CN110093362A - Efficiently auxiliary produces functional gene carrier pET32a-fdhD and its building of hydrogen - Google Patents
Efficiently auxiliary produces functional gene carrier pET32a-fdhD and its building of hydrogen Download PDFInfo
- Publication number
- CN110093362A CN110093362A CN201910204925.0A CN201910204925A CN110093362A CN 110093362 A CN110093362 A CN 110093362A CN 201910204925 A CN201910204925 A CN 201910204925A CN 110093362 A CN110093362 A CN 110093362A
- Authority
- CN
- China
- Prior art keywords
- fdhd
- pet32a
- gene
- hydrogen
- carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P3/00—Preparation of elements or inorganic compounds except carbon dioxide
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses functional gene carrier pET32a-fdhD and its construction method that efficient auxiliary produces hydrogen, are related to gene engineering technology field.PET32a-fdhD genophore is the pET32a plasmid for including bacillus cereus fdhD gene.It is the fdhD genetic fragment that hydrogenlyase is assisted in bacillus cereus to be expanded by design primer, and be connected to containing in the pET32a segment for being correspondingly connected with end with recombinase that it, which is constructed, carries out gene sequencing, verifies the integrality of gene.PET32a-fdhD plasmid is transformed into Escherichia coli, addition sodium formate is substrate in producing hydrogen culture medium, cultivates this bacterium production hydrogen.PET32a-fdhD can be applied in different bacterium, can improve hydrogen generation efficiency, can improve the Escherichia coli that existing industry produces hydrogen.
Description
Technical field
The present invention relates to gene engineering technology field, in particular to a kind of efficient auxiliary produces hydrogen functional gene carrier
PET32a-fdhD and its building and application.
Background technique
Hydrogen Energy is concerned as the energy of cleaning and high thermal energy.Though hydrogen energy source can be obtained by chemical method, because
Its at high cost and problem of environmental pollution that may cause and disputed on, and bio-hydrogen then can solve this problem.Biological production
The microorganism of hydrogen has very much, and wherein Escherichia coli produce no matter hydrogen from cost or is all one of optimal selection from the point of view of efficiency.Mesh
Come to see, wild Escherichia coli do not produce hydrogen or production hydrogen is less, are unable to satisfy demand of the mankind to the energy, therefore, gene work
Journey or metabolic engineering method, which are just used to transformation Escherichia coli, increases significantly its H2-producing capacity.Existing production hydrogen Escherichia coli
Consumption substrate is more, but the hydrogen generated is fewer, and efficiency is also relatively low, is badly in need of making its production hydrogen by transformation introducing foreign gene
Efficiency increases substantially, and the hydrogen generation efficiency of different foreign genes also difference.
Summary of the invention
The object of the present invention is to provide the carrier pET32-fdhD that an efficient auxiliary produces hydrogen functional gene, and its building
Method.It can be applied to also the hydrogen generation efficiency of hydrogen-producing bacteria can be made to significantly improve in e. coli bl21 (DE3).
In order to solve the above technical problems, the technical solution used in the present invention is:
The present invention provides a kind of carrier pET32a-fdhD of efficient auxiliary production hydrogen functional gene, to include waxy
The pET32a-fdhD plasmid of bacillus fdhD gene.Production hydrogen plasmid pET32a-fdhD constructed by the present invention can be used to improve
Hydrogen-producing bacteria increases substantially hydrogen generation efficiency.When the sodium formate for adding final concentration of 40mmol/L is substrate, hydrogen output reaches
0.2molH2/L/h.(explanation: fdhD gene in bacillus cereus is subjected to clone and is used to improve hydrogen output as present invention head
Wound, select pET32a be carrier and fdhD gene to be recombinated also be innovation of the invention.It is first during construction of recombinant plasmid
First filtering out has the fdhD gene for producing hydrogen function in Bacillus cereus, and then carries out performance measurement to it, verifies the gene
Not only there is the performance for producing hydrogen, but also can be realized the purpose for improving hydrogen generation efficiency.)
The present invention also provides the construction methods of functional gene carrier pET32a-fdhD, mainly by using clone
smarter technologyTMKit Seamless Assembly Cloning Kit completes recombining reaction.
(explanation: this method is different from the past using T4 ligase connection genetic fragment and carrier, can overcome in genetic fragment
The shortcomings that being cut out if containing restriction enzyme site.And the method is easy to operate, save double digestion, connection and etc., letter
Change operating process, saves manpower.Improve the building efficiency of recombinant plasmid.)
