CN110066823A

CN110066823A - MIM396 is increasing Rice Panicle shape and is improving the application in Plant Height of Rice

Info

Publication number: CN110066823A
Application number: CN201810059688.9A
Authority: CN
Inventors: 时振英; 苗雪霞; 戴争妍; 杨晓芳
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Center for Excellence in Molecular Plant Sciences of CAS
Priority date: 2018-01-22
Filing date: 2018-01-22
Publication date: 2019-07-30

Abstract

The present invention relates to MIM396 to increase Rice Panicle shape and improve the application in Plant Height of Rice.Present invention discloses the fringe shape of miR396 and rice, plant height character are closely related, Rice Panicle shape can be increased or improve Plant Height of Rice by lowering miR396.Therefore, the substance and method of miR396 or adjusting miR396 can be applied to realize the improvement of plant variety.

Description

MIM396 is increasing Rice Panicle shape and is improving the application in Plant Height of Rice

Technical field

The invention belongs to botany and gene technology fields, more particularly it relates to which MIM396 is increasing Rice Panicle Application in shape and raising Plant Height of Rice.

Background technique

With the reduction year by year of cultivated area on the earth, the yield of crops is difficult to maintain the development of the mankind.Although grain The per mu yield of crop is increasing, but total output is difficult to maintain growth trend.According to FAO (Food and Agriculture Organization of the United Nation) issue report, the whole world face compared with Big crisis in food.The breed improvement of some staple food crops, oil crops seems extremely urgent.

Rice to be in the world more than that the population of half provides grain, be provided for the world more than half food it is three big One of crop (corn, wheat and rice), is very important cereal crops.Raising and rice city with living standards of the people The opening of field, the quality problem of Chinese rice, which seems, to become increasingly conspicuous.Rice quality is related to food safety, grain-export amount and people People's improvement of living standard, improvement China's rice quality have become a significant and very urgent task.Therefore, from The mechanism and hereditary capacity that molecule angle research rice quality is formed are conducive to provide for rice fine quality breeding theoretical and real Trample guidance.The quality and particle shape tight association of rice, the change of quality influence whether particle shape, and vice versa.Therefore, to rice grain The research and quality research of shape are often inseparable.

With the expansion of population and the reduction increasingly of arable area, how in limited arable land on kind to go out more grains Food, is always the research center of gravity of agriculturist.Therefore the means that research adjusts plant type of rice, optimizes Rice Cropping, are very Important work.

Summary of the invention

The purpose of the present invention is to provide MIM396 to increase Rice Panicle shape and improve the application in Plant Height of Rice.

In the first aspect of the present invention, the purposes of a kind of miR396 or the lower adjustment of its precursor are provided, for improveing rice Character, comprising: increase Rice Panicle shape or improve Plant Height of Rice.

In a preferred embodiment, the lower adjustment is specific downregulation miR396 or the disturbing molecule of its precursor expression, Or the miR396 silencing body based on target mimicry technology.

In another preferred example, the rice is long-grained nonglutinous rice or japonica rice.

In another preferred example, the long-grained nonglutinous rice is elegant water 134；Or the japonica rice is R8015.

In another preferred example, the increase Rice Panicle shape includes: raising spike length, and it is wide to increase fringe.

In another aspect of this invention, a kind of method for increasing Rice Panicle shape or improving Plant Height of Rice, the method are provided It include: the expression for lowering miR396 or its precursor in rice.

In a preferred embodiment, the rice is long-grained nonglutinous rice or japonica rice；Preferably, the long-grained nonglutinous rice is elegant water 134；Or institute The japonica rice stated is R8015.

In another preferred example, the expression for lowering miR396 or its precursor in rice also increases the grain of rice paddy seed Long or particle shape, increases the mass of 1000 kernel of rice paddy seed.

In another preferred example, the expression of miR396 or its precursor includes: to utilize disturbing molecule in the downward rice The expression of specific downregulation miR396 or its precursor, or lowered using the miR396 silencing body based on target mimicry technology The expression of miR396 or its precursor.

In another preferred example, described to lower miR396 using the miR396 silencing body based on target mimicry technology The method of expression includes:

(1) mimicry miR396 sequence is placed in ips gene order, obtains ips-MIM396b sequence fragment；

(2) ips-MIM396b sequence fragment is transferred in rice, obtains genetically modified plants, for the rice of improvement.

