings overnight
It supports (12 hours), illustrates to extract plasmid according to OMEGA kits.
2) prokaryotic expression carrier is built
(1) pET28a carriers double digestion (added plasmid amount is adjusted according to plasmid concentration)：
Double digestion reaction system is as follows：
Reaction condition：37 DEG C, 3-5 hours
Note：Individually when the prokaryotic expression plasmid of structure pET28a-SpaP, carrier double enzyme site is NheI and BamH
I, when building pET28a-SpaP- (G4S) 3-GtfB, carrier double enzyme site is NheI and XhoI.
(2) carrier and Insert Fragment gel extraction
0.8% agarose gel electrophoresis is carried out to double digestion product, control 2kd DNA ladder carry out gel extraction, tool
For body step according to OMEGA (D2500-01) application method, concrete operations are as follows：
A. the agar gel containing purpose band is cut under ultraviolet lamp.
B. load-bearing calculates colloid product with 1mg=1ml, adds in isometric Buffer XP2, after mixing 60 DEG C to be heated to glue complete
Fully dissolved (about 10 minutes).
C. transfer liquid to centrifugal column, room temperature 10000g centrifuges 1 minute, abandons centrifugate.
D. 300 μ l Buffer XP2, room temperature 10000g are added in, centrifuges 1 minute, abandons centrifugate.
E. 700 μ l Buffer SPW, room temperature 10000g are added in, centrifuges 1 minute, abandons centrifugate.
F. previous step is repeated.
G. room temperature blank pipe centrifugation 13000g is centrifuged 2 minutes.
H. Elution Buffer 30-40 μ l are added in, stand 2 minutes.
I. room temperature 13000g is centrifuged 1 minute, collects centrifugate, surveys OD.
(3) carrier is connect with target fragment
Reaction system is as follows：
Remarks：16 DEG C of connections (12-16 hours) overnight, carrier and the suggestion of Insert Fragment molar ratio are 1：1-1:3 obtain
Cloned plasmids are named as pET28a-SpaP, pET28a-SpaP- (G4S) 3-GtfB.
(4) chemical conversion
5 μ l of connection product is taken to add in 50 μ l E.coli DH5 α (Tiangeng biochemical technology Co., Ltd), gently mixing, ice bath
30 minutes, 42 DEG C 90 seconds, ice bath 150 seconds again add in the LB fluid nutrient mediums of 500 μ l preheatings, 37 DEG C of (150rpm) shaking tables trainings
It supports 45 minutes, 200 μ l is taken to be applied to the LB solid mediums (50 μ g/ μ l) containing kanamycins, (12-16 is small for 37 DEG C of overnight incubations
When).
(5) positive colony is identified
Picking monoclonal, 37 DEG C of kanamycins positive LB fluid nutrient mediums (100 μ g/ml) shake bacterium culture proliferation 12 hours,
Collect bacterium, plasmid is extracted using OMEGA kits, choose BamH I/NheI, XhoI restriction enzyme sites carry out digestion identification.(Fig. 2)
5. destination protein induced expression
1) induced fusion protein expression (Fig. 3)
A. picking contains the monoclonal of the recon of destination protein, is transferred to the LB Liquid Cultures of the 10ml kanamycins positive
Base, 37 DEG C of overnight shake cultures.
B. 200 μ l bacterium solutions is taken to be seeded in the LB fluid nutrient mediums of the kanamycins positive of 10ml Fresh, 37 DEG C are shaken
Bed concussion is overnight.
C. when A600OD values are about 0.5-0.6, the final concentration of 1.0mmol/L of IPTG are added in, it is small to continue 37 DEG C of cultures 4
When.
D. it takes induction group bacterium solution and does not induce bacterium solution each 1ml, 4 DEG C of 10000rpm are centrifuged 1 minute, abandon supernatant, -20 DEG C of guarantors
It deposits.
E. induction group and group is not induced respectively to add in a 100 μ l PBS, mixing, (ultrasound 10 times, power is carrying out ultrasonic bacteria breaking
200W, 3 seconds time, ultrasonic 3 seconds interval times), 4 DEG C of 14000rpm are centrifuged 10 minutes.Supernatant precipitation is detached, is being precipitated
100 μ l PBS of middle addition, mixing.
