CN110129347A - A kind of method of chemical cleavage method preparation carrier T - Google Patents
A kind of method of chemical cleavage method preparation carrier T Download PDFInfo
- Publication number
- CN110129347A CN110129347A CN201910473843.6A CN201910473843A CN110129347A CN 110129347 A CN110129347 A CN 110129347A CN 201910473843 A CN201910473843 A CN 201910473843A CN 110129347 A CN110129347 A CN 110129347A
- Authority
- CN
- China
- Prior art keywords
- carrier
- chemical cleavage
- dna
- base
- plasmid vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a kind of methods of chemical cleavage method preparation carrier T, expand plasmid vector using RNA-DNA chimeric primers；Digestion process is carried out to wild plasmid template with restriction endonuclease Dpn I, negative background caused by wild plasmid is eliminated and clones；The linearized vector of PCR amplification is subjected to chemical cleavage method processing, obtains carrier T.By the above-mentioned means, the directly simple PCR amplification of method of the invention can prepare the linearized fragment of carrier T, the technological deficiency of restriction endonuclease method and terminal deoxynucleotidyl transferase method is eliminated, simple process just can obtain carrier T.
Description
Technical field
The present invention relates to genetic engineering fields, more particularly to a kind of method of chemical cleavage method preparation carrier T.
Background technique
Traditional gene cloning disadvantage based on restriction endonuclease and DNA ligase mainly has: 1) restriction enzyme
The selection of enzyme is more troublesome, and often can not find suitable handy restriction enzyme site for Long fragment gene, lead to not into
The clone of the row gene；2) restriction endonuclease of different genes selection is different, and different restriction enzymes is needed to be handled, because
This is difficult to clone multiple genes simultaneously.
In order to solve above-mentioned technological deficiency, carrier T and TA clone technology have been invented.Carrier T is the 3 ' of linearized vector DNA
End attached the carrier of a single-chain state T base.Taq archaeal dna polymerase etc. can be at 3 ' ends of the PCR product of target gene
In addition the A base of a single-chain state.The target gene of 3 ' A base of band is mixed with carrier T, after A-T pairing, in DNA connection
Under the action of enzyme, the two is linked together, forms closed loop recombinant DNA.The operation flux of TA clone based on carrier T is big, can
To be used for high-throughput gene cloning, while several hundred a genes are cloned, therefore substituting traditional base based on restriction enzyme
Because of clone technology.
The main restrictive enzyme cutting method of method of preparation carrier T, terminal deoxynucleotidyl transferase method at present, but the two is all
There is certain defect.The available restriction enzyme of restriction enzyme cutting method is limited, only a few, it is expensive, and will be original
The restriction enzyme site (former and later two) of the previously-introduced this special preparation carrier T in the multiple cloning sites region of carrier, leads to every building
A kind of new carrier T will prepare a kind of this specific initial carrier, very time-consuming, and versatility is very poor.In addition after digestion
The small fragment removal cut away, not so can be automatically reconnected to form empty carrier in DNA ligase reaction.Bigger disadvantage
Be, endonuclease reaction quality directly decide that can carrier T be successfully prepared, if digestion is not thorough, remaining circular vectors with
The carrier that unit point digestion only occurs can generate a large amount of empty carrier (without target gene) in subsequent DNA connection reaction,
Cause positive clone rate too low, screens less than positive colony.Terminal deoxynucleotidyl transferase method is first used in flat terminal restriction
Cyclic plasmid is cut into the linear plasmid of flat end by enzyme cutting, such as EcoRV, is then existed using terminal deoxynucleotidyl transferase
3 ' ends of double-stranded DNA add a T base, to prepare carrier T.Although this method can prepare carrier T, due to end
Deoxynucleotidyl transferase can arrive several T bases plus one in 3 ' ends, thus be difficult to control the T base added in end
Quantity, and only plus the case where T base is just needed carrier T.In addition cricoid wild-type template in two methods
Removal all not no good strategies of plasmid, can bring higher negative clone background.
Summary of the invention
The invention mainly solves the technical problem of providing a kind of method of chemical cleavage method preparation carrier T, obtained T is carried
Body can be used in TA clone, it can also be used to need to carry out gene cloning, the accurate medical treatment, viral vectors structure of DNA library building
Build equal fields.