In another preferred example, in step (1), mimicry miR396 sequence is placed in ips gene order In site between CCTCTAGAAA and AGCTTCGGTT；Or

The mimicry miR396 sequence is as shown in SEQ ID NO:14.

In another aspect of this invention, a kind of miR396 or the purposes of its precursor are provided, for as identification Rice Characters Molecular labeling；The character includes: Rice Panicle shape or Plant Height of Rice.

In a preferred embodiment, the rice is long-grained nonglutinous rice or japonica rice；Preferably, the long-grained nonglutinous rice is elegant water 134 or institute The japonica rice stated is R8015.

Other aspects of the invention are apparent to those skilled in the art due to this disclosure 's.

Detailed description of the invention

Fig. 1, MIM396 convert influence of the transgenic plant of elegant water 134 to plant type and fringe shape.

A: the plant type of transgenic plant；

B: significant difference and pole is presented in plant height and the tiller number statistical analysis of transgenic plant, statistical data after t- is examined Significant difference uses * (P < 0.05) and * * (P < 0.01) to indicate respectively；

C: the fringe shape of transgenic plant.

Fig. 2, MIM396 convert elegant water 134 to be influenced caused by particle shape.

A: the particle shape of transgenic plant；

B: significant difference and extremely significant difference point is presented in the mass of 1000 kernel statistics of transgenic plant, statistical data after t- is examined It Yong not * (P < 0.05) and * * (P < 0.01) expression；

C: grain length, the grain of transgenic plant be wide and length-width ratio statistics, statistical data is presented after t- is examined significant difference with Extremely significant difference is used respectively, * (P < 0.05), and * * (P < 0.01) is indicated.

The variation of particle shape caused by Fig. 3, MIM396 Transformation of Indica Rice kind R8015.

A:MIM396 converts the particle shape of the transgenic plant of R8015；

B:MIM396 converts the mass of 1000 kernel statistics of the transgenic plant of R8015, and statistical data is presented significantly after t- is examined Difference and extremely significant difference use * (P < 0.05) and * * (P < 0.01) to indicate respectively；

Grain length, the grain of the transgenic plant of C:MIM396 conversion R8015 are wide and length-width ratio statistics, statistical data are examined through t- Significant difference is presented afterwards and extremely significant difference is used respectively, * (P < 0.05), * * (P < 0.01) are indicated.

The schematic diagram of Fig. 4, MIM396b plasmid construction.

Specific embodiment

The present inventor passes through in-depth study, it is found that fringe shape, the plant height character of miR396 and rice are closely related, lower MiR396 can increase Rice Panicle shape or improve Plant Height of Rice.Therefore, the substance and method of miR396 or adjusting miR396 can be applied In the improvement for realizing plant variety.

As used herein, Rice Panicle shape is a kind of breeding character, and the size of fringe shape and end tiller length, density etc. have It closes, is independently of that rice paddy seed grain length, grain be wide, a kind of character of yield.

As used herein, " plant " is the plant for expressing miR396 or its precursor, including gramineae plant.It is described Gramineae plant include: grass family oryza plant such as rice, grass family wheat platymiscium such as wheat, grass family corn platymiscium Such as corn.As preferred embodiment of the invention, the gramineae plant is rice.

As used herein, " miR396 " refers to the miR396 of oryza plant.It is a variety of from oryza plant The sequence of the gene of miR396 and corresponding maturation miR396 are tabulated in 1.It will be understood by those skilled in the art that in view of There is very high sequence identity between these miRNA (or their precursor), lower these miRNA and be able to achieve to rice Technical effect identical with downward miR396b verified in the embodiment of the present invention is realized in the adjusting of shape.

The sequence of table 1, the gene for encoding miR396 for being derived from rice (osa) and corresponding maturation miR396

The present invention provides a kind of increase Rice Panicle shape or the methods for improving Plant Height of Rice, which comprises lower water transfer The expression of miR396 or its precursor in rice.

It, can be using a variety of methods well known in the art to lower after the function of knowing the miR396 The expression of the miR396 stated, these methods can be included in the present invention.For example, can use well known in the art more Kind of method interferes the expression of miR396 or is allowed to loss of expression.

