A kind of people BRCA1/2 genetic mutation detection quality-control product and its preparation method and application
Technical field
The invention belongs to high throughput sequencing technologies fields more particularly to a kind of 1/2 genetic mutation of people BRCA to detect quality-control product
And its preparation method and application.
Background technique
Breast cancer is a kind of body of women health even one of most common malignant tumour of threat to life of seriously affecting.According to
Statistics, the disease incidence of breast cancer account for the 7-10% of the various Cancer Mortalities of whole body.Breast cancer can be divided into it is sporadic and
Heredity two major classes.Wherein hereditary breast cancer accounts for about the 5-10% of breast cancer disease incidence.1 (the of breast cancer susceptibility gene BRCA
First familial breast and ovarian cancer susceptibility gene) and BRCA2 (the
Second familial breast cancer susceptibility gene) there are heritable mutation, BRCA 1 or
The damage assessment that BRCA2 mutated gene carrier suffers from breast cancer in life is 90.In addition, the mutation of BRCA 1 and BRCA2
It is related with oophoroma.Either with or without family history or age of onset, 2~6% mutation for having a BRCA1 in all oophoromas, 3~
4% has the mutation of BRCA2.Therefore, the mutation for screening BRCA gene is also more interested by researchers.
BRCA1 and BRCA2 gene is respectively positioned in 17q12_21 and 13q12_13, coded sequence be respectively 5711bp and
10987bp, expression have certain tissue specificity.BRCA 1 and BRCA2 albumen are respectively by 1863 amino acid and 3418
Amino acid composition, the two albumen all have certain features of Granin albumen.BRCA1/2, which is two kinds, has inhibition malignant tumour
The gene of generation, adjust the duplication of human body cell, hereditary material DNA injury repair, cell normal growth in terms of have it is important
Effect.The family for possessing this gene mutation tends to have high incidence of breast cancer, usually occurs more at an early age, patient's
Two sides breast all suffers from cancer, and suffers from oophoroma simultaneously.If certain changes have occurred in the structure of 1/2 gene of BRCA, its institute
The tumorigenic function of the inhibition having will be impacted.Cut-off 2013, it has been found that BRCA 1/2 mutation have it is hundreds of
As many as.There is scholar to summarize the lifetime risk of the cancer relevant with BRCA2 gene mutation of BRCA 1, it is prominent to show 1 gene of BRCA
Change person, suffering from breast cancer with the risk of oophoroma is 50-85% and 15-45% respectively, has BRCA2 gene mutation person, suffers from breast cancer
Risk with oophoroma is 50-85% and 10-20% respectively.Breast cancer, ovary can be screened out by the detection to BRCA 1/2
The people at highest risk of cancer and other associated malignancies treats conducive to the early diagnosis of such disease.
High throughput sequencing technologies (High throughput sequencing) are also known as two generation sequencing technologies (Next
Generation Sequencing, NGS), sequencing once can be carried out to millions of DNA moleculars to hundreds of thousands parallel, so
Sequencing result is compared with reference sequences afterwards, finds abrupt information present on DNA molecular.High throughput sequencing technologies are one
Kind efficiently, accurately detection method of gene mutation.
The country there is no the quality-control product and kit for BRCA1/2 genetic test at present.It is existing to be directed to fetal chromosomal
Aneuploid (T21, T18, T13) detection uses semiconductor PCR sequencing PCR, since the purpose of analysis is different, such detection and analysis
Be the variation of Chromosome level, thus cannot be used for by target gene make a variation for the purpose of detection and analysis.Other gene mutations
Class product is detected, if EGFR hot spot mutation detects, uses PCR-fluorescence probe method, fluorescent PCR-capillary electrophoresis, stream
Formula fluorescent hybridization method, FISH PCR sequencing PCR, Taqman-ARMS method etc., due to being only capable of detecting the mutation of a certain specific site, detection
Low efficiency, it is at high cost, and specific site is not present in the variation of BRCA1/2 gene, the incidence of variation is special without apparent site
The opposite sex, therefore conventional method is not suitable for the screening of this kind of variation, cannot meet well will for target gene full coding region
Seek the demand of the BRCA1/2 genetic test of detection and analysis.
Summary of the invention
In view of this, the purpose of the present invention is to provide a kind of people BRCA1/2 genetic mutation detection quality-control product and its preparations
Methods and applications.People BRCA1/2 quality-control product provided by the invention includes the variant sites of different variation frequencies, is conducive to control
Precision of analysis;The reliability for capableing of high-flux sequence detection architecture effectively to 1/2 genetic mutation of people BRCA 1BRCA carries out
Assessment improves efficiency and reduces detection Quality Control cost.
