CN110106243A - Based on Sanger PCR sequencing PCR to the detection method of Pax1 gene promoter zone methylation multidigit point - Google Patents
Based on Sanger PCR sequencing PCR to the detection method of Pax1 gene promoter zone methylation multidigit point Download PDFInfo
- Publication number
- CN110106243A CN110106243A CN201910333862.9A CN201910333862A CN110106243A CN 110106243 A CN110106243 A CN 110106243A CN 201910333862 A CN201910333862 A CN 201910333862A CN 110106243 A CN110106243 A CN 110106243A
- Authority
- CN
- China
- Prior art keywords
- pcr
- pax1
- sanger
- sequencing
- gene promoter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of based on Sanger PCR sequencing PCR to the detection method of Pax1 gene promoter zone methylation multidigit point, the pax1 gene promoter zone amplication primer that the present invention designs is divided into two pairs, a pair is methylated amplification primer, a pair is non-methylated amplification primer, amplified fragments size is in 150bp or so, segment contains 9 methylation sites, cooperates ABI3720xl microarray dataset to carry out Sanger sequencing after amplification.Method provided by the invention can once sequencing can take 9 sites of PAX1 promoter region methylation status as a result, and existing Pax1 sonde method patent mostly only detect a site, Limited information is provided；The period of Sanger sequencing is very short, more suitable with qPCR sonde method than the sequencing of two generations short 5-7 days；PCR adds Sanger sequencing experimental implementation to be easy, and sequencing result interpretation is directly very clear, does not need data analysis experience.
Description
Technical field
The invention belongs to gene diagnosis technical fields, and in particular to one kind is based on Sanger PCR sequencing PCR to Pax1 gene promoter
The detection method of sub-district methylation multidigit point.
Background technique
Cervical carcinoma refers to occurring a kind of malignant tumour in cervical department and cervical guide, belongs to common gynecological tumor, hair
Raw rate is only second to breast cancer.The whole world has 200,000 people because of cervical carcinoma death every year, domestic annual nearly 50,000 people because cervical carcinoma and
Extremely.An important factor for HPV viruse infection is uterine neck carcinogenesis and development, there are HPV senses for about 90% cervical cancer patient
Dye.Current clinically common screening methods of cervical cancer includes cytolgical examination (TCT), the detection of HPV parting.
Though cervical carcinoma is malignant tumour, its occurrence and development have a progressive evolution process, and the time can be from number
Year arrives many decades, it is considered that this evolution process passes through the stages several in this way: slight, moderate and severe intraepithelial neoplasia sample disease
Change, early invasive carcinoma, infiltrating carcinoma.Precancerous lesion refers to that clinically three by histopathology detection are by stages, slight (CIN1),
Moderate (CIN2), severe intraepithelial neoplasia (CIN3).The accurate evaluation of precancerous lesion clinical stages to the treatment of patient extremely
Close important, but conventional pathological tissue detection goldstandard needs to perform the operation, cone cutting tissue is detected, there is wound to patient, and
And there are also higher cost, the disadvantages of operation difficulty is big, and reporting cycle is long.The cancer that clinic needs one kind quick and precisely and wound is small
Preceding lesion CIN2+ screening means.
DNA methylation is a kind of important apparent modification, it is not in the case where changing DNA sequence dna, to gene expression mould
Formula and the stability of genome play important regulating and controlling effect.PAX1 gene is tumor suppressor gene, its normal function is that regulation is thin
Born of the same parents' differentiation, but the gene methylates, and will be unable in conjunction with transcription factor, express can decline, even silencing, cell differentiation
Function is obstructed, cell Proliferation etc..Majority researches show that PAX1 gene methylation levels with the increase of cervical lesions severity and
It increases, can be used as the biological markers of cervical carcinoma and precancerous lesion screening.