As one embodiment of the present invention, a kind of method for reducing the expression of miR396 in plant is provided, it is described Method include:

(1) the miR396 silencing body based on target mimicry technology is constructed comprising in ips gene order and position In site between the CCTCTAGAAA (SEQ ID NO:10) and AGCTTCGGTT (SEQ ID NO:11) of the sequence Mimicry miR396 sequence；

(2) the miR396 silencing body that (1) obtains is transferred to plant cell, tissue, organ or seed, acquisition is transformed into described Plant cell, tissue, organ or the seed of disturbing molecule；

(3) again by plant cell, tissue, organ or the seed for being transferred to the miR396 silencing body of step (2) acquisition Generate plant.

Preferably, the method also includes:

(iii) plant cell, tissue or organ for being transferred to the carrier are selected；With

(iv) by plant cell, tissue or the neomorph in step (iii) at plant.

Other methods for inhibiting miR396 or its precursor are well known in the art.

Invention additionally provides the substance for lowering the miR396 or its precursor, by lower miR396 or its Precursor is to play the function of the character of improvement plant.The substance may is that nucleic acid inhibitor, antagonist, lower adjustment, retardance Agent, blocking agent etc., as long as they can lower miR396 or the expression of its precursor.The biomolecule can be nucleic acid Horizontal (including DNA, RNA's), it is also possible to protein level.

Substance for lowering the miR396 or its precursor, which can be, any prevents miR396 (especially therein In conjunction with critical sites) or its precursor with its target sequence in conjunction with, the activity that reduces miR396 or its precursor, reduce miR396 or its The stability of precursor, reduces miR396 or the substance of its precursor effective acting time at the expression for lowering miR396 or its precursor, this A little substances are used equally for the present invention, as lowering the useful substance of miR396.For example, the inhibitor is: nucleic acid suppression Object processed, protein inhibitor, antibody, ligand, nuclease, nucleic acid binding molecule, as long as its expression that can lower miR396.

As preferred embodiment of the invention, the substance include specific downregulation miR396 or its precursor disturbing molecule or MiR396 silencing body based on target mimicry technology.More preferably, mimicry miR396 sequence is placed in ips gene sequence In site between CCTCTAGAAA (SEQ ID NO:10) in column and AGCTTCGGTT (SEQ ID NO:11), obtain The segment is placed in suitable carrier by ips-MIM396b sequence fragment, converts plant, so that acquired character improvement turns base Because of plant.

The present invention also provides the expression vector comprising the ips-MIM396b sequence, preferred plant expression vectors；More preferably It is suitable for carrying out the expression vector of subsequent transgeneic procedure (transgeneic procedure as applied Agrobacterium).Those skilled in the art Well known method can be used to construct the expression vector containing promoter of the present invention and/or objective gene sequence.These sides Method includes recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc..Expression vector further includes the core of translation initiation Sugared body binding site and transcription terminator.

The present invention also provides genetically engineered host cell, containing ips-MIM396b sequence or containing including ips- The carrier of MIM396b sequence.Host cell is usually plant cell.Converting plant generally can be used Agrobacterium-mediated Transformation or particle gun The methods of conversion, such as leaf disk method, Rice Young Embryo conversion method etc.；Preferably agrobacterium co-cultivation.Plant cell, group for conversion It knits or organ can regenerate plant with conventional method, to obtain the plant that character changes for wild type.

In a preferred embodiment of the invention, " miR396 " is miR396b ", it is with SEQ ID NO:2 The RNA of sequence.

In a specific embodiment of the present invention, MIM396 plasmid has been converted two kinds of main cultivated rice product by the present inventor Kind, japonica rice show water 134 and long-grained nonglutinous rice R8015.Transgenic plant shows apparent big fringe phenotype, long grain phenotype respectively, it was demonstrated that MIM396 increases particle shape with generality in rice.

Moreover, it relates to be marked using strong MIM396 as a kind of tracking of genetic transformation progeny of plants.This hair Bright to further relate to using MIM396 as a kind of molecular labeling, by the expression of MIM396 in detection plant, early stage, which determines, plants The feature of the fringe shape of object, plant height etc..

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip Part such as J. Pehanorm Brooker etc. is write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, condition described in 2002, or According to the normal condition proposed by manufacturer.

The building of embodiment 1, MIM396b transgenic plant

With the ips gene (its nucleotide sequence such as SEQ ID NO:18) of IPSF and IPSR amplification arabidopsis, pass through BamHI and SacI digestion is building up in the site BamHI and SacI of cloning vector pBSK.

IPSF (BamHI) sequence: 5 '-GTGGATCCaagaaaaatggccatcccctagc-3 ' (SEQ ID NO:12).