To achieve the goals above, the present invention provides following technical schemes:
A kind of preparation method of 1/2 genetic mutation of people BRCA detection quality-control product, comprising the following steps:
1) several human tumor cell line genomic DNA difference that is 1/2 genetic mutation of BRCA is positive, stablizing passage is dilute
It releases to 95~105ng/ μ L, obtains several human tumor cell line genomic DNA dilution;
2) determination step 1 is distinguished using the method for high-flux sequence) in the human tumor cell line genomic DNA dilution
Variant sites on 1/2 gene of BRCA, optionally one in the variant sites are used as positive control site, choose variation position
The wild type site of point is negative control site;
3) using the method for real-time fluorescence quantitative PCR in the several human tumor cell line genomic DNA dilution
The copy number of genome is quantified;
4) according to genome copy numbers and choosing in the determining several human tumor cell line genomic DNA dilution of step 3)
The target alleles frequency of middle variant sites, which calculates, obtains the mixed of the several human tumor cell line genomic DNA dilution
Composition and division in a proportion example;
5) the several human tumor cell line genomic DNA dilution is mixed according to the mixed proportion described in step 4)
It closes and obtains 1/2 genetic mutation of people BRCA detection quality-control product;
Target alleles frequency >=5% of the variant sites;
Human tumor cell line genomic DNA dilution where the target alleles frequency of the variant sites=variant sites
In liquid in the copy number of genome/several human tumor cell line genomic DNA dilution mixed liquor genome it is total
Copy number;
Total copy number=A*V of genome in the mixed liquor of the several human tumor cell line genomic DNA dilutionA
+B*VB+…..+N*VN;
Wherein A is the copy number of unit volume A cellular genome dilution, VAFor the volume of A cellular genome dilution;
B is the copy number of unit volume B cell genome dilution, VBFor the volume of B cell genome dilution;N is unit volume N
The copy number of cellular genome dilution, VNFor the volume of N cellular genome dilution.
Preferably, it includes people that 1/2 genetic mutation of BRCA is positive, stablizes the human tumor cell line genomic DNA of passage
Tumor cell line GM13705, GM13707, GM13708, GM13709, GM13710, GM13711, GM13712, GM13713,
GM13714, GM13715, GM14090, GM14092, GM14093, GM14095, GM14096, GM14097, GM14170,
GM14622, GM14623, GM14624, GM14626, GM14634, GM14636, GM14637, GM14638, GM14639,
One or more of GM14684, GM14788, GM14805, GM16105 and GM17509 genomic DNA.
Preferably, it includes human tumor cells that 1/2 genetic mutation of BRCA is positive, stablizes the human tumor cell line of passage
It is GM13705, GM13707, GM13708 and GM13709 genomic DNA.
Preferably, the target alleles frequency of the variant sites is 6~20%.
It preferably, further include by the negative human tumor cells of no 1/2 genetic mutation of BRCA in the step 4)~step 5)
It is that genomic DNA is mixed with the several human tumor cell line genomic DNA dilution, no 1/2 gene of BRCA
The gene frequency of the negative human tumor cell line genomic DNA variant sites of variation is 0.
Preferably, the negative human tumor cell line genomic DNA of 1/2 genetic mutation of no BRCA includes that human tumour is thin
The genomic DNA of born of the same parents system HCC1599, HCT-15, Jurkat and NCI-H720;The human tumor cell line HCC1599, HCT-
The concentration of 15, Jurkat and NCI-H720 genomic DNA stands alone as 50~100ng/ μ L;The human tumor cell line HCC1599,
The volume ratio of HCT-15, Jurkat and NCI-H720 genomic DNA is (1~2): 1:1:1.
Preferably, variant sites described in step 2) include heterozygous variance site and homozygous variant sites.
Preferably, 1/2 genetic mutation of BRCA is positive, stablizes the several human tumor cell line genomic DNA of passage
Purity OD260/280 between 1.65~2.10, integrity analysis score >=7.
The present invention also provides 1/2 genetic mutations of people BRCA that the preparation method is prepared to detect quality-control product.
The present invention also provides a kind of 1/2 genetic mutation detection kits of people BRCA, including 1/2 base of people BRCA
Because variation detects quality-control product.