Specific operation process is the following steps are included: prepared by (1) linearized vector: the use of pET32a being carrier, uses double enzymes
Blanking method obtains linearized vector.According to the digestion point design primer on pET32a, PCR amplification fdhD genetic fragment, wherein make
To be preferred, the restriction enzyme site of the fdhD gene is Nde I, Xho I.
(2) prepared by DNA fragmentation: the primer of fdhD gene in design bacillus cereus, and expands fdhD gene.
(3) recombining reaction: by the way that recombinase is added, ready linearized vector has been connected with fdhD genetic fragment
Come, obtains recombinant vector.
(4) it converts: the recombinant vector built is transferred in competent E.coli DH5 α.
(5) identification of positive recombinant: picked clones bacterium, using the primer at vector cloning sites both ends as bacterium colony PCR
The amplimer of reaction carries out bacterium colony PCR reaction, is identified by electrophoresis, after determining recon, then extracts plasmid, sequencing.
The present invention also provides the applications that efficient auxiliary produces hydrogen functional gene carrier pET32a-fdhD: by pET32a-
FdhD plasmid is transformed into e. coli bl21 (DE3), this Escherichia coli production hydrogen is cultivated in producing hydrogen culture medium.(explanation:
Selecting e. coli bl21 (DE3) is host strain, and the plasmid of building is transformed into this bacterium and is used to produce hydrogen reaction, and the present invention
Innovation.)
Bacillus cereus in the present invention, the spit of fland Cong Puru biotechnology Beijing Co., Ltd buys.
The beneficial effects of the invention are as follows pET32a-fdhD can be applied in Escherichia coli, can make less thin of hydrogen output
The hydrogen generation efficiency of bacterium significantly improves, and hydrogen faster and more can be generated by consuming same concentration of substrate.Existing industry can be improved
Produce the Escherichia coli of hydrogen.
Detailed description of the invention
The present invention will be further explained below with reference to the attached drawings:
Fig. 1 is the constructing plan schematic diagram and its Western-blot electrophoretogram of carrier pET32a-fdhD；
A. construction recombination plasmid pET32a-fdhD-His
B.Western blot result
Note: swimming lane 1,2 is C in figureHCOONaThe recombination bacillus coli pET32a-fdhD of=10mmol/L；
Swimming lane 3 is CHCOONaThe control bacterium (recombinant bacterium containing empty plasmid) of=10mmol/L；
Fig. 2 is that pET32a-fdhD plasmid is transformed into the production hydrogen histogram measured in e. coli bl21 (DE3).
Specific embodiment
Below in conjunction with the embodiment and attached drawing in the present invention, technical solution in the embodiment of the present invention carry out it is clear,
It is fully described by, it is clear that described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.Base
Embodiment in the present invention, it is obtained by those of ordinary skill in the art without making creative efforts it is all its
His embodiment, shall fall within the protection scope of the present invention.
Embodiment 1:
(1) Homologous gene sequences about Bacillus cereus hydrogenlyase auxilin FDHD are searched on NCBI,
In conjunction with pET32a plasmid sequence, using DNAMAN software, the hydrogenlyase auxiliary egg with carrier homologous sequence is designed
The primer of white encoding gene.It gives designed primer to Sangon Biotech (Shanghai) Co., Ltd. and carries out primer conjunction
At.
The primer designed are as follows:
Forward-Primer:AACTTTAAGAAGGAGATATACATATGGGACCTACGCAAGAGAGTTAT
Reverse-Primer:CAGCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGGTTATTCGATCGATAACCAT
CA
(2) according to designed primer, fdhD genetic fragment is expanded using round pcr.PCR condition setting: 94 DEG C of denaturation
15s, 60 DEG C of 10s of renaturation extend 68 DEG C of 1min, 30 circulations；50 μ L systems: 25 μ L 2*HiFi-PCR Master, 22 μ L
ddH2O, 1 μ LDAN template, 2 μ L upstream primers (10 μm of ol/L), 2 μ L downstream primers (10 μm of ol/L).It (is tried with PCR amplification
Agent box, the raw work in Shanghai)
(3) PCR product is separated with agarose gel electrophoresis, and the cutting recycling genetic fragment under gel imager, most
Cutting segment is recycled with plastic recovery kit (Omega Bio-Tek, USA) afterwards, is 35 μ L genetic fragments.
(4) segment that glue recycles is sent to the sequencing of gene sequencing company, to verify the correctness of amplification gene.
(5) I double digestion pET32a carrier of restriction enzyme Nde I and Xho is used.