IPSR (SacI) sequence: 5 '-CTGGAGCTCgaggaattcactataaagagaatcg-3 ' (SEQ ID NO: 13)。

It is as follows to design mimicry miR396b sequence:

5’-TTCCACAGCTTtagaTCTTGAACTG-3’(SEQ ID NO:14)。

In sequence, the addition of " taga " is so that the ability of MIM396 combination target gene greatly reinforces, so that normally MiR396 does not have competitiveness when combining target gene, achievees the purpose that lower normal miR396.

According to correlated series in mimicry miR396b and the ips gene, design following MIM396-I and MIM396-II sequence:

MIM396-I sequence:

5’-cgaagctTTCCACAGCTTtagaTCTTGAACTGtttctagagggagataa-3’(SEQ ID NO: 15)；

MIM396-II sequence:

5’-cctctagaaaCAGTTCAAGATCTAAAGCTGTGGAAagcttcggttcccctcg-3’ (SEQ ID NO:16)。

Then, it using obtained plasmid as template, is matched with IPSF and MIM396-I matching, IPSR and MIM396-II, into Mimicry miR396b is substituted into the position of the incomplete target site of miR399 in ips gene by row overlapping PCR (base in Fig. 4 in dotted line frame).

Later, the segment of the ips-MIM396 is cloned on the 35Snos of overexpression vector p1301-35sNOS and (is located at Between the BamHI and SacI of p1301-35sNOS), and use agrobacterium co-cultivation rice transformation kind show water 134 and rice variety R8015 overexpresses the ips-MIM396 segment, to be built into the target mimcry transgenic plant of miR396. Wherein, the target mimcry is abbreviated as MIM396.

The complete sequence of the segment of ips-MIM396 is (SEQ ID NO:17):

aaaacaccacaaaaacaaaagaaaaatggccatcccctagctaggtgaagaagaatgaaaacctctaa tttatctagaggttattcatcttttaggggatggcctaaatacaaaatgaaaactctctaattaagtggttttgt gttcatgtaaggaaagcgttttaagatatggagcaatgaagactgcagaaggctgattcagactgcgagt tttgtttatctccctctagaaaTTCCACAGCTTtagaTCTTGAACTGagcttcggttc ccctcggaatcagcagattatgtatctttaattttgtaatactctctctcttctctatgctttgtttttcttcatta t gtttgggttgtacccactcccgcgcgttgtgtgttctttgtgtgaggaataaaaaaatattcggatttgagaa ctaaaactagagtagttttattgatattcttgtttttcatttagtatctaataagtttggagaatagtcagaccag tgcatgtaaatttgcttccgattctctttatagtgaattcctctt

Embodiment 2, MIM396 are overexpressed the character variation of plant

Rice varieties show water 134 is the late round-grained rice kind of Shanghai surrounding area plantation.Kind growth is neat, proper height, Plant type is compacter, green in leaf color, and stalk is sturdy, and fringe is upright, grain ellipse.

As described in Example 1, the present inventor obtains the transgenic plant of rice varieties show water 134, cultivates the transgenosis Plant.

As a result such as Fig. 1, transgenic plant show the phenotype that plant height slightly increases, and tiller number changes less (Figure 1A, B), together When fringe shape significantly increase (Fig. 1 C).

In addition to above-mentioned character changes, present inventors have further discovered that, the particle shape of transgenic plant becomes larger (Fig. 2A).To kind The mass of 1000 kernel of son is counted, it is found that the grain of transgenic plant increases again 18% or more, wherein the apparent MIM396- of phenotype 1,34%, MIM-2 can be increased to and increase by 19%, MIM-4 increase, 18.4% (Fig. 2 B).

The present inventor further analyzes the constituent element of particle shape, and discovery is wherein more obvious to the influence of grain length, and right Grain is wide to be had little effect, so that length-width ratio be caused obviously to increase (Fig. 2 C).

Therefore, 134 genetically modified plants of japonica rice variety show water prepared by the present invention, compared with wild type, plant type increases, fringe shape Increase, grain length increases, and particle shape increases.It can be seen that the increase of the fringe shape embodies are as follows: spike length dramatically increase and fringe is wide Degree increases.