Beneficial effects of the present invention: people BRCA1/2 quality-control product provided by the invention includes the variation of different variation frequencies
Site is conducive to control precision of analysis;It is capable of high-flux sequence detection architecture effectively to 1/2 genetic mutation of people BRCA
Reliability is assessed, and is improved efficiency and is reduced detection Quality Control cost.
Detailed description of the invention
Fig. 1-A indicates BRCA1, the sequencing result of 4-BP DEL;
Fig. 1-B is the sequencing result of BRCA1 40-BP DEL;
Fig. 1-C is the sequencing result of BRCA2 D 2-BP DEL;
Fig. 1-D is the sequencing result of BRCA2 1-BP DEL;
Fig. 2 is to NA113705, NA113707, NA114170, and tetra- kinds of Viral RNA genomes of NA114622 carry out genome and copy
The quantitative result of shellfish number.
Specific embodiment
The present invention provides a kind of preparation methods of people BRCA1/2 genetic mutation detection quality-control product, comprising the following steps:
1) several human tumor cell line genomic DNA that is BRCA1/2 genetic mutation is positive, stablizing passage dilutes respectively
To 95~105ng/ μ L, several human tumor cell line genomic DNA dilution is obtained;
2) determination step 1 is distinguished using the method for high-flux sequence) in the human tumor cell line genomic DNA dilution
Variant sites on BRCA1/2 gene, optionally one in the variant sites are used as positive control site, choose variant sites
Wild type site be negative control site;
3) using the method for real-time fluorescence quantitative PCR in the several human tumor cell line genomic DNA dilution
The copy number of genome is quantified;
4) according to genome copy numbers and choosing in the determining several human tumor cell line genomic DNA dilution of step 3)
The target alleles frequency of middle variant sites, which calculates, obtains the mixed of the several human tumor cell line genomic DNA dilution
Composition and division in a proportion example;
5) the several human tumor cell line genomic DNA dilution is mixed according to the mixed proportion described in step 4)
It closes and obtains 1/2 genetic mutation of people BRCA detection quality-control product.
The present invention several human tumor cell line genome that is positive, stablizing passage by 1/2 genetic mutation of BRCA first
DNA is diluted to 95~105ng/ μ L respectively, obtains several human tumor cell line genomic DNA dilution.Institute in the present invention
The several human tumor cell line genomic DNA for stating positive, the stable passage of 1/2 genetic mutation of BRCA preferably includes human tumour
Cell line GM13705, GM13707, GM13708, GM13709, GM13710, GM13711, GM13712, GM13713,
GM13714, GM13715, GM14090, GM14092, GM14093, GM14095, GM14096, GM14097, GM14170,
GM14622, GM14623, GM14624, GM14626, GM14634, GM14636, GM14637, GM14638, GM14639,
One or more of GM14684, GM14788, GM14805, GM16105 and GM17509 genomic DNA;More preferably include
Human tumor cell line GM13705, GM13707, GM13708 and GM13709 genomic DNA.The BRCA 1/2 in the present invention
Genetic mutation is positive, stablizes the several human tumor cell line genomic DNA of passage is preferably purchased from Coril institute official
The DNA standard items of net.1/2 genetic mutation of BRCA is positive in the present invention, stablizes the several human tumor cell line of passage
Genomic DNA can also be by voluntarily preparing;1/2 genetic mutation of BRCA is positive, it is swollen to stablize the several people of passage
The preparation method of oncocyte system genomic DNA is preferably utilized using corresponding human tumor cell line growth logarithmic phase cell as raw material
Cellular genome extraction agent box, which is extracted, to be obtained;It extracts the cell genomic dna obtained and preferably uses Tris-EDTA buffer
(10mM Tris, pH8.0,1Mm EDTA, pH8.0) is dissolved.In the present invention, 1/2 genetic mutation of BRCA it is positive,
The concentration for stablizing the several human tumor cell line genomic DNA of passage is preferably 98~102ng/ μ L, more preferably 100ng/ μ
L;1/2 genetic mutation of BRCA is positive, stablizes the purity OD260/ of the several human tumor cell line genomic DNA of passage
280 preferably between 1.65~2.10, more preferably between 1.7~1.9;1/2 genetic mutation of BRCA is positive, steady
Surely the integrity analysis score of the several human tumor cell line genomic DNA passed on is preferably >=7, heretofore described complete
Property analysis preferably use agilent bio-analyser.In the present invention, 1/2 genetic mutation of BRCA is positive, stablizes passage
Several human tumor cell line genomic DNA appearance is transparency liquid and is visible by naked eyes impurity.