In order to solve the above technical problems, one technical scheme adopted by the invention is that: a kind of chemical cleavage method preparation T is provided
The method of carrier, including step are as follows: (1) expand plasmid vector using RNA-DNA chimeric primers, the plasmid after being expanded carries
Body；(2) the cyclic annular matter in plasmid vector after the amplification obtained with restriction endonuclease Dpn I removal process (1)
Grain template；(3) decorative features of the RNA-DNA chimeric primers according to step (1), to step (2) restriction nuclease inscribe
Enzyme DpnI treated plasmid vector PCR fragment carries out chemical cleavage method processing, obtains carrier T.
In a preferred embodiment of the present invention, the sequence signature of RNA-DNA chimeric primers described in step (1) are as follows: (a)
The base that 5 ' ends are the 1st is RNA base rA；(b) DNA fragmentation of 3 ' end base sequences and plasmid vector to be amplified matches.
In a preferred embodiment of the present invention, it is expanded described in step (1) using polymerase chain reaction PCR,
Include in amplified reaction buffer for expanding the forward primer of plasmid vector, the reverse primer for expanding plasmid vector,
Plasmid template molecule, archaeal dna polymerase, 4 kinds of deoxynucleoside triphosphates.
In a preferred embodiment of the present invention, chemical cleavage method described in step (3) is alkaline lysis.
In a preferred embodiment of the present invention, the alkaline lysis be added in plasmid vector PCR fragment it is final concentration of
The alkaline solution of 10-100 mM, and heated 1-30 minutes under 60-90 degree, rA base is removed, 3 ' end 1 T base of band of preparation
Carrier T.
In a preferred embodiment of the present invention, the alkaline solution is sodium hydroxide solution.
In a preferred embodiment of the present invention, the alkaline lysis further includes after removing rA base, with the examination of purifying DNA
Agent box or cold ethanol precipitation technology are gone unless DNA component, the carrier T of 3 ' end 1 T base of band of preparation.
The beneficial effects of the present invention are:
One, the specific support in previously prepared restriction enzyme cutting method carrier T technology of preparing is not needed, direct simple PCR amplification
The linearized fragment of carrier T can be prepared.
Two, negative clone background is extremely low.It is removed due to using PCR amplification plasmid vector, and with restriction enzyme Dpn I
Wild plasmid template eliminates the negative clone of restriction endonuclease preparation carrier T.
Three, terminal deoxynucleotidyl transferase method preparation carrier T is eliminated, the technological deficiency of multiple T bases is continuously added.
Four, RNA-DNA chimeric primers alkaline lysis does not need enzymatic treatment, it is only necessary to which the simple hot alkali treatment that carries out can be made
Standby carrier T.
Detailed description of the invention
To describe the technical solutions in the embodiments of the present invention more clearly, make required in being described below to embodiment
Attached drawing is briefly described, it should be apparent that, drawings in the following description are only some embodiments of the invention, for
For those of ordinary skill in the art, without creative efforts, it can also be obtained according to these attached drawings other
Attached drawing, in which:
Fig. 1 is the structural schematic diagram of chemical cleavage method preparation carrier T of the invention.
Specific embodiment
The technical scheme in the embodiments of the invention will be clearly and completely described below, it is clear that described implementation
Example is only a part of the embodiments of the present invention, instead of all the embodiments.Based on the embodiments of the present invention, this field is common
Technical staff's all other embodiment obtained without making creative work belongs to the model that the present invention protects
It encloses.
Embodiment one: the preparation of the carrier T based on pUC18 carrier
Referring to Fig. 1, providing a kind of preparation method of carrier T based on pUC18 carrier, including step are as follows:
(1) design synthesizes the RNA-DNA chimeric primers for expanding plasmid vector.The sequence of the RNA-DNA chimeric primers is special
Sign is :(a) the base at 5 ' the 1st, ends is RNA base rA；(b) the DNA piece of the base sequence of primer downstream and amplification plasmid vector
Section pairing.Specific primer sequence is as follows:
PUC18-F:5 ' Xgtcgacctgcaggcatgcaa
PUC18-R:5 ' Xtctagaggatccccgggtac
Wherein lowercase is that base is matched with template plasmid, and X is rA base.