Embodiment 3, MIM396 plasmid Transformation of Indica Rice kind R8015, increase particle shape

The characteristics of japonica rice particle shape, is round shaped grain shape, and in contrast, the particle shape of long-grained nonglutinous rice is partial to long particle shape.MIM396 plasmid Conversion japonica rice variety show water 134 significantly increases particle shape, and more obvious to the growth of grain length.Further to prove MIM396 Whether plasmid, which can increase itself, has the characteristics that the particle shape of the long-grained nonglutinous rice of long grain, and the present inventor obtains rice rice variety R8015 Transgenic plant cultivate the transgenic plant as described in Example 1.

As a result the increased phenotype of apparent grain length (figure is also presented in such as Fig. 1, the transgenic plant of rice rice variety R8015 3A), mass of 1000 kernel is counted, also presents and obviously increases, MIM396-1 mass of 1000 kernel increasing degree is 5.8%, and the increase of MIM396-2 Amplitude is in 8.4% (Fig. 3 B).

The present inventor further analyzes the constituent element of particle shape, and discovery is wherein more obvious to the influence of grain length, and right Grain is wide to be had little effect, so that length-width ratio be caused obviously to increase (Fig. 3 C).

Accordingly, inventors believe that, no matter in long-grained nonglutinous rice or japonica rice, MIM396 has the apparent particle shape that increases to mention The function of high mass of 1000 kernel；In the constituent element of particle shape, MIM396 is partial to increase grain length again, and unknown to the wide influence of grain It is aobvious.

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Sequence table

<110>Shanghai Inst. of Life Science, CAS

<120>MIM396 is increasing Rice Panicle shape and is improving the application in Plant Height of Rice

<130> 17A224

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA/RNA

<213>rice (Oryza sativa)

<400> 1

uuccacagcu uucuugaacu g 21

<210> 2

<211> 21

<212> DNA/RNA

<213>rice (Oryza sativa)

<400> 2

uuccacagcu uucuugaacu u 21

<210> 3

<211> 21

<212> DNA/RNA

<213>rice (Oryza sativa)

<400> 3

uccacaggcu uucuugaacu g 21

<210> 4

<211> 24

<212> DNA/RNA

<213>rice (Oryza sativa)

<400> 4

augguucaag aaagcccaug gaaa 24

<210> 5

<211> 21

<212> DNA/RNA

<213>rice (Oryza sativa)

<400> 5

guucaagaaa gcccauggaa a 21

<210> 6

<211> 22

<212> DNA/RNA

<213>rice (Oryza sativa)

<400> 6

ucuccacagg cuuucuugaa cu 22

<210> 7

<211> 24

<212> DNA/RNA

<213>rice (Oryza sativa)

<400> 7

auaguucaag aaaguccuug gaaa 24

<210> 8

<211> 21

<212> DNA/RNA

<213>rice (Oryza sativa)

<400> 8

guucaagaaa guccuuggaa a 21

<210> 9

<211> 21

<212> DNA/RNA

<213>rice (Oryza sativa)

<400> 9

uccacaggcu uucuugaacg g 21

<210> 10

<211> 10

<212> DNA/RNA

<213>rice (Oryza sativa)

<400> 10

cctctagaaa 10

<210> 11

<211> 10

<212> DNA/RNA

<213>rice (Oryza sativa)

<400> 11

agcttcggtt 10

<210> 12

<211> 31

<212> DNA/RNA

<213>artificial sequence (Artificial Sequence)

<400> 12

gtggatccaa gaaaaatggc catcccctag c 31

<210> 13

<211> 34

<212> DNA/RNA

<213>artificial sequence (Artificial Sequence)

<400> 13

ctggagctcg aggaattcac tataaagaga atcg 34

<210> 14

<211> 25

<212> DNA/RNA

<213>artificial sequence (Artificial Sequence)

<400> 14

ttccacagct ttagatcttg aactg 25

<210> 15

<211> 49

<212> DNA/RNA

<213>artificial sequence (Artificial Sequence)

<400> 15

cgaagctttc cacagcttta gatcttgaac tgtttctaga gggagataa 49

<210> 16

<211> 52

<212> DNA/RNA

<213>artificial sequence (Artificial Sequence)

<400> 16

cctctagaaa cagttcaaga tctaaagctg tggaaagctt cggttcccct cg 52

<210> 17

<211> 543

<212> DNA/RNA

<213>artificial sequence (Artificial Sequence)

<400> 17

aaaacaccac aaaaacaaaa gaaaaatggc catcccctag ctaggtgaag aagaatgaaa 60

acctctaatt tatctagagg ttattcatct tttaggggat ggcctaaata caaaatgaaa 120

actctctaat taagtggttt tgtgttcatg taaggaaagc gttttaagat atggagcaat 180

gaagactgca gaaggctgat tcagactgcg agttttgttt atctccctct agaaattcca 240

cagctttaga tcttgaactg agcttcggtt cccctcggaa tcagcagatt atgtatcttt 300

aattttgtaa tactctctct cttctctatg ctttgttttt cttcattatg tttgggttgt 360

acccactccc gcgcgttgtg tgttctttgt gtgaggaata aaaaaatatt cggatttgag 420

aactaaaact agagtagttt tattgatatt cttgtttttc atttagtatc taataagttt 480

ggagaatagt cagaccagtg catgtaaatt tgcttccgat tctctttata gtgaattcct 540

ctt 543

<210> 18

<211> 542

<212> DNA/RNA

<213>arabidopsis (Arabidopsis thaliana)

<400> 18

aaaacaccac aaaaacaaaa gaaaaatggc catcccctag ctaggtgaag aagaatgaaa 60

acctctaatt tatctagagg ttattcatct tttaggggat ggcctaaata caaaatgaaa 120

actctctaat taagtggttt tgtgttcatg taaggaaagc gttttaagat atggagcaat 180

gaagactgca gaaggctgat tcagactgcg agttttgttt atctccctct agaaattggg 240

caacttctat cctttggcaa gcttcggttc ccctcggaat cagcagatta tgtatcttta 300

attttgtaat actctctctc ttctctatgc tttgtttttc ttcattatgt ttgggttgta 360

cccactcccg cgcgttgtgt gttctttgtg tgaggaataa aaaaatattc ggatttgaga 420

actaaaacta gagtagtttt attgatattc ttgtttttca tttagtatct aataagtttg 480

gagaatagtc agaccagtgc atgtaaattt gcttccgatt ctctttatag tgaattcctc 540

tt 542

Claims

1. the purposes of the lower adjustment of a kind of miR396 or its precursor, for improveing the character of rice, comprising: increase Rice Panicle shape or Improve Plant Height of Rice.

2. purposes as described in claim 1, which is characterized in that the lower adjustment is specific downregulation miR396 or its precursor The disturbing molecule of expression, or the miR396 silencing body based on target mimicry technology.

3. purposes as described in claim 1, which is characterized in that the rice is long-grained nonglutinous rice or japonica rice.

4. purposes as claimed in claim 3, which is characterized in that the long-grained nonglutinous rice is elegant water 134；Or the japonica rice is R8015。

5. purposes as described in claim 1, which is characterized in that the increase Rice Panicle shape includes: raising spike length, increases fringe It is wide.

6. a kind of method for increasing Rice Panicle shape or improving Plant Height of Rice, which is characterized in that the described method includes: lowering in rice The expression of miR396 or its precursor.

7. method as claimed in claim 6, which is characterized in that the rice is long-grained nonglutinous rice or japonica rice；Preferably, the Xian Rice is elegant water 134；Or the japonica rice is R8015.

8. the method for claim 7, which is characterized in that the expression for lowering miR396 or its precursor in rice is also The grain length or particle shape for increasing rice paddy seed, increase the mass of 1000 kernel of rice paddy seed.

9. method as claimed in claim 6, which is characterized in that the expression packet of miR396 or its precursor in the downward rice It includes: using the expression of disturbing molecule specific downregulation miR396 or its precursor, or using based on target mimicry technology MiR396 silencing body lowers miR396 or the expression of its precursor.

10. method as claimed in claim 9, which is characterized in that described using based on target mimicry technology MiR396 silencing body lowers the method that miR396 is expressed

11. method as claimed in claim 10, which is characterized in that in step (1), mimicry miR396 sequence is placed in In the site between CCTCTAGAAA and AGCTTCGGTT in ips gene order；Or

The mimicry miR396 sequence is as shown in SEQ ID NO:14.

12. the purposes of a kind of miR396 or its precursor, for the molecular labeling as identification Rice Characters；The character packet It includes: Rice Panicle shape or Plant Height of Rice.

13. purposes as claimed in claim 12, which is characterized in that the rice is long-grained nonglutinous rice or japonica rice；Preferably, described Long-grained nonglutinous rice is elegant water 134 or the japonica rice is R8015.