The present invention is obtaining dry kind of the human tumor cell line genomic DNA dilution, utilizes the method for high-flux sequence
The variant sites in the human tumor cell line genomic DNA dilution on 1/2 gene of BRCA are measured respectively, the optional change
One in ectopic sites is used as positive control site, and choosing the wild type site of variant sites is negative control site.In this hair
In bright, the method for the high-flux sequence is also referred to as the sequencing of two generations, be mainly characterized by can simultaneously to the sequence of input into
Row large-scale parallel sequencing obtains the sequencing result of a large amount of short sequences.The basic principle of high-flux sequence is that DNA to be measured is random
Be broken into small fragment, through end reparation, jointing sequence, PCR and etc. carry out library construction, finally use illumina,
The sequenators such as Ion Torrent are sequenced.In the present invention, the variant sites include heterozygous variance site and homozygous variation
Site, according to high-flux sequence peak figure interpretation of result, such as waveform stabilization and when specific site occurs bimodal interpretation be exist it is latent
It is heterozygous variance site in variant sites, as wave crest is stable and unimodal and interpretation is to sport homozygous variation position in specific site
Point.Heretofore described high-flux sequence can provide the frequency of mutation of variant sites.
The present invention dilutes the several human tumor cell line genomic DNA using the method for real-time fluorescence quantitative PCR
The copy number of genome is quantified in liquid.In the present invention, the specific method of the real-time fluorescence quantitative PCR is normal referring to this field
The real-time fluorescence quantitative PCR of rule, without other particular/special requirements.The calculation formula of heretofore described copy number be copy number=
10(34.29-y)/3.23, wherein y is the CT value of real-time fluorescence quantitative PCR detection.
Genome copies in the several human tumor cell line genomic DNA dilution that the present invention is obtained according to above-mentioned steps
It counts and chooses the target alleles frequency of variant sites to calculate and obtain the several human tumor cell line genomic DNA dilution
The mixed proportion of liquid.In the present invention, target alleles frequency >=5% of the variant sites, is chosen as >=10%, or >=
15%.Human tumor cell line genome where the target alleles frequency of heretofore described variant sites=variant sites
Gene in the copy number of genome/several human tumor cell line genomic DNA dilution mixed liquor in DNA dilution
Total copy number of group;Total copy number of genome in the mixed liquor of the several human tumor cell line genomic DNA dilution
=A*VA+B*VB+…..+N*VN;Wherein A is the copy number of unit volume A cellular genome dilution, VAFor A cellular genome
The volume of dilution;B is the copy number of unit volume B cell genome dilution, VBFor the body of B cell genome dilution
Product;N is the copy number of unit volume N cellular genome dilution, VNFor the volume of N cellular genome dilution.
It preferably further include that the negative human tumour of no 1/2 genetic mutation of BRCA is thin in specific implementation process of the present invention
Born of the same parents system genomic DNA is mixed with the several human tumor cell line genomic DNA dilution, and no 1/2 gene of BRCA becomes
The gene frequency of different negative human tumor cell line variant sites is 0.Preferably, the feminine gender of 1/2 genetic mutation of no BRCA
Human tumor cell line includes human tumor cell line HCC1599, HCT-15, Jurkat and NCI-H720;The human tumor cell line
The concentration of HCC1599, HCT-15, Jurkat and NCI-H720 stand alone as 50~100ng/ μ L;The human tumor cell line
The volume ratio of HCC1599, HCT-15, Jurkat and NCI-H720 are (1~2): 1:1:1.In the present invention, the no BRCA 1/2
The appearance of the negative human tumor cell line genomic DNA of genetic mutation is transparency liquid, is visible by naked eyes impurity, purity OD260/
280 preferably 1.65~2.1, Quality Control is carried out to genomic integrity using 2100 biological analyser of Agilent, DNA integrality obtains
Divide preferably >=7.If the negative human tumor cell line genomic DNA of heretofore described 1/2 genetic mutation of no BRCA and described
Dry kind of human tumor cell line genomic DNA dilution mixing, can make the target alleles frequency for obtaining the variant sites
It operates simpler.
The present invention is after obtaining the mixed proportion, according to the mixed proportion by the several human tumor cell line base
Quality-control product is detected because a group DNA dilution mixing obtains 1/2 genetic mutation of people BRCA.