(2) polymerase chain reaction (PCR) expands linearized plasmid vector DNA fragmentation.It will be used to expand linearization plasmid
The PCR of vector DNA fragment reacts (50 microlitres) component are as follows: forward primer and reverse primer (each 0.4 μM), target plasmid template point
Sub- pUC18 plasmid vector (5 nanogram), KOD archaeal dna polymerase (1 unit), 4 kinds of deoxynucleoside triphosphates (dNTPs, 0.2
MM), 1 × PCR reaction buffer carries out PCR reaction.PCR condition are as follows: 98 degree 3 minutes；(95 degree 0.5 minute, 60 degree 0.5 point
Clock, 72 degree 5 minutes) × 30 circulation；72 degree × 8 minutes；16 degree 3 minutes.
(3) the DpnI digestion of ring plasmid template.It is digested with restriction endonuclease Dpn I wild in PCR reaction
Type ring plasmid template is eliminated negative background caused by wild plasmid and is cloned.Directly it is added in 200 microlitres of PCR products
DpnI is 10 units, and 37 degree of reaction time are 2 hours.The restriction endonuclease Dpn I can specific recognition cutting
The G that A methylates in template plasmid double-stranded DNAmATC sequence, the processing of Dpn I is so that plasmid template becomes the short DNA of many sections
Double-strand, these short DNA double chain conversion Escherichia coli can not generate clone, to eliminate the vacation of ring plasmid template generation
Positive mutants body.
(4) prepared by carrier T.The PCR of the linearization plasmid of DpnI processing is added in alkaline lysis reaction system (250 microlitres)
240 microlitres, 10 microlitres 0.5M NaOH of segment, 90 degree are reacted 3 minutes, and the rA base of 5 ' ends is removed；It is purified using PCR product
Kit purifies hot alkali treatment reactant, removes the non-DNA component of the inside, and DNA is eluted in water or TE buffer
In, it is successfully prepared the carrier T of 3 ' end 1 T base of band.The carrier T of preparation can be used to TA clone through simple DNA purifying.
The above description is only an embodiment of the present invention, is not intended to limit the scope of the invention, all to utilize this hair
Equivalent structure or equivalent flow shift made by bright description is applied directly or indirectly in other relevant technology necks
Domain is included within the scope of the present invention.
Claims (7)
1. a kind of method of chemical cleavage method preparation carrier T, which is characterized in that including step are as follows: (1) chimeric using RNA-DNA
Primer amplification plasmid vector, the plasmid vector after being expanded；(2) it is obtained with restriction endonuclease Dpn I removal process (1)
To the amplification after plasmid vector in ring plasmid template；(3) the RNA-DNA chimeric primers according to step (1)
Decorative features, chemical cleavage method is carried out to step (2) restriction endonuclease DpnI treated plasmid vector PCR fragment
Processing, obtains carrier T.
2. the method for chemical cleavage method preparation carrier T according to claim 1, which is characterized in that described in step (1)
The sequence signature of RNA-DNA chimeric primers are as follows: the base that the 5 ' end (a) is the 1st is RNA base rA；(b) 3 ' end base sequences with
The DNA fragmentation of plasmid vector to be amplified matches.
3. the method for chemical cleavage method preparation carrier T according to claim 1, which is characterized in that expand described in step (1)
Increase using polymerase chain reaction PCR, include in amplified reaction buffer for expand the forward primer of plasmid vector,
For expanding reverse primer, plasmid template molecule, archaeal dna polymerase, the 4 kinds of deoxynucleoside triphosphates of plasmid vector.
4. the method for chemical cleavage method preparation carrier T according to claim 1, which is characterized in that change described in step (3)
Learning cracking process is alkaline lysis.
5. the method for chemical cleavage method according to claim 4 preparation carrier T, which is characterized in that the alkaline lysis be
The alkaline solution of final concentration of 10-100 mM is added in plasmid vector PCR fragment, and is heated 1-30 minutes under 60-90 degree, goes
Except rA base, the carrier T of 3 ' end 1 T base of band of preparation.
6. the method for chemical cleavage method according to claim 5 preparation carrier T, which is characterized in that the alkaline solution is
Sodium hydroxide solution.
