CN110079492B

CN110079492B - Escherichia coli M4 mutant strain, and preparation method and application thereof

Info

Publication number: CN110079492B
Application number: CN201910407496.7A
Authority: CN
Inventors: 彭仁; 童春梅; 林明晴
Original assignee: Jiangxi Normal University
Current assignee: Jiangxi Normal University
Priority date: 2019-05-16
Filing date: 2019-05-16
Publication date: 2022-09-13
Anticipated expiration: 2039-05-16
Also published as: CN110079492A

Abstract

The invention belongs to the field of biological engineering, and provides an Escherichia coli M4 mutant strain, and a preparation method and application thereof. Carrying out error-prone PCR on the pseudomonas aeruginosa foldase gene, cloning the mutated foldase gene and the pseudomonas aeruginosa lipase gene into pACYCDuet-1 recombinant plasmid, transferring the plasmid into E.coli BL21(DE3) for co-expression, and carrying out primary screening and secondary screening to obtain a mutant strain, wherein the specific activity of the intracellular lipase is 2.1 times that of the mutant strain. Compared with the un-mutant strain, one amino acid residue of the recombined foldase in the mutant strain is changed, and glycine is mutated into glutamic acid. The invention provides a new method for improving the lipase activity.

Description

Escherichia coli M4 mutant strain, and preparation method and application thereof

Technical Field

The invention belongs to the field of biological engineering, and particularly relates to an Escherichia coli M4 (E.coli M4) mutant strain, and a preparation method and application thereof.

Background

Lipases are not only widely used in the traditional industries of industry, agriculture and animal husbandry, but also increasingly paid more attention in the fields of biosensors, biodiesel synthesis, diagnostic tool enzymes, etc. The lipase has wide sources, and can be extracted by culturing microorganisms or obtained from animals and plants. The microbial lipase has the characteristics of diverse catalytic activity, high yield, convenience in extraction, short microbial growth cycle, easiness in gene operation and the like, so that the microbial lipase is more widely applied compared with animal and plant derived lipases. Lipases from pseudomonas aeruginosa are the ones with a long history of research. It has high activity, stability and selectivity. However, lipases in P.aeruginosa are dependent on specific folding enzymes and need to be folded correctly into an active conformation with the aid of the folding enzymes.

The lipase and the specific folding enzyme thereof have higher affinity. The studies prove that the three secondary bonds, namely hydrophobic interaction, hydrogen bond and salt bond, are mainly used for interaction to form an intermediate complex. Experiments prove that the lipase subjected to chemical denaturation treatment can realize renaturation with the help of the folding enzyme of the lipase. During the binding process with lipase, the secondary and tertiary structures of the folded enzyme are significantly changed. Some studies have shown that: the foldase assists the corresponding lipase to fold correctly, and cannot further assist the folding of another lipase, so that the foldase is a catalyst for single turnover. However, Northern blot experiments gave different results. This experiment shows that although the transcription of the foldase and lipase genes is synchronous and proportional, after their transcription is complete, a significant portion of the mRNA encoding the foldase protein is degraded, and therefore the number of foldase molecules produced is much smaller than that of lipase. This indicates that the foldase protein assists the corresponding lipase in folding correctly, and is separated from the lipase, and can continue to assist the folding of the next corresponding lipase molecule, and thus is a multi-turn catalyst (Chenkyki, etc., lipase specific foldase, Biotechnology report, 2011,4: 35-39).

Disclosure of Invention

The invention aims to provide an Escherichia coli M4 mutant strain, a preparation method and application thereof, and solves the problems in the prior art at least to a certain extent.

The Escherichia coli M4 mutant strain provided by the invention is preserved in China center for type culture Collection (Wuhan university), the preservation date is 2019, 04 months and 10 days, and the preservation number is CCTCC NO: M2019245.