Summary of the invention
To solve problems of the prior art, the present invention is provided one kind and is opened based on Sanger PCR sequencing PCR Pax1 gene
The detection method of mover zone methylation multidigit point, according to sequencing the following steps are included:
(1) clinical cervical exfoliated cell sample is subjected to DNA extraction, concentration mensuration is carried out to the DNA of extraction；
(2) DNA after extracting carries out bisulphate conversion, and system goes bisulphate is last to obtain through over cleaning purifying after reaction
To pure converted product, it is directly used in and expands in next step；
(3) by Multiplex PCR master mix, forward primer, reverse primer, converted product and seedless sour water group
PCR amplification is carried out at PCR system；
(4) PCR product is sequenced after purification.
Preferably, in step (3), the title and sequence of the forward primer and reverse primer are as follows:
pax1-2F(M)GAATTAATGAGTTGTTAATTCGCGCGT
pax1-2R(M)CCGATTAAAAAAAATTCGTCTAACCGAA
pax1-2F(U)GGGAATTAATGAGTTGTTAATTTGTGTGT
pax1-2R(U)CCAATTAAAAAAAATTCATCTAACCAAA。
In any of the above-described scheme preferably, in step (1), DNA extracts the QIAamp for selecting Qiagen company
Blood Mini kit, the model Qubit 3.0 for the fluorescent quantitation instrument that DNA concentration measurement uses.
In any of the above-described scheme preferably, in step (2), the system of bisulphate conversion are as follows: DNA 300-
500ng, CT conversion reagent 130ul, the reaction condition of setting are as follows: temperature 98 DEG C of 10min, 64 DEG C of 2.5h, 4 DEG C
It keeps.
In any of the above-described scheme preferably, in step (2), the concrete operations of purifying are cleaned are as follows: the system after reaction
First pass through M-Wash buffer cleaning purifying twice, then primary by M-Desulphonation buffer cleaning purifying.
In any of the above-described scheme preferably, in step (3), the additional amount of PCR system are as follows: Multiplex PCR
Master mix 12.5ul, forward primer 1ul, reverse primer 1ul, converted product 2ul, seedless sour water 8.5ul.
In any of the above-described scheme preferably, in step (3), the condition of PCR reaction setting are as follows: 95 DEG C of 2min；95℃
30s, 54 DEG C of 30s, 72 DEG C of 60s, 35 circulations；72℃10min.
In any of the above-described scheme preferably, in step (4), sequencing procedure is by ABI 3730xl sequenator flat
Sanger sequencing is carried out on platform.
The invention has the benefit that
(1) once sequencing can take the methylation status in 9 sites of PAX1 promoter region as a result, and existing Pax1 probe
Method patent only detects a site mostly, provides Limited information；
(2) period of Sanger sequencing is very short, more suitable with qPCR sonde method than the sequencing of two generations short 5-7 days；
(3) PCR adds Sanger sequencing experimental implementation to be easy, and sequencing result interpretation is directly very clear, does not need data point
Analysis experience.
Detailed description of the invention
Fig. 1 is that methylation Sanger sequencing result occurs for site；
Fig. 2 is that the Sanger sequencing result that methylates does not occur for site.
Specific embodiment
In order to be further understood that summary of the invention of the invention, the present invention is elaborated below in conjunction with specific embodiment.
The pax1 gene promoter zone amplication primer that the present invention designs is divided into two pairs, and a pair is methylated amplification primer, and one
To being non-methylated amplification primer, for amplified fragments size in 150bp or so, segment contains 9 methylation sites, matches after amplification
It closes ABI3720xl microarray dataset and carries out Sanger sequencing, specific steps are as follows:
(1) clinical cervical exfoliated cell sample carries out DNA using the QIAamp Blood Mini kit of Qiagen company
It extracts, DNA concentration measurement uses Qubit 3.0；
(2) DNA after extracting carries out bisulphate conversion, uses the EZ DNA Methylation-Gold of ZYMO company
Kit, steps are as follows:
Bisulphate converts (150ul):
| Composition | Volume/amount of DNA |
| DNA | 20ul(300-500ng) |
| CT conversion reagent | 130ul |
Reaction condition:
| Temperature | Time |
| 98℃ | 10min |
| 64℃ | 2.5hr |
| 4℃ | It is unlimited |
System is by M-Wash buffer twice and a M-Desulphonation buffer cleaning purifying after reaction
It goes bisulphate to finally obtain pure converted product, is directly used in and expands in next step；
(3) PCR amplification, primer sequence and system mixing are shown in Table 1；
| Primer | Sequence |
| pax1-2F(M) | GAATTAATGAGTTGTTAATTCGCGCGT |
| pax1-2R(M) | CCGATTAAAAAAAATTCGTCTAACCGAA |
| pax1-2F(U) | GGGAATTAATGAGTTGTTAATTTGTGTGT |
| pax1-2R(U) | CCAATTAAAAAAAATTCATCTAACCAAA |
1 primer sequence table of table
PCR reaction system (25ul):
Response procedures:
PCR carries out once purifying after reaction can carry out Sanger survey on ABI 3730xl sequenator platform
Sequence；
(4) sequencing data analysis result is as follows:
As shown in Figure 1, if the set peak that C and T is shown in methylation Sanger sequencing result, i.e. this sample occur for site
The part C for not being methylated modification has been converted to T, and normal person is then as shown in Fig. 2, substantially all C is converted into T.