7. the method for chemical cleavage method preparation carrier T according to claim 5, which is characterized in that the alkaline lysis also wraps
It includes after removing rA base, with the kit of purifying DNA or cold ethanol precipitation technology is gone unless DNA component, 3 ' 1, band, end of preparation
The carrier T of T base.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910473843.6A CN110129347A (en) | 2019-06-01 | 2019-06-01 | A kind of method of chemical cleavage method preparation carrier T |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910473843.6A CN110129347A (en) | 2019-06-01 | 2019-06-01 | A kind of method of chemical cleavage method preparation carrier T |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110129347A true CN110129347A (en) | 2019-08-16 |
Family
ID=67579756
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910473843.6A Pending CN110129347A (en) | 2019-06-01 | 2019-06-01 | A kind of method of chemical cleavage method preparation carrier T |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110129347A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058361A (en) * | 2016-12-28 | 2017-08-18 | 苏州旷世骏弛生物科技有限公司 | Ligase dependent/non-dependent gene clone method based on ribonucleotide Mdification primer |
| CN109266672A (en) * | 2018-10-26 | 2019-01-25 | 苏州博睐恒生物科技有限公司 | A kind of preparation method of carrier T |
| CN109266725A (en) * | 2018-09-27 | 2019-01-25 | 苏州泰康吉安仪器科技有限公司 | A kind of gene clone method using RNA site specific nucleic acid enzyme |
-
2019
- 2019-06-01 CN CN201910473843.6A patent/CN110129347A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058361A (en) * | 2016-12-28 | 2017-08-18 | 苏州旷世骏弛生物科技有限公司 | Ligase dependent/non-dependent gene clone method based on ribonucleotide Mdification primer |
| CN109266725A (en) * | 2018-09-27 | 2019-01-25 | 苏州泰康吉安仪器科技有限公司 | A kind of gene clone method using RNA site specific nucleic acid enzyme |
| CN109266672A (en) * | 2018-10-26 | 2019-01-25 | 苏州博睐恒生物科技有限公司 | A kind of preparation method of carrier T |
Non-Patent Citations (1)
| Title |
|---|
| 栾怡等: "TA克隆的应用研究", 《山东医科大学学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10421957B2 (en) | DNA assembly using an RNA-programmable nickase | |
| US8329887B2 (en) | Synthesis of tagged nucleic acids | |
| US7368265B2 (en) | Selective genome amplification | |
| US20170356026A1 (en) | Methods for RT-PCR comprising an anionic polymer | |
| CN101067133B (en) | Ligase independent gene cloning process based on thio-modification | |
| CN107058361A (en) | Ligase dependent/non-dependent gene clone method based on ribonucleotide Mdification primer | |
| CN105420225A (en) | Iodine dissociation type gene cloning method based on sulfo-modifiers | |
| CN107488655B (en) | Method for removing 5 'and 3' adaptor connection by-products in sequencing library construction | |
| CN105969784A (en) | Recombinase-independent DNA (deoxyribonucleic acid) seamless cloning method | |
| CN113227370B (en) | Single-stranded DNA synthesis method | |
| CN110129347A (en) | A kind of method of chemical cleavage method preparation carrier T | |
| CN110724728B (en) | Preparation method of circular DNA | |
| CN109266672A (en) | A kind of preparation method of carrier T | |
| WO2020252720A1 (en) | Method for constructing library on basis of rna samples, and use thereof | |
| CN110499310A (en) | A kind of novel gene cloning process independent of enzyme | |
| CN112534062A (en) | Cleavable partner primers and methods of amplifying nucleic acid sequences using the same | |
| CN109266670A (en) | The method for carrying out gene cloning and point mutation using dI base | |
| CN101535478B (en) | Nucleic acid amplification method | |
| CN110564754A (en) | Gene cloning method using dU-tolerant high-fidelity DNA polymerase | |
| CN109266671A (en) | The method for carrying out gene cloning and point mutation using dU and endoQ | |
| CN109439682A (en) | Utilize the method for the gene cloning of dU and archaeal archaeal dna polymerase | |
| JP5129498B2 (en) | Nucleic acid cloning method | |
| JP2020096564A (en) | RNA detection method, RNA detection nucleic acid, and RNA detection kit | |
| CN109266644A (en) | A method of gene site-directed saturation mutation is carried out using dI primer | |
| CN109266725A (en) | A kind of gene clone method using RNA site specific nucleic acid enzyme |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190816 |