F. supernatant is taken to precipitate each 20 μ l, adds in 20 μ l 2X sample-loading buffers, 100 DEG C are boiled 5 minutes.
G. 10 μ l-20 μ l of sample carry out SDS-PAGE electrophoresis after taking processing respectively.
6. metal chelate affinity chromatography obtains the process of the recombinant protein of expected molecular weight
1) positive colony frozen is taken out in -80 DEG C of refrigerators, on the solid LB tablets containing 50 μ g/ml kanamycins
Scribing line；Picking single bacterium colony is inoculated in 5ml LB liquid mediums (containing 50 μ g/ml kanamycins), and 160rpm, 37 DEG C were cultivated
Night；
2) according to 1：100 ratio is transferred to 500ml LB culture mediums (containing 50 μ g/ml kanamycins), 160rpm, 37 DEG C
Culture reaches 0.4-0.6 to OD600, and bacterium solution cools down 10 minutes through ice bath, adds the IPTG of final concentration 0.1-0.2mM,
120rpm, 16 DEG C of induction 10-16h.
3) bacterium is received：4 DEG C, 8000rpm centrifuges 5 minutes thalline collected after induction, removes supernatant, is washed with binding buffer
It washs once, according to the amount of thalline, selects suitable binding buffer that thalline is resuspended.
4) it crushes：Under ice bath environment, ultrasonication condition is 37% power, broken 3s, stops 5s, 30min.
5) the thick liquid of albumen is collected：10000rpm, 30min, 4 DEG C of centrifugal breaking liquid collect supernatant, and through 0.45 μm of filter
Filtering, ice bath are spare.
6) loading and purifying：It is purified using 1ml HisTrap FF nickel columns and 10 instruments of AKTA purifier.
SDS-PAGE electrophoresis, the purity of analysis purpose albumen；
7) it dialyses.Liquid is changed in ice bath stirring dialysis, removes imidazoles；
8) albumen packing freezes spare in -80 DEG C.
【Embodiment 2】Effect is immunized in SpaP and the protein vaccine of SpaP- (G4S) 3-GtfB recombinant protein nasal cavity immunity mouse
The detection of energy
Study 2 kinds of preventing decayed tooth subunit vaccine intranasal inoculation mouse caused by immune effect, proving and comparisom SpaP and
The immunizing potency of SpaP- (G4S) two kinds of albumen of 3-GtfB.The present invention uses BALB/c mouse as animal model.
The vaccine safety of 1.SpaP and SpaP- (G4S) 3-GtfB protein vaccines is evaluated
5-6 week old Healthy females BALB/c mouse 15 is taken, is randomly divided into 3 groups, every group 5, A, B group mouse distinguish muscle
Inject SpaP and SpaP- (G4S) 3-GtfB protein vaccines vaccine (10 μ g/100 μ l of every mouse of dosage), C groups mouse muscle note
The 100 sterile PBS of μ l are penetrated as negative control.
It is observed 21 days after mouse injection, measures changes of weight, respectively at 5,7,9,14 and 21 days, tail portion blood sampling counted white
Cell quantity.
The results show that SpaP and SpaP- (G4S) 3-GtfB protein vaccinations group and the variation of PBS control group mouse weight
With each blood sampling time point quantity of leucocyte without significant difference.
The evaluation (Fig. 4) of 2.SpaP and SpaP- (G4S) 3-GtfB nasal membrane immunization route immunizing potencies
1) SpaP and the inoculation of SpaP- (G4S) 3-GtfB anti-caries vaccine mouse nasal cavity immunity
PBS dilutes SpaP and SpaP- (G4S) 3-GtfB protein concentrations are 2g/L, spare.Take 5-6 week old Healthy females
BALB/c mouse 30 is randomly divided into 5 groups, every group 6, SpaP, SpaP- (G4S) 3-GtfB and PAc albumen (this is respectively adopted
Laboratory preserves) and the immune mouse of PBS (blank control) and PCIA-P DNA vaccinations (positive controls).Strengthen exempting from after two weeks
Epidemic disease is primary.Mouse salivary was collected respectively at 0,2,4,6,8,10,12 week and blood testing Specific antibody titre is horizontal.
2) immune response of SpaP and SpaP- (G4S) 3-GtfB nasal cavity immunity mouse detects
ELISA method measures in mice serum the anti-SpaP and SpaP- (G4S) 3-GtfB of specificity in IgG antibody and saliva
The generation (Fig. 4) of antibody I gA antibody.Specific steps include：
Coating：With by buffer solution (carbonate buffer solution of 0.05M PH 9.6) by SpaP and SpaP- (G4S) 3-GtfB
Albumen is diluted to 5 μ g/ml, and per 100 μ l of hole, 4 DEG C were coated with 96 hole ELISA ELISA Plates (Corning Products, similarly hereinafter) of coating
Night；
Closing：By the ELISA ELISA Plates of coating SpaP and SpaP- (G4S) 3-GtfB antigens, with PBS-T, (PBS contains 0.1%
Tween-20, pH 7.5, similarly hereinafter) wash 5 times, each 5min；Add in 100 μ l confining liquids (PBST containing 3%BSA), 37 DEG C of envelopes
Close 60min；After PBST is washed 5 times.
Add serum to be checked：Mice serum makees 1 with the PBST containing 1%BSA:100 gradient dilutions or mouse salivary 1:4 dilutions,
Dilute serum or saliva are added in each hole of ELISA ELISA Plates (100 μ l/ are per hole), 37 DEG C of incubation 60min；PBST is washed 5 times.
Add ELIAS secondary antibody：Secondary antibody is horseradish peroxidase-labeled sheep anti-mouse igg or IgA antibody (31432Pierce companies
Product), make 1 with the PBST containing 1%BSA:5000 dilutions are added in each hole of elisa plate (100 μ l/ are per hole), 37 DEG C of effects
60min；PBST is washed 5 times.
Add in display substrate solution：Colour developing bottom solution is added in into each hole of ELISA Plate and (contains 0.045%H2O2, 0.4mg/ml
Phosphoric acid-citrate buffer of o-phenylenediamine dihydrochloride (OPD)), per 100 μ l of hole, 37 DEG C
It is protected from light colour developing 15min；2M H are added in per hole2SO450 μ l terminate reaction.
OD492 values measure：It is measured at wavelength 492nm per hole internal optical density absorption value (OD492) in microplate reader
The result shows that two kinds of protein vaccines of SpaP and SpaP- (G4S) 3-GtfB prepared by the present invention can be in certain journey
Degree makes mouse generate the specific antibody of high titre, and the specific antibody level that wherein SpaP- (G4S) 3-GtfB is induced is most
It is high.
Claims (3)
1. a kind of streptococcus mutans cell surface protein antigen SpaP and glucosyltransferase GtfB fusion proteins, amino acid sequence
It is classified as SEQ ID NO:1.
2. application of the fusion protein described in claim 1 in anti-caries subunit vaccine is prepared.
3. the preparation method of fusion protein described in claim 1 mainly includes step：
1) the design synthesis of primer
From NCBI:Table in streptococcus mutans UA159 (streptococcus mutans UA159) genome sequence in BLAST
Face Protein S paP sequences (Genbank Gene ID:And β -1,3- dextranase GtfB coded sequences (Gene 102805)
ID:1028336), two pairs of specific primers of design synthesis, the sequence and number of primer are as follows:
(1) GtfB gene PCRs amplimer
Sense primer P1 (SEQ ID NO.2)
5′-CGCGGATCCATGGGCTATCAAGCCAAAG-3′
Downstream primer P2 (SEQ ID NO.3)
5′-CCGCTCGAGAATCCGAACTCGTTCTCCAG-3′
(2) 3 gene PCR amplimers of SpaP- (G4S)
Sense primer P3 (SEQ ID NO.4)
5′-CTAGCTAGCATGACCAATGCTGCCAATC-3′
Downstream primer P4 (SEQ ID NO.5)
5′-CGCGGATCCGCTTCCTCCTCCTCCGCTTCCTCCTCCTCCGCTTCCTCCTCCTCCCTCTGCTTCATAGCTT
GGC-3′
2) the GtfB genetic fragments, 3 genetic fragments of SpaP- (G4S) are building up to the table containing 6-His histidine tags respectively
Up on carrier pET28a plasmids, recombinant plasmid, conversion to expression bacterium E.coli DH5 α, digestion identification are obtained；
3) recombinant protein of induced expression solubility：Picking contains the monoclonal of the recon of destination protein, is transferred to kanamycins
Positive LB fluid nutrient mediums, 37 DEG C of overnight shake cultures；It inoculates to the LB liquid training of the kanamycins positive of Fresh
It supports in base, 37 DEG C of shaking table concussions overnight, increase bacterium, when A600 OD values are 0.5-0.6, add in the final concentration of 1.0mmol/ of IPTG
L, 37 DEG C are continued culture 4 hours；
4) recombinant protein that purification step 3 obtains, 4 DEG C, 8000rpm centrifuges 5 minutes thalline collected after induction, removes supernatant, uses
Binding buffer washed once, and according to the amount of thalline, select suitable binding buffer that thalline is resuspended；Ice bath environment
Under, the thick liquid of albumen is collected in ultrasonication；10000rpm, 30min, 4 DEG C of centrifugal breaking liquid collect supernatant, and through 0.45 μm of filtering
Device filters, and ice bath is spare；It is purified using 1ml HisTrap FF nickel columns and 10 instruments of AKTA purifier, SDS-
PAGE electrophoresis, the purity of analysis purpose albumen；Liquid is changed in ice bath stirring dialysis, removes imidazoles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510390458.7A CN104945513B (en) | 2015-07-06 | 2015-07-06 | Streptococcus mutans cell surface protein antigen (SpaP) and glucosyltransferase (GtfB) amalgamation protein vaccine and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510390458.7A CN104945513B (en) | 2015-07-06 | 2015-07-06 | Streptococcus mutans cell surface protein antigen (SpaP) and glucosyltransferase (GtfB) amalgamation protein vaccine and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104945513A CN104945513A (en) | 2015-09-30 |
| CN104945513B true CN104945513B (en) | 2018-07-03 |
Family
ID=54160624
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510390458.7A Active CN104945513B (en) | 2015-07-06 | 2015-07-06 | Streptococcus mutans cell surface protein antigen (SpaP) and glucosyltransferase (GtfB) amalgamation protein vaccine and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104945513B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868029A (en) * | 2017-01-20 | 2017-06-20 | 遵义医学院 | Preventing decayed tooth Transgenic Plant Vaccines and preparation method thereof |
| CN107501414B (en) * | 2017-09-22 | 2020-10-20 | 四川理工学院 | Streptococcus mutans CAT-SYI antigen and antibody |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1419938A (en) * | 2001-11-21 | 2003-05-28 | 武汉大学 | Fusion anticaries DNA vaccine and prepring method thereof |
-
2015
- 2015-07-06 CN CN201510390458.7A patent/CN104945513B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1419938A (en) * | 2001-11-21 | 2003-05-28 | 武汉大学 | Fusion anticaries DNA vaccine and prepring method thereof |
Non-Patent Citations (5)
| Title |
|---|
| Conservation of salivary glycoprotein-interacting and human immunoglobulin G-cross-reactive domains of antigen I/II in oral streptococci.;A Moisset等;《INFECTION AND IMMUNITY》;19940131;第62卷(第1期);全文 * |
| Effects of antibodies against cell surface protein antigen PAc-glucosyltransferase fusion proteins on glucan synthesis and cell adhesion of Streptococcus mutans;HAO YU等;《INFECTION AND IMMUNITY》;19970630;第65卷(第6期);全文 * |
| Enhanced Immunogenicity of a Genetic Chimeric Protein Consisting of Two Virulence Antigens of Streptococcus mutans and Protection against Infection;Ping Zhang等;《INFECTION AND IMMUNITY》;20021231;第70卷(第12期);摘要、摘要倒数第1-2行、第6789页左栏倒数第1段右栏1-3段 * |
| glucosyltransferase [Streptococcus mutans GS-5];Shiroza,T.等;《GenBank Database》;19960215;Accession No. AAA88588.1 * |
| Okahashi,N.等.RecName: Full=Major cell-surface adhesin PAc AltName: Full=Antigen I/II;Flags: Precursor.《GenBank Database》.2014,Accession No.P11657. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104945513A (en) | 2015-09-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102636641B (en) | Detection kit of helicobacter pylori emulsion method and preparation process thereof | |
| CN102068690A (en) | Polyvalent pneumococcal capsular polysaccharide conjugate vaccine and preparation method thereof | |
| CN101955545B (en) | Multi-target recombination gene and application of protein thereof in preventing and treating infection of helicobacter pylori | |
| CN102864157B (en) | Immune protective antigen of haemophilus parasuis | |
| CN113173977B (en) | Bifunctional antigen, preparation method and application thereof | |
| CN100535116C (en) | Helicobacter pylori urease B subunit B cell antigen epitope polypeptide, identification method and application | |
| CN107630024A (en) | The gene of encoding hemagglutinin protein of H 5 avian influenza virus and its application | |
| Han et al. | A recombinant mutant abrin A chain expressed in Escherichia coli can be used as an effective vaccine candidate | |
| CN104861049B (en) | Acinetobacter bauamnnii 1A1S_1969 recombinant proteins and its preparation method and application | |
| Taubman et al. | Diepitopic construct of functionally and epitopically complementary peptides enhances immunogenicity, reactivity with glucosyltransferase, and protection from dental caries | |
| CN104945513B (en) | Streptococcus mutans cell surface protein antigen (SpaP) and glucosyltransferase (GtfB) amalgamation protein vaccine and preparation method thereof | |
| CN103160519B (en) | Staphylococcus aureus enterotoxin B (SEB) immune preparation and its preparation method and use | |
| Smith et al. | Immunological and protective effects of diepitopic subunit dental caries vaccines | |
| CN102586311A (en) | Enterohemorrhage Escherichia coli (EHEC) O157:H7 multivalence fliC-hcpA-tir-eae recombinant strain and vaccine | |
| CN104861050B (en) | Acinetobacter bauamnnii zinc relies on Gly-Lys-Ala-Phe-Val-Lys-Lys 1S_1610 albumen and its preparation method and application | |
| CN108774628A (en) | Synthesis causes the colibacillus engineering and purposes of neonatal meningitis Escherichia coli Glycoprotein binding vaccine | |
| CN103990121B (en) | Antigen chimera, antigen composition, vaccine and preparation method and kit thereof | |
| Choi et al. | Potent in vitro and in vivo activity of plantibody specific for Porphyromonas gingivalis FimA | |
| CN1748791B (en) | Haemorrhagic E, coli 0157:H7 vaccine for human and livestock prevention and preparing method | |
| CN102058881A (en) | Gene recombinant vaccine for preventing enterovirus 71 infection and preparation method thereof | |
| CN104862331B (en) | A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen | |
| CN110257405A (en) | Mycoplasma bovis alcohol dehydrogenase gene and its coding albumen and application | |
| CN104861048B (en) | Acinetobacter bauamnnii assumes albumin A 1S_1462 albumen and preparation method and application | |
| CN101629159B (en) | Brucella abortus recombinant strain and application thereof | |
| CN108619502A (en) | A kind of season influenza-RSV- epidemic meningitis combined vaccine based on recombinant vector albumen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20191223 Address after: 430000 Wuhan first dental hospital Co., Ltd., No. 675 Jianshe Avenue, Jianghan District, Wuhan City, Hubei Province Patentee after: Wuhan first dental hospital Co.,Ltd. Address before: 430000 Wuhan first dental hospital Co., Ltd., No. 675 Jianshe Avenue, Jianghan District, Wuhan City, Hubei Province Patentee before: Wuhan Myron dental science and Technology Co.,Ltd. Effective date of registration: 20191223 Address after: 430000 Wuhan first dental hospital Co., Ltd., No. 675 Jianshe Avenue, Jianghan District, Wuhan City, Hubei Province Patentee after: Wuhan Myron dental science and Technology Co.,Ltd. Address before: 430072 Hubei Province, Wuhan city Wuchang District of Wuhan University Luojiashan Patentee before: WuHan University |
|
| TR01 | Transfer of patent right |