| Cervical lesions are by stages | SCC | CIN3 | CIN2+CIN2/3 | CIN1 |
| Sample size | 13 | 21 | 42 | 36 |
| Methylation positive rate | 100% | 76.1% | 52.3% | 13.8% |
2 accuracy test result of table
By carrying out the test of method accuracy to batch clinical sample, it the results are shown in Table 2, have detected 112 clinical samples altogether
This, these samples all did the clear precancerous lesion of pathological examination by stages.The verification and measurement ratio of Cervix Squamous Cell cancer is 100%,
The recall rate of CIN3, CIN2 and CIN1 are respectively 76%, 52% and 13.8%.Wherein the methylation positive rate of CIN1 is ground with other
Study carefully compared to somewhat high, it may be possible to because the accumulation of CIN1 sample size is not enough, as sample accumulation increase data also can be more and more accurate.
It will be apparent to those skilled in the art that it is of the invention based on Sanger PCR sequencing PCR to the gene promoter area Pax1 methyl
The detection method for changing multidigit point includes summary of the invention and specific embodiment part and the attached drawing institute of aforementioned present invention specification
Any combination of each section shown, as space is limited and to keep specification concise without these combining each scheme one constituted
One description.All within the spirits and principles of the present invention, any modification, equivalent substitution, improvement and etc. done should be included in this
Within the protection scope of invention.
Sequence table
<110>Nanjing Ge Zhi medical test Co., Ltd
<120>based on Sanger PCR sequencing PCR to the detection method of Pax1 gene promoter zone methylation multidigit point
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 55
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gaattaatga gttgttaatt cgcgcgtccg attaaaaaaa attcgtctaa ccgaa 55
<210> 2
<211> 57
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gggaattaat gagttgttaa tttgtgtgtc caattaaaaa aaattcatct aaccaaa 57
Claims (8)
1. it is a kind of based on Sanger PCR sequencing PCR to the detection method of Pax1 gene promoter zone methylation multidigit point, according to successively suitable
Sequence the following steps are included:
(1) clinical cervical exfoliated cell sample is subjected to DNA extraction, concentration mensuration is carried out to the DNA of extraction；
(2) DNA after extracting carries out bisulphate conversion, and to go bisulphate to finally obtain pure through over cleaning purifying for system after reaction
Net converted product is directly used in and expands in next step；
(3) Multiplex PCR master mix, forward primer, reverse primer, converted product and seedless sour water are formed into PCR
System carries out PCR amplification；
(4) PCR product is sequenced after purification.
2. the detection according to claim 1 based on Sanger PCR sequencing PCR to Pax1 gene promoter zone methylation multidigit point
Method, which is characterized in that in step (3), the title and sequence of the forward primer and reverse primer are as follows:
pax1-2F(M)GAATTAATGAGTTGTTAATTCGCGCGT
pax1-2R(M)CCGATTAAAAAAAATTCGTCTAACCGAA
pax1-2F(U)GGGAATTAATGAGTTGTTAATTTGTGTGT
pax1-2R(U)CCAATTAAAAAAAATTCATCTAACCAAA。
3. the detection according to claim 1 based on Sanger PCR sequencing PCR to Pax1 gene promoter zone methylation multidigit point
Method, which is characterized in that in step (1), DNA extracts the QIAamp Blood Mini kit for selecting Qiagen company, DNA
The model Qubit 3.0 for the fluorescent quantitation instrument that concentration mensuration uses.
4. the detection according to claim 1 based on Sanger PCR sequencing PCR to Pax1 gene promoter zone methylation multidigit point
Method, which is characterized in that in step (2), the system of bisulphate conversion are as follows: DNA 300-500ng, CT conversion
Reagent 130ul, the reaction condition of setting are as follows: temperature 98 DEG C of 10min, 64 DEG C of 2.5h, 4 DEG C of holdings.
5. the detection according to claim 1 based on Sanger PCR sequencing PCR to Pax1 gene promoter zone methylation multidigit point
Method, which is characterized in that in step (2), clean the concrete operations of purifying are as follows: the system after reaction first passes through M-Wash
Buffer cleaning purifies twice, then primary by M-Desulphonation buffer cleaning purifying.
6. the detection according to claim 1 based on Sanger PCR sequencing PCR to Pax1 gene promoter zone methylation multidigit point
Method, which is characterized in that in step (3), the additional amount of PCR system are as follows: Multiplex PCR master mix 12.5ul,
Forward primer 1ul, reverse primer 1ul, converted product 2ul, seedless sour water 8.5ul.
7. the detection according to claim 6 based on Sanger PCR sequencing PCR to Pax1 gene promoter zone methylation multidigit point
Method, which is characterized in that in step (3), the condition of PCR reaction setting are as follows: 95 DEG C of 2min；95 DEG C of 30s, 54 DEG C of 30s, 72
DEG C 60s, 35 circulations；72℃ 10min.
8. the detection according to claim 1 based on Sanger PCR sequencing PCR to Pax1 gene promoter zone methylation multidigit point
Method, which is characterized in that in step (4), sequencing procedure is that Sanger survey is carried out on platform by ABI 3730xl sequenator
Sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910333862.9A CN110106243A (en) | 2019-04-24 | 2019-04-24 | Based on Sanger PCR sequencing PCR to the detection method of Pax1 gene promoter zone methylation multidigit point |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910333862.9A CN110106243A (en) | 2019-04-24 | 2019-04-24 | Based on Sanger PCR sequencing PCR to the detection method of Pax1 gene promoter zone methylation multidigit point |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110106243A true CN110106243A (en) | 2019-08-09 |
Family
ID=67486548
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910333862.9A Pending CN110106243A (en) | 2019-04-24 | 2019-04-24 | Based on Sanger PCR sequencing PCR to the detection method of Pax1 gene promoter zone methylation multidigit point |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110106243A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112322742A (en) * | 2020-12-03 | 2021-02-05 | 广东辉锦创兴生物医学科技有限公司 | Fluorescent quantitative PCR detection kit for PAX1 gene methylation detection and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101831490A (en) * | 2009-03-12 | 2010-09-15 | 上海市第八人民医院 | Method and kit for detecting cervical carcinoma by using PAX1 and CDH1 gene methylation |
| CN106755491A (en) * | 2017-01-24 | 2017-05-31 | 韩林志 | Primer pair, kit and method based on the detection of cervical carcinoma specific methylation |
| CN107287294A (en) * | 2017-06-14 | 2017-10-24 | 广州中心法则生物科技有限公司 | A kind of detection primer, probe, kit and its application of cervical cancer-related genes methylation |
-
2019
- 2019-04-24 CN CN201910333862.9A patent/CN110106243A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101831490A (en) * | 2009-03-12 | 2010-09-15 | 上海市第八人民医院 | Method and kit for detecting cervical carcinoma by using PAX1 and CDH1 gene methylation |
| CN106755491A (en) * | 2017-01-24 | 2017-05-31 | 韩林志 | Primer pair, kit and method based on the detection of cervical carcinoma specific methylation |
| CN107287294A (en) * | 2017-06-14 | 2017-10-24 | 广州中心法则生物科技有限公司 | A kind of detection primer, probe, kit and its application of cervical cancer-related genes methylation |
Non-Patent Citations (2)
| Title |
|---|
| MEZAAL,M.I等: "LC113892.1", 《GENEBANK》 * |
| MEZAAL,M.I等: "LC113893.1", 《GENEBANK》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112322742A (en) * | 2020-12-03 | 2021-02-05 | 广东辉锦创兴生物医学科技有限公司 | Fluorescent quantitative PCR detection kit for PAX1 gene methylation detection and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104357443B (en) | A kind of detection of the long-chain non-coding RNA for bladder cancer examination and its application | |
| CN112094907B (en) | Peripheral red blood cell micronucleus DNA and application thereof | |
| CN112646882B (en) | Composition and diagnostic reagent for detecting cervical high-grade lesion and cervical cancer | |
| CN108085395A (en) | Primer sets, kit and the method for cervical carcinoma polygenes DNA methylation assay based on high-flux sequence | |
| CN114672568B (en) | Kit for detecting cervical cell gene methylation | |
| CN109055563A (en) | The related cyclic annular rna gene of colorectal cancer, colorectal cancer molecular marker and its application | |
| CN108368552A (en) | Infiltrating cancer, the gynecological cancer and ZIC1 the and GHSR molecular diagnostic markers of anogenital cancer disease and its high-level cercinoma prophase pathologic change of non-HPV inductions for HPV inductions | |
| CN110093454A (en) | The amplification sequencing approach analyzed for a variety of HPV Classification Identifications and genome conformity | |
| CN115820847A (en) | Detection reagent for methylation of cervical cancer related genes and application thereof | |
| CN107519193A (en) | Esophageal squamous cell carcinoma early molecule diagnosis marker and its application | |
| CN106967792B (en) | DKK-3 gene methylation diagnostic reagent system, kit and application thereof | |
| CN112375824B (en) | Application of MSC as cervical cancer diagnosis, prognosis and/or treatment marker | |
| CN110106243A (en) | Based on Sanger PCR sequencing PCR to the detection method of Pax1 gene promoter zone methylation multidigit point | |
| CN105177164A (en) | Molecular marker for early screening cervical cancer and detecting primers | |
| CA3181473A1 (en) | Tumor detection reagent and kit | |
| CN107177676A (en) | Long-chain non-coding RNA NONHSAT113026 is used for the purposes of Diagnosis of Renal Cell Carcinoma molecular marker | |
| RU2569154C1 (en) | Differential diagnostic technique for individual's thyroid new growths | |
| CN110172512A (en) | A kind of application of carcinoma of endometrium biomarker in cancer diagnosis and the prediction of prognosis situation | |
| CN113528662B (en) | CircRNA marker, specific primer pair, kit and application for detecting cervical cancer | |
| CN110791567B (en) | Single-site DNA methylation detection kit | |
| CN109161590A (en) | Application of the Integrin beta4 gene DNA methylation sites in preparation asthma and/or the biomarker of COPD early diagnosis | |
| CN114107514A (en) | miRNA molecular marker for colorectal cancer diagnosis and kit thereof | |
| CN114717311A (en) | Marker, kit and device for detecting urothelial cancer | |
| CN106566894A (en) | Primer and probe for HPV (Human Papilloma Virus) high-risk infection screening, and purpose thereof | |
| CN115803448A (en) | Micronucleus DNA from peripheral red blood cells and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200731 Address after: Room 1201, 1205-1207, 1211-1212, block a, Zhongdan Ecological Life Science Industrial Park, No. 3-1, xinjinhu Road, Jiangbei new district, Nanjing, Jiangsu Province Applicant after: NANJING GEZHI GENOMICS BIOTECHNOLOGY Co.,Ltd. Address before: High tech Development Zone in Nanjing City, Jiangsu province 212028 Danish Ecological Life Science Industrial Park A building 1201 room Applicant before: Nanjing Gezhi Medical Laboratory Co.,Ltd. |