The preparation method of the Escherichia coli M4 mutant strain comprises the following steps:

(1) carrying out PCR amplification by taking a pet28a-lip plasmid carrying Pseudomonas aeruginosa CS-2 lipase gene as a template, carrying out double enzyme digestion on a PCR amplification product through BamHI and HindIII, and connecting a gene fragment obtained by double enzyme digestion with a plasmid pACYCDuet-1 to obtain a recombinant plasmid pACYCDuet-1-lip;

(2) using pet28a-fold plasmid carrying Pseudomonas aeruginosa CS-2 foldase gene as a template, carrying out error-prone PCR amplification, carrying out double enzyme digestion on an error-prone PCR amplification product by NdeI and XhoI, and connecting a gene fragment obtained by double enzyme digestion with a recombinant plasmid pACYCDuet-1-lip to obtain a recombinant plasmid pACYCDuet-1-lip-fold;

(3) the recombinant plasmid pACYCDuet-1-lip-fold is transformed into a competent cell E.coli BL21(DE3), inoculated into a screening culture medium for culture, and subjected to primary screening and secondary screening to obtain an Escherichia coli M4 mutant strain.

In the step (1), the sequence of the forward primer for PCR amplification is CCTTGGATCCGATGAAGAAGAAGTCTCTGCTCC, the reverse primer sequence is CCTTAAGCTTCTACAGGCTGGCGTTCTTCAGG。

In the step (2), the sequence of the forward primer of error-prone PCR amplification is GGAATTCCATATGATGAAGAAAATCCTCCTGC, the reverse primer sequence is AATTCTCGAGGCGCTGCTCGGCCTG。

One amino acid residue of the recombinant foldase in the above Escherichia coli M4 mutant was changed from glycine (non-mutant) to glutamic acid (mutant) as compared with the non-mutant. Therefore, the specific activity of the lipase in the Escherichia coli M4 mutant strain is improved, and the specific activity of the lipase in the Escherichia coli M4 mutant strain is 2.1 times that of an un-mutant strain as shown by a lipase activity measurement result. Based on the excellent specific activity of lipase in the Escherichia coli M4 mutant strain, the Escherichia coli M4 mutant strain can be applied to the field of biological catalysis.

The invention has the beneficial effects that: provides an Escherichia coli M4 mutant strain, the specific activity of the intracellular lipase is 2.1 times of that of an un-mutant strain, and the Escherichia coli M4 mutant strain can be applied to the field of biocatalysis; provides a preparation method of an Escherichia coli M4 mutant strain, and realizes the improvement of the activity of recombinant lipase through the molecular modification of a folding enzyme.

Drawings

FIG. 1 is a diagram of the specific activities of lipases of mutant and unmutant strains.

FIG. 2 is a molecular docking diagram of lipase and foldase.

FIG. 3 is a molecular docking diagram of lipase and foldase mutants.

Figure 4 is a graph of molecular docking PISA interface parameters for lipases and foldases.

FIG. 5 is a graph of molecular docking PISA interface parameters for lipase and foldase mutants.

Sequence 1 in the sequence table is a folding enzyme mutant sequence.

Detailed Description

The following examples are provided to illustrate the advantageous effects of the present invention in detail, and are intended to help the reader to better understand the essence of the present invention, but should not be construed to limit the scope of the present invention.

The Escherichia coli M4 mutant strain provided by the invention is obtained by the following steps: firstly, constructing a recombinant plasmid pACYCDuet-1-lip; then constructing a pACYCDuet-1-lip-fold mutant library, and obtaining an Escherichia coli M4 mutant strain through primary screening and secondary screening. Specifically, the method comprises the following steps:

(1) the lipase gene was amplified using pet28a-lip plasmid carrying Pseudomonas aeruginosa CS-2 lipase gene as a template. Wherein the forward primer sequence is CCTTGGATCCGATGAAGAAGAAGTCTCTGCTCC, the reverse primer sequence is CCTTAAGCTTCTACAGGCTGGCGTTCTTCAGG are provided. The PCR conditions were: 94 ℃ for 2 min; 20 cycles of 94 ℃ for 20s, 60 ℃ for 20s and 72 ℃ for 50 s; 3min at 72 ℃. The fragment obtained by double enzyme digestion amplification of BamHI and Hind III is connected to pACYCDuet-1 subjected to double enzyme digestion of BamHI and Hind III, and then transformed into competent cells E.coli TOP 10. Selecting clone, extracting recombinant plasmid pACYCDuet-1-lip for enzyme digestion identification.