Agarose gel electrophoresis separation, and under gel imager cut vector large fragment, with plastic recovery kit return
It receives, obtains about 30 μ L of linearized vector.
(6) the pET32a carrier of linearisation is obtained from step (5), step (3) obtains fdhD gene, obtains through recombining reaction
10 μ L of pET32a plasmid containing fdhD genetic fragment: 1. recombining reaction (Seamless Assembly Cloning Kit,
clone smarter technologyTM): 1 μ L pET32a Vector, 3 μ L fdhD genetic fragments, 1 μ L ddH2O, 5 μ L
Seamless Master Mix；2. 50 DEG C are reacted 15 minutes；3. conversion: taking 5 μ L to be added 100 μ L's the plasmid connected
In DH5 α competence, placed 30 minutes in ice；4. 42 DEG C water-bath 30 seconds, then placed 2 minutes in ice；5. 400 μ L LB training is added
Support base (be free of antibiotic), 37 DEG C 200rpm shaken cultivation 60 minutes；6. 200 μ L of culture solution is poured into the solid LB containing ammonia benzyl
37 DEG C of overnight incubations of culture medium；Picking individual colonies are put into the LB liquid medium that 100mL contains ammonia benzyl and expand culture, finally use matter
Grain extracts kit (OmegaBio-Tek, USA) extracts plasmid.
(7) identification (bacterium colony PCR method) of positive recombinant: 1. picking clone bacterium of medium size into 10 μ L sterile waters,
It is sufficiently mixed, the template for taking 2 μ L mixed liquors to react as PCR: 2. using the primer at vector cloning sites both ends as identification weight
The amplimer 3. PCR reaction condition of group: denaturation 94 DEG C of 15s, 60 DEG C of 10s of renaturation extend 68 DEG C of 1 min, 30 circulations；④
Take 10 μ L PCR product electroresis appraisals；5. remaining 8 μ L mixed liquor is transferred to LB culture medium (benzyl containing ammonia after confirming recon
Antibiotic), 37 DEG C of overnight incubations；Finally plasmid is extracted with plasmid extraction kit (OmegaBio-Tek, USA).
(8) plasmid in (7) is sent to genome company's sequencing after amplification, to verify the integrality of gene；
(9) plasmid after having verified that in (8) is transformed into e. coli bl21 (DE3), is examined using hydrogen culture medium is produced
Its hydrogen-producing characteristic.
It is cultivated in the LB of the 250mL containing 100 μ g/mL ammonia benzyls, condition of culture: 37 DEG C, 200rpm, incubation time: 20
Hour, the Escherichia coli after being enriched with；
Escherichia coli in LB culture medium are inoculated into the 10 mL LB containing various concentration sodium formate by the amount of 1%v/v
In culture medium, anaerobic fermentation, fermentation condition: 1. 37 DEG C, 200rpm culture to OD600nm=0.6；2. IPTG inducer is added to dense
Spending is 1mM, 37 DEG C, stationary culture.After IPTG is added, per the gaseous sample for extracting 500 μ L from anaerobism bottle every other hour, use
GC3420 gas chromatograph carries out sample analysis.Analysis condition, the 5A molecular sieve of 80/100 mesh, 120 DEG C of TCD detector temperature,
80 DEG C of injector temperature, 80 DEG C of column temperature, carrier gas is high pure nitrogen.It produces hydrogen experimental period and continues 14 hours altogether.
Every 1 hour survey density of hydrogen after addition inducer, until stopping producing hydrogen, hydrogen output is calculated.It adds final concentration of
Hydrogen output highest, reaches 0.2molH in the reaction unit of 40mmol/L sodium formate2/ L/h, under the conditions of different sodium formate concentrations
It is as shown in Figure 2 to produce hydrogen rate.Experiment effect is shown, compared with the e. coli bl21 (DE3) containing empty plasmid for not producing hydrogen, is contained
The e. coli bl21 (DE3) of fdhd gene can generate hydrogen, and work well.Experiment also turns out, constructed by the present invention
Producing hydrogen plasmid pET32a-fdhD can be used to improve hydrogen-producing bacteria, increase substantially hydrogen generation efficiency.Conversion bacterial species are only limitted to
The prokaryotic micro-organisms of hydrogen is produced by ferronickel hydrogen enzyme.
Above embodiment, which is intended to illustrate the present invention, to be realized or use for professional and technical personnel in the field, to above-mentioned
Embodiment, which is modified, will be readily apparent to those skilled in the art, therefore the present invention includes but is not limited to
Above embodiment, it is any to meet the claims or specification description, meet with principles disclosed herein and novelty,
The method of inventive features, technique, product, fall within the scope of protection of the present invention.