The present invention also provides 1/2 genetic mutations of people BRCA that the preparation method is prepared to detect quality-control product.This
Variant sites gene frequency >=5% of the genetic mutation of BRCA 1/2 described in invention detection quality-control product;Can be used as it is positive/
Negative quality-control product, while can also be used as the reference material of the performance verifications such as repeatability, stability and detection limit as needed.This hair
1/2 genetic mutation of people BRCA of bright offer detects the high-flux sequence that quality-control product can effectively to 1/2 genetic mutation of people BRCA
The reliability of detection architecture is assessed, and is improved efficiency and is reduced detection Quality Control cost.
The present invention also provides a kind of 1/2 genetic mutation detection kits of people BRCA, including 1/2 base of people BRCA
Because variation detects quality-control product.In the present invention, the 1/2 genetic mutation detection kit of people BRCA also wraps expansion for people BRCA 1/
Any other component of the high-flux sequence detection of 2 genetic mutations.In preferred embodiments, 1/2 gene of people BRCA
Mutation test kit further comprises that enzymatic mixture, end reparation reaction buffer, DNA ligase, company are repaired selected from end
Connect the reaction buffer, connector containing molecular label, amplified library primer, PCR premixed liquid, tab closure agent, DNA sealer, miscellaneous
Hand over buffer, hybridization enhancers, magnetic bead washing lotion, hybridization washing lotion, capture library PCR primer, capture probe, nucleic acid purification magnetic bead,
One or more reagents of streptavidin magnetic bead.The present invention does not have particular/special requirement to the source of mentioned reagent and specification, uses
The mentioned reagent of high-flux sequence field routine.
Technical solution provided by the invention is described in detail below with reference to embodiment, but they cannot be understood
For limiting the scope of the present invention.
Embodiment 1
The preparation of negative reference product
1.1. passage human tumor cell line HCC1599, HCT-15 can commonly be stablized by obtaining four from ATCC purchase,
Jurkat,NCI-H720。
1.2. using purchased from GIBCO company DMEM high glucose medium (Gibco DMEM high glucose medium Gibco article No.:
12100046) tumor cell line is cultivated, condition of culture: 37 DEG C, 5% CO2It is cultivated in constant temperature cell incubator.Culture is extremely
Cell density passes on when reaching culture dish area 80-90%, collects in exponential phase cells, the speed of 800-1000rpm/min
Centrifuging and taking precipitating, using commercialization cellular genome extracts kit (QIAamp DNA Mini Kit (50) article No.: 51304)
Extract the genome of cell line.
1.3. take the genomic DNA of each cell line after purification use respectively Tris-EDTA buffer (10mM Tris,
PH8.0,1Mm EDTA, pH8.0) it is diluted to 100-50ng/uL, appearance is transparency liquid, is visible by naked eyes impurity, and purity is
2.1 > OD260/280 > 1.65 obtain quality-control product raw material DNA, while complete to genome using 2100 biological analyser of Agilent
Property carry out Quality Control, DNA score should be 7 or more.
1.4. it is sequenced, is confirmed through Sanger method miscellaneous with genomic DNA of the Sanger PCR sequencing PCR to each cell line
It closes and homozygous variant sites is as positive control site.
1.5. take the quality-control product raw material DNA of four kinds of cell lines HCC1599, HCT-15, Jurkat, NCI-H720 according to 1:1:
1 volume ratio is uniformly mixed, -20 DEG C of preservations.
The preparation of positive reference product
The implementation case uses the GM13705, GM13707, GM13708, GM13709 purchased from coriell institute
Cellular genome NA13705, NA13707, NA13708, NA13709 carries out the preparation of positive quality control product, other positive quality controls
The preparation of product is identical as present case step.
2.1 couples of NA113705, NA113707, NA114170, tetra- kinds of Viral RNA genomes of NA114622 carry out Sanger sequencing
Whether to verify its mutational site are as follows: BRCA1,4-BP DEL, pFS1252TER c3875-4del, BRCA1 40-BP DEL,
FS397TER c1294-13 40del, BRCA2 1-BP DEL, 6174T, FS and 2-BP DEL, 6503TT.Fig. 1 is pair
NA113705, NA113707, NA114170, NA114622 carry out Sanger sequencing result;Wherein, Fig. 1-A indicates BRCA1,4-
The sequencing result of BP DEL;Fig. 1-B is the sequencing result of BRCA1 40-BP DEL;Fig. 1-C is the survey of BRCA2 D 2-BP DEL
Sequence result;Fig. 1-D is the sequencing result of BRCA2 1-BP DEL.