(2) To be provided withThe pet28a-fold plasmid carrying the Pseudomonas aeruginosa CS-2 foldase gene was used as a template to amplify the foldase mutant gene. Wherein the forward primer sequence is GGAATTCCATATGATGAAGAAAATCCTCCTGC, the reverse primer sequence is AATTCTCGAGGCGCTGCTCGGCCTG are provided. 50 ul error prone PCR system containing 3 ul Mn ²⁺ . Error-prone PCR conditions were: 10min at 95 ℃; 1min at 95 ℃, 50s at 54 ℃ and 1min at 72 ℃ for 30 cycles; 3min at 72 ℃. The amplified fragment is subjected to double digestion by NdeI and XhoI, then the fragment is connected to a recombinant plasmid pACYCDuet-1-lip subjected to double digestion by NdeI and XhoI, and the recombinant plasmid is transformed into a competent cell E.coli BL21(DE3), so that a recombinant bacterium containing the pACYCDuet-1-lip-fold mutant library is obtained.

(3) And (3) inoculating the recombinant bacteria containing the pACYCDuet-1-lip-fold mutant library into a screening culture medium, and selecting the strains with larger transparent circles for secondary screening. The primary screened strain was inoculated into LB medium containing chloramphenicol (34. mu.g/mL) for overnight culture, 2.5mL of the bacterial solution was added to 50mL of LB medium containing chloramphenicol (34. mu.g/mL), cultured at 37 ℃ for 3 hours, added with IPTG (isopropyl thiogalactoside) at a final concentration of 1.5mmol/L, and induced at 37 ℃ for 6 hours. And (3) centrifuging to collect thalli, suspending the thalli by precooled Tris-HCl (pH8.0), placing in an ice bath for ultrasonic crushing, and centrifuging to obtain a supernatant for lipase activity determination. After primary screening and secondary screening, the specific activity of the intracellular lipase of the obtained mutant strain is 2.1 times that of the mutant strain (figure 1). One amino acid residue of the recombinant foldase in the mutant strain was changed from glycine (non-mutant strain) to glutamic acid (mutant strain) compared to the non-mutant strain.

The three-dimensional structures of lipase, foldase and a foldase mutant are constructed by using I-TASSER, then molecular Docking between the lipase, the foldase and the lipase, the foldase mutant is carried out by using Z-Docking (figure 2 and figure 3), and the PDBepisa analysis result shows that the Delta G (Gibbs free energy) of the lipase and the foldase complex is-24.3 kcal/mol (figure 4), and the Delta G of the lipase and the foldase mutant complex is-38.9 kcal/mol (figure 5). This indicates that the affinity of the lipase and foldase mutant complex is greater than the affinity of the lipase and foldase complex.

Mutated foldase sequence:

MMKKILLLIPLAFAASLAWFVWLEPSPAPETAPPASPQAGADRAPPAASAGEAVPAPQVMPAKVAPLPTSFRGTSVDGSFSVDASGNLLITRDIRNLFDYFLSAVGEEPLQQSLDRLRAYIAAELQEPARGQALALMQQYIDYKKELVLLERDLPRLADLDALRQREAAVKALRARIFSNEAHVTFFADEETYNQFTLERLAIRQDGKLSTEEKAAAIDRLRASLPEDQQESVLPQLQSELQQQTAALQAAGAGPEAIRQMRQQLVGAEATTRLEQLDRQRSAWKGRLDDYFAEKSRIEGNTGLSEADRRAAVERLAEERFSEQERLRLGALEQMRQAEQRLELESGKETAAAKFERQHMDSSTSAA

note: amino acid residues translated by the nucleic acid in the expression vector are underlined, and the recombinant foldase in the mutant was mutated from glycine to glutamic acid (black box) compared to the non-mutant.

Sequence listing

<110> university of Jiangxi teacher

<120> Escherichia coli M4 mutant strain, preparation method and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 367

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Met Lys Lys Ile Leu Leu Leu Ile Pro Leu Ala Phe Ala Ala Ser

1 5 10 15

Leu Ala Trp Phe Val Trp Leu Glu Pro Ser Pro Ala Pro Glu Thr Ala

20 25 30

Pro Pro Ala Ser Pro Gln Ala Gly Ala Asp Arg Ala Pro Pro Ala Ala

35 40 45

Ser Ala Gly Glu Ala Val Pro Ala Pro Gln Val Met Pro Ala Lys Val

50 55 60

Ala Pro Leu Pro Thr Ser Phe Arg Gly Thr Ser Val Asp Gly Ser Phe

65 70 75 80

Ser Val Asp Ala Ser Gly Asn Leu Leu Ile Thr Arg Asp Ile Arg Asn

85 90 95

Leu Phe Asp Tyr Phe Leu Ser Ala Val Gly Glu Glu Pro Leu Gln Gln

100 105 110

Ser Leu Asp Arg Leu Arg Ala Tyr Ile Ala Ala Glu Leu Gln Glu Pro

115 120 125

Ala Arg Gly Gln Ala Leu Ala Leu Met Gln Gln Tyr Ile Asp Tyr Lys

130 135 140

Lys Glu Leu Val Leu Leu Glu Arg Asp Leu Pro Arg Leu Ala Asp Leu

145 150 155 160

Asp Ala Leu Arg Gln Arg Glu Ala Ala Val Lys Ala Leu Arg Ala Arg

165 170 175

Ile Phe Ser Asn Glu Ala His Val Thr Phe Phe Ala Asp Glu Glu Thr

180 185 190

Tyr Asn Gln Phe Thr Leu Glu Arg Leu Ala Ile Arg Gln Asp Gly Lys

195 200 205

Leu Ser Thr Glu Glu Lys Ala Ala Ala Ile Asp Arg Leu Arg Ala Ser

210 215 220

Leu Pro Glu Asp Gln Gln Glu Ser Val Leu Pro Gln Leu Gln Ser Glu

225 230 235 240

Leu Gln Gln Gln Thr Ala Ala Leu Gln Ala Ala Gly Ala Gly Pro Glu

245 250 255

Ala Ile Arg Gln Met Arg Gln Gln Leu Val Gly Ala Glu Ala Thr Thr

260 265 270

Arg Leu Glu Gln Leu Asp Arg Gln Arg Ser Ala Trp Lys Gly Arg Leu

275 280 285

Asp Asp Tyr Phe Ala Glu Lys Ser Arg Ile Glu Gly Asn Thr Gly Leu

290 295 300

Ser Glu Ala Asp Arg Arg Ala Ala Val Glu Arg Leu Ala Glu Glu Arg

305 310 315 320

Phe Ser Glu Gln Glu Arg Leu Arg Leu Gly Ala Leu Glu Gln Met Arg

325 330 335

Gln Ala Glu Gln Arg Leu Glu Leu Glu Ser Gly Lys Glu Thr Ala Ala

340 345 350

Ala Lys Phe Glu Arg Gln His Met Asp Ser Ser Thr Ser Ala Ala

355 360 365

Claims

1.Escherichia coli Use of a mutant strain M4 for the production of lipase, characterized in that: the above-mentionedEscherichia coli The M4 mutant is preserved in China center for type culture Collection with the preservation date of 2019, 4 months and 10 days and the preservation number of CCTCC NO: M2019245.