1 catatgggacctacgcaagagagttatacaattgtacgctatcactctggtacattttca
61 aaacaaactgatgagattgttacagaatctcctattactattaaattgaatggtgaagaa
121 tatgtaacagtcgtatgtacaccaaattatattgaagatatggtaattggttttttaatt
181 tctgaggggattatttcttcctataaagatattgaagaactatgggttcaaaaagataac
241 ggaattgtccatgtaacatcatcaaaaataaatccgctctatcaaaatttatataataaa
301 cgatacatcacttcctgctgcggaaaaggtagacaaggttttattttcgctaacgatgca
361 gcaaaagcaaaagatttacatgatatacatataaaaattactcctgaagaatgcttttac
421 ttaatgaatactttacaacaatcttctactacctttcgccaaaccggcggtgttcacaat
481 accgcgctatgtgatcgaaacaatatcctcctatcaagaatggatattggaagacataat
541 gcattagataaaatatatggacattgtttacgcaacgatatatctgttaaaggaaaaatc
601 attgcatttagcgggcgtatttcatccgaaattttactcaaagtttcaaaaatcggatgt
661 gaaattgttctatctaaatccgctccaacaaaactagcattgcaactcgctcacgattta
721 ggcattactgtcgtaggatttattagaaatgactcttgtaatatttacacgcatccacat
781 cgaattgatggttatcgatcgaataactaactcgag
Claims (5)
1. auxiliary produce hydrogen functional gene carrier pET32a-fdhD, which is characterized in that the genophore be include waxy bud
Spore bacillus assists the pET32a plasmid of the fdhD gene of hydrogenlyase.
2. the method that building auxiliary as described in claim 1 produces the functional gene carrier pET32a-fdhD of hydrogen, including following step
It is rapid:
(1) primer for assisting the fdhD gene of hydrogenlyase in bacillus cereus is designed, and expands fdhD gene；
(2) genetic fragment for recycling fdhD gene, carries out the integrality of sequence verification amplification gene；
(3) I double digestion pET32a carrier of restriction enzyme Nde I and Xho is used, gel extraction obtains linearized vector；
(4) recombinase is added, ready linearized vector and fdhD genetic fragment are connected, the piece of gene containing fdhD is obtained
The recombinant vector of section；
(5) by recombinant products, DH5 α competent bacteria is converted；
(6) positive recombinant is identified by colony identification method；
(7) recombinant plasmid transformed e. coli bl21 (DE3).
3. according to the method described in claim 2, it is characterized in that the primer for expanding fdhD gene and designing is respectively as follows:
Forward-Primer:AACTTTAAGAAGGAGATATACATATGGGACCTACGCAAGAGAGTTAT；
Reverse-Primer:CAGCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGGTTATTCGATCGATAACCAT
CA。
4. the construction method of genophore pET32a-fdhD according to claim 2, which is characterized in that the fdhD base
Because being connected to carrier by restriction enzyme site Nde I, Xho I.
5. the application of functional gene carrier pET32a-fdhD, which is characterized in that by functional gene carrier described in claim 1
PET32a-fdhD is finally transformed into e. coli bl21, and addition sodium formate is substrate in producing hydrogen culture medium, and sodium formate adds
Dosage is final concentration of 40mmol/L in the medium, and recombinant bacterium is cultivated under anaerobic state and produces hydrogen.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910204925.0A CN110093362B (en) | 2019-03-18 | 2019-03-18 | Functional gene vector pET32a-fdhD for high-efficiency auxiliary hydrogen production and construction thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910204925.0A CN110093362B (en) | 2019-03-18 | 2019-03-18 | Functional gene vector pET32a-fdhD for high-efficiency auxiliary hydrogen production and construction thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110093362A true CN110093362A (en) | 2019-08-06 |
| CN110093362B CN110093362B (en) | 2022-05-24 |
Family
ID=67443304
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910204925.0A Active CN110093362B (en) | 2019-03-18 | 2019-03-18 | Functional gene vector pET32a-fdhD for high-efficiency auxiliary hydrogen production and construction thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110093362B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111996157A (en) * | 2020-09-08 | 2020-11-27 | 齐鲁工业大学 | Gene engineering bacterium for efficiently producing 1, 3-propylene glycol and construction method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160102325A1 (en) * | 2013-06-18 | 2016-04-14 | Johann Wolfgang Goethe-Universität | Method for Storing Gaseous Hydrogen Through Producing Methanoate (Formate) |
| CN106755044A (en) * | 2017-03-19 | 2017-05-31 | 北京工业大学 | Highly effective hydrogen yield functional gene carrier pET32a fdhF and its structure and application |