2.2 carry out copy number measurement to genome using Real-Time Fluorescent Quantitative PCR Technique, use SuperReal PreMix
The specific primer that Plus (Tiangeng biochemical technology Co., Ltd, BeiJing, China, article No.: FP205) combines us to design is determined
To quantitative.Primer be it is artificial synthesized, sequence is as follows:
Upstream primer: ACCTCAGTCACATAATAAGGAATGCA (SEQ ID NO:1)
Downstream primer: CTATTGGATCCAAAGAGAGGCCAA (SEQ ID NO:2)
Present position: the site the 32890495-32890521 downstream that upstream primer is located at 13 chromosomes is located at 13 chromosomes
The site 32890601-32890625, with reference to gene selects hg19.
System is as follows:
Condition is as follows
Melting curve analysis (Melting/Dissociation Curve Stage)
Measurement result such as Fig. 2, Fig. 2 are the quantitative result that four groups of genomes are carried out with genome copy numbers, from top to bottom according to
Secondary is NA113705, NA113707, NA114170, tetra- kinds of Viral RNA genomes of NA114622.
The formula y=klgX+b that regression curve is obtained according to the standard curve that plasmid is established, thus through being scaled X=
10^ ((CT-b)/k) obtains initial template copy number, and genome can be calculated in conjunction with the copy number of △ Ct value combination plasmid
Copy number:
2.3 pairs of positive cell genomes carry out gradient dilution using negative cells genome, and carry out the survey of two generations to product
Sequence.
Gradient dilution method:
1v positive reference product i (stoste)+9v negative reference product (stoste), obtain positive reference product ii
1v positive reference product ii+9v negative reference product (stoste) obtain positive reference product iii
1v positive reference product iii+9v negative reference product (stoste) obtain positive reference product iv
1v positive reference product iv+9v negative reference product (stoste) obtain positive reference product v
2.4 determine that the multiple proportions gradient dilution section of each cell of 10% frequency of mutation is NA13705:0.47;NA14170:
0.19;NA13707:0.59;NA14622:0.15.
2.5 calculate by 2.4 results and obtain each genome and need volume number to be added (total volume is as shown in table 1
100)。
The each genome of table 1 needs volume number to be added
NA13705 |
NA13707 |
NA14170 |
NA14622 |
47 |
19 |
59 |
15 |
2.6 high-flux sequences are verified
The each genome mutation frequency of table 2 and site
|
NA13705 |
NA13707 |
NA14170 |
NA14622 |
Mutational site |
4-BP DEL |
40-BP DEL |
2-BP DEL |
1-BP DEL |
The frequency of mutation |
10.12% |
9.86% |
11.23% |
10.01% |
Embodiment 2: the detection of sequencing data
Instrument used in being sequenced in the present embodiment is illumina Miseq.
The preparation method is the same as that of Example 1 for positive quality control product.
3.1DNA template extraction and Quality Control
Use Qiagen Whole Blood Genomic DNA extracts kit (Qiagen company, Germany, article No.: 51185) to 20 sun
Property blood sample in extract human gene group DNA, Yin/Yang quality-control product is ground using the purchase of cell line genome in U.S. Coriell
Institute is studied carefully, directly using without extracting.
The building of 3.2 initial libraries
Each human gene group DNA's sample takes 20ng, and quality-control product also takes 20ng, the available PCR-grade less than 50uL
Water is mended to 30uL,
3.3. sequencing library constructs
3.3.1. end is repaired and is connected with connector
3.3.2. purifying
3.4.3. sequencing library amplification and purifying
3.3. sequencing and data analysis
3.3.1. sequencing
Upper machine sequencing is carried out according to sequencing instrument and matched reagent operation instruction.Average effective overburden depth: blood sample
Greater than 300X.
3.3.2. data are analyzed
It after obtaining raw sequencing data, is compared with reference data library, carries out analysis of variance and interpretation.
Testing result is as follows:
The mutational site of clinical sample and testing result are as shown in table 3.Clinical sample detects coincidence rate: 20/20=
100%.All clinical samples are verified errorless through Sanger PCR sequencing PCR.
The mutational site of 3. clinical sample of table and testing result
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered
It is considered as protection scope of the present invention.
Sequence table
<110>Anhui Ding Jing Biotechnology Co., Ltd
Shanghai Ding Jing biological medicine Science and Technology Co., Ltd.
<120>a kind of people BRCA1/2 genetic mutation detection quality-control product and its preparation method and application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
acctcagtca cataataagg aatgca 26
<210> 2
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ctattggatc caaagagagg ccaa 24