| CN108220319A (en) * | 2018-01-31 | 2018-06-29 | 北京工业大学 | There is the carrier pET32a-fdhF-1 for producing hydrogen functional gene and its structure and application in Escherichia coli |
-
2019
- 2019-03-18 CN CN201910204925.0A patent/CN110093362B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160102325A1 (en) * | 2013-06-18 | 2016-04-14 | Johann Wolfgang Goethe-Universität | Method for Storing Gaseous Hydrogen Through Producing Methanoate (Formate) |
| CN106755044A (en) * | 2017-03-19 | 2017-05-31 | 北京工业大学 | Highly effective hydrogen yield functional gene carrier pET32a fdhF and its structure and application |
| CN108220319A (en) * | 2018-01-31 | 2018-06-29 | 北京工业大学 | There is the carrier pET32a-fdhF-1 for producing hydrogen functional gene and its structure and application in Escherichia coli |
Non-Patent Citations (1)
| Title |
|---|
| TAKENO,A. 等: "Accession：AP007209.1", 《GENBANK》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111996157A (en) * | 2020-09-08 | 2020-11-27 | 齐鲁工业大学 | Gene engineering bacterium for efficiently producing 1, 3-propylene glycol and construction method and application thereof |
| CN111996157B (en) * | 2020-09-08 | 2022-07-08 | 齐鲁工业大学 | Gene engineering bacterium for efficiently producing 1, 3-propylene glycol and construction method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110093362B (en) | 2022-05-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106191083B (en) | The xylanase mutant and its encoding gene and application that a kind of specific enzyme activity improves | |
| CN108103120B (en) | Method for synthesizing L-aspartic acid by catalyzing maleic acid through double-enzyme coupled whole cells | |
| CN107012130A (en) | A kind of glucose oxidase mutant and its encoding gene and application | |
| EP2840135B1 (en) | Cis-epoxysuccinate hydrolase-encoding gene, polypeptide encoded by the gene, and related application thereof | |
| CN111763676B (en) | Promoter for improving activity of heterologous expression enzyme of keratinase and application thereof | |
| CN111748535A (en) | Alanine dehydrogenase mutant and application thereof in fermentation production of L-alanine | |
| CN106755044A (en) | Highly effective hydrogen yield functional gene carrier pET32a fdhF and its structure and application | |
| CN110964686B (en) | Recombinant pseudomonas proteus and construction method and application thereof | |
| CN107043757B (en) | Recombinant pichia pastoris for heterologous high-efficiency expression of rhizomucor miehei lipase and application thereof | |
| CN110093362A (en) | Efficiently auxiliary produces functional gene carrier pET32a-fdhD and its building of hydrogen | |
| CN111996157B (en) | Gene engineering bacterium for efficiently producing 1, 3-propylene glycol and construction method and application thereof | |
| CN112920984A (en) | Construction is based on formic acid and CO2Method and application of growing recombinant strain | |
| CN111500479A (en) | Construction and application of non-methanol-induced dual-promoter pichia pastoris engineering bacteria | |
| CN111471700B (en) | Recombinant vector and recombinant strain for assisting in hydrogen production, and construction method and application thereof | |
| CN107354167A (en) | Efficient degradation grease functional gene carrier and its structure and application | |
| CN114854612B (en) | Transformation of Saccharomyces cerevisiae for producing L-lactic acid and application thereof | |
| CN115074303B (en) | Genetically engineered bacterium capable of degrading feathers, construction method and application thereof | |
| CN110066821B (en) | Method for constructing random protein expression library based on random expression element multiplication mode | |
| CN113956336B (en) | Application of CitT protein or coding gene thereof in regulating ramie degumming efficiency of microorganism | |
| CN108220317A (en) | A kind of recombinant expression plasmid and preparation method thereof, purposes | |
| CN118652907A (en) | Homologous chaperone element and application thereof in improving soluble expression of PET plastic degrading enzyme | |
| CN115806892A (en) | Genetically engineered bacterium utilizing pectin and construction method and application thereof | |
| CN105112389B (en) | A kind of keratinase and its encoding gene and application | |
| CN104059935A (en) | Amylase recombinant expression engineering bacteria and application thereof | |
| CN117802020A (en) | Engineering bacterium and biological material for improving valine yield and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |