CN110029189A - The molecular labeling and application that a kind of and celery cell matter male sterility gene isolates - Google Patents
The molecular labeling and application that a kind of and celery cell matter male sterility gene isolates Download PDFInfo
- Publication number
- CN110029189A CN110029189A CN201910393232.0A CN201910393232A CN110029189A CN 110029189 A CN110029189 A CN 110029189A CN 201910393232 A CN201910393232 A CN 201910393232A CN 110029189 A CN110029189 A CN 110029189A
- Authority
- CN
- China
- Prior art keywords
- celery
- sequence
- measured
- derivatives
- breeding
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of molecular labeling isolated with celery cell matter male sterility gene and applications.The present invention provides detect in celery genome to be measured whether the substance containing nucleotide shown in sequence 3 or derivatives thereof following 1) -6) at least one of in application: 1) identify or assist to identify celery fertility to be measured；2) preparation identification or auxiliary identify the product of celery fertility to be measured；3) breeding infertility celery；4) product of breeding infertility celery is prepared；5) the fertile celery of breeding；6) product of the fertile celery of breeding is prepared.The label about celery cell matter male sterile line related gene that the present invention has found at first, and the identification of material fertility can be carried out by extracting celery genomic DNA, simple and easy to do, appraisal cost is low, can be used in production in high volume identifying.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to a kind of point isolated with celery cell matter male sterility gene
Son label and application.
Background technique
Celery (Apiumgraveolens L.) is one, biennial herb plant in Umbelliferae apium, spends a small amount of big, people
Work emasculation is extremely difficult, serious to restrict the utilization of celery hybrid vigour in production, and limitation celery hybrid is commercially produced
Development cultivates half-blood using celery male sterility, can reduce production cost, it is pure to significantly improve half-blooded seed
Degree is therefore the effective way of preparation celery hybrid selects male sterile line and has very important significance.
In plant heritable male sterility type be divided into nuclear male sterility (Genic Male Sterility,
) and cytoplasmic male sterility type (Cytoplasmic Male Sterility, CMS) GMS.Nuclear male sterility is by cell
What karyogene individually controlled, and cytoplasmic male sterility is to lead to male sterility by karyogene and cytogene co- controlling,
Most cells kernel male sterile is due to that cannot effectively keep sterility so being unsuitable for crossbreeding, and compared to nucleus
Male sterility, cytoplasmic male sterility can get 100% sterile plant, is therefore widely used in all kinds of crop heterosis
It utilizes.
Celery CMS is the phenomenon that cannot generating normal function pollen as caused by the sterile gene in mitochondria.It is so far
Only, domestic and foreign scholars in many garden crops although have discovered that the lots of genes of cytoplasmic male sterility, in celery
In dish, relevant report is never received, is more applied in production without the relevant molecular labeling of cytoplasmic male sterility, efficiently
Key of the molecular labeling as current molecular marker-assisted breeding, directly selects genotype, greatly improves in breeding
Therefore the accuracy and efficiency of selection, significantly shortening breeding cycle develop relevant point of efficient celery cell matter male sterility
Son label has very important significance for celery breed improvement and breeding of new variety.
Summary of the invention
In order to identify the fertility of celery pollen, the present invention provides the following technical scheme that
A purpose of the invention be to provide in detection celery genome to be measured whether containing nucleotide shown in sequence 3 or its
The purposes of the substance of derivative.
The present invention provides detect in celery genome to be measured whether contain nucleotide shown in sequence 3 or derivatives thereof
Substance is following 1) -6) at least one of in application:
1) it identifies or assists to identify celery fertility to be measured；
2) preparation identification or auxiliary identify the product of celery fertility to be measured；
3) breeding infertility celery；
4) product of breeding infertility celery is prepared；
5) the fertile celery of breeding；
6) product of the fertile celery of breeding is prepared.
In above-mentioned application, the derivative of nucleotide shown in the sequence 3 is that sequence 3 is passed through one or several nucleotide
Substitution and/or deletion and/or addition and with the DNA molecular with the same function of sequence 3.
In above-mentioned application, whether contain nucleotide shown in sequence 3 or its derivative in the detection celery genome to be measured
The substance of object be it is following 1) or 2):
1) primer set, primer set single strand dna as shown in sequence 1 in sequence table or derivatives thereof and sequence
Single strand dna shown in sequence 2 or derivatives thereof in list；
2) contain the PCR reagent or kit of the primer set.
In above-mentioned application, the derivative of single strand dna shown in sequence 1 is that sequence 1 is passed through one in the sequence table
The substitution and/or deletion and/or addition of a or several nucleotide and with the DNA molecular with the same function of sequence 1；
The derivative of single strand dna shown in sequence 2 is that sequence 2 is passed through one or several nucleosides in the sequence table
Acid substitution and/or deletion and/or addition and with the DNA molecular with the same function of sequence 2.
Another object of the present invention is to provide a kind of product.
Whether contain nucleosides shown in sequence 3 in product provided by the invention, including above-mentioned detection celery genome to be measured
The substance of acid or derivatives thereof；
At least one of the product has the function of following 1) -3):
1) it identifies or assists to identify celery fertility to be measured；
2) breeding infertility celery；
3) the fertile celery of breeding.
The present invention also provides a kind of DNA moleculars.
DNA molecular provided by the invention, nucleotides sequence are classified as follows
1) nucleotide shown in sequence 3 in sequence table；
2) there is phase by sequence 3 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 3
The DNA molecular of congenerous.
Above-mentioned DNA molecular is following 1) -3) at least one of in application be also the scope of protection of the invention:
1) it identifies or assists to identify celery fertility to be measured；
2) breeding infertility celery；
3) the fertile celery of breeding.
The present invention also provides a kind of methods that celery fertility to be measured is identified in identification or auxiliary.
Whether method provided by the invention includes the following steps: to detect in celery genome to be measured containing shown in sequence 3
Nucleotide or derivatives thereof, if containing nucleotide shown in sequence 3 or derivatives thereof, celery to be measured in the genome of celery to be measured
Dish infertility or candidate infertility, if without containing nucleotide shown in sequence 3 or derivatives thereof in the genome of celery to be measured, it is to be measured
Celery is fertile or candidate fertile；
The derivative of nucleotide shown in the sequence 3 be by sequence 3 by one or several nucleotide substitution and/or
Deletion and/or addition and with the DNA molecular with the same function of sequence 3.
The present invention also provides a kind of methods of breeding infertility celery.
Whether method provided by the invention includes the following steps: to detect in celery genome to be measured containing shown in sequence 3
Nucleotide or derivatives thereof, the celery to be measured containing nucleotide shown in sequence 3 or derivatives thereof in breeding genome, for infertility
Celery.
Or, the present invention also provides a kind of methods of the fertile celery of breeding.
Whether method provided by the invention includes the following steps: to detect in celery genome to be measured containing shown in sequence 3
Nucleotide or derivatives thereof, the celery to be measured without containing nucleotide shown in sequence 3 or derivatives thereof in breeding genome, for not
Educate celery；
The derivative of nucleotide shown in the sequence 3 be by sequence 3 by one or several nucleotide substitution and/or
Deletion and/or addition and with the DNA molecular with the same function of sequence 3.
Among the above, whether contain nucleotide shown in sequence 3 or derivatives thereof in the detection celery genome to be measured
Method is as follows:
1) direct Sequencing；
2) celery to be measured is expanded with above-mentioned primer set, detects amplified production；
If the amplified production size is 2307bp, contain core shown in sequence 3 in the genome of the celery to be measured
Thuja acid or derivatives thereof；
If the amplified production size is not 2307bp, without containing shown in sequence 3 in the genome of the celery to be measured
Nucleotide or derivatives thereof.
The experiment proves that the present invention find at first about celery cell matter male sterile line related gene
Label, and the identification of material fertility can be carried out by extracting celery genomic DNA, simple and easy to do, appraisal cost is low, can use
It is in high volume identified in production.
Detailed description of the invention
Fig. 1 is the electrophoresis result of the PCR product of 99A, 99B；Wherein, A 99A, B 99B.
Fig. 2 is the electrophoresis result of the PCR product of 41 portions of celeries.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.
Quantitative test in following embodiment, is respectively provided with three repeated experiments, and results are averaged.
In following embodiments celery cell matter male sterile line 99A (texts and pictures drawing in breeding, and be returned 7 generations with
On, and identify infertility), the public can obtain the biomaterial from applicant, which only attaches most importance to the correlation of duplicate invention
Used in experiment, it not can be used as other purposes and use.
Celery holding in following embodiments is that (breeding in texts and pictures drawing, and it is more than generation to be returned 7 to 99B, and identifying can
Educate), the public can obtain the biomaterial from applicant, which only attaches most importance to used in the related experiment of duplicate invention, no
It can be used as other purposes to use.
Embodiment 1 utilizes celery molecular markers for identification celery pollen fertility
1, the acquisition of molecular labeling
It using celery cell matter male sterile line 99A and its keeps being 99B being test material, measures the line grain of two systems respectively
Body genome sequence, by comparing two be mitochondrial genomes sequence difference, exploitation with celery cell matter male sterility gene
The molecular labeling primer isolated identifies the fertility of 99A, 99B to orf768a.
Primer pair orf768a is made of orf768aF and orf768aR；Orf768aF is single shown in sequence 1 in sequence table
Chain DNA, orf768aR are single stranded DNA shown in sequence 2 in sequence table.
Sequence 1:ATGGGCACATGCTTCTCAGTACT
Sequence 2:AGTAGATCATAGCCTTGGATTGCTC
2, celery molecular markers for identification celery pollen fertility is utilized
The leaves genomic DNA for extracting 20 plants of 99A and 20 plant of 99B carries out PCR amplification using primer pair orf768a.
Pcr amplification reaction system (20 μ l) are as follows: 3 μ l of genomic DNA, PrimerSTAR Max DNA Polymerase
10 μ l, orf768aF and each 1 μ l of orf768aR, with 5ul ddH2O is by total volume polishing to 20 μ l.Wherein, PrimerSTAR
Max DNA Polymerase is taraka treasured bioengineering Co., Ltd product.
Pcr amplification reaction program: 94 DEG C of initial denaturation 5min；98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 40s, 28
A circulation；72 DEG C of extension 5min.
1.5% agarose gel electrophoresis of pcr amplification product, Labworks image acquisition and analysis software observation photograph, and to PCR amplification
Product is sequenced.
As a result as shown in Figure 1, the PCR product size of celery cell matter male sterile line 99A is 2307bp, the 2307bp piece
The nucleotides sequence of section is classified as sequence 3；Celery holding is that 99B can not expand target fragment.
To celery cell matter male sterile line 99A and its keep being that 99B progress pollen fertility statistics is as follows:
It is investigated in fertility of the full-bloom stage to each single plant, to avoid the misjudgement to phenotype, every plant is carried out 3 times or more
Fertility investigation (the uncracked stamen of fertile flower is very full, and anther dehiscence is abundant after blooming, and pollen amount is more, and sterile flower
Stamen is shrivelled, also without pollen after blooming).The pollen fertility of each plant is counted, the results show that 99A pollen sterility, 99B pollen
It is fertile.
The above results show DNA molecular shown in the pollen fertility correlated series 3 of DNA molecular shown in sequence 3 and celery
It can be used as the molecular labeling of celery pollen fertility identification, the specific method is as follows:
It whether detects in the genome of celery to be measured containing DNA molecular shown in sequence 3 or derivatives thereof；If celery to be measured
Genome in containing DNA molecular shown in sequence 3 or derivatives thereof, then celery infertility to be measured or candidate infertility, if celery to be measured
Without containing DNA molecular shown in sequence 3 or derivatives thereof in the genome of dish, then celery to be measured is fertile or candidate fertile.
Detect in the genome of celery to be measured whether the method containing DNA molecular shown in sequence 3 or derivatives thereof includes
It is as follows:
1) direct Sequencing；
2) PCR amplification is carried out with primer orf768aF (sequence 1) and orf768aR (sequence 2), if PCR product size is
2307bp then contains DNA molecular shown in sequence 3 or derivatives thereof in the genome of celery to be measured；If PCR product size is not
2307bp, then without containing DNA molecular shown in sequence 3 or derivatives thereof in the genome of celery to be measured.
The derivative of DNA molecular shown in sequence 3 is that sequence 3 is passed through to the substitution of one or several nucleotide and/or is lacked
Lose and/or addition and with the DNA molecular with the same function of sequence 3.
Embodiment 2, celery molecular markers for identification celery pollen fertility
1, test material
The celery group (table 1) of pollen fertility known to 41 parts.
The identification of 1,41 part of celery material pollen fertility of table
2, test method
The genomic DNA for extracting each celery of table 1 carries out PCR amplification using primer pair orf768a.Pcr amplification reaction system
With embodiment 1, pcr amplification reaction program is the same as embodiment 1, pcr amplification product 1.5% agarose gel electrophoresis, gel imaging
Analysis system observation photograph.
If PCR product size is 2307bp, celery to be measured contains DNA molecular shown in sequence 3 or derivatives thereof, for not
It educates or candidate sterile；If PCR product size is not 2307bp, celery to be measured does not contain DNA molecular shown in sequence 3 or it spreads out
Biology, for infertility or candidate infertility.
As a result as shown in Fig. 2, the celery that the number that swimming lane 1-41 is respectively table 1 is 1-41；As can be seen that obtaining 2307bp
PCR product be cytoplasmic male sterility celery, fertility and known consistent；The PCR product for not obtaining 2307bp is fertile celery
Dish, fertility and known consistent.
The results are shown in Table 1 for statistics molecule qualification result and known pollen fertility.
The results show that utilizing the pollen fertility of celery molecular markers for identification 41 parts of celery self-mating systems and kind of the invention
In, 10 parts of celery pollen sterilities, 31 parts of celery pollen are fertile, and compared with the practical fertility of this 41 portions of celeries, accuracy is
100%, show that the celery molecular labeling of embodiment 1 is with strong applicability, can use the label in breeding practical application to celery
Cauliflower powder fertility carries out Rapid identification.
SEQUENCE LISTING
<110>China Agricultural University
<120>a kind of molecular labeling isolated with celery cell matter male sterility gene and application
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 23
<212> DNA
<213> Artificial sequence
<400> 1
atgggcacat gcttctcagt act 23
<210> 2
<211> 25
<212> DNA
<213> Artificial sequence
<400> 2
agtagatcat agccttggat tgctc 25
<210> 3
<211> 2307
<212> DNA
<213> Artificial sequence
<400> 3
atgggcacat gcttctcagt actgattcgt atggaattag cacgaccggg cgatcaaatt 60
cttggtggga atcatcaact ttataatgtt ttaataacgg ctcacgcttt tttaatgatc 120
ttttttatgg ttatgccggc gatgataggt ggatctggta attggtctgt tccgattctg 180
ataggtgcgc ctgacatggc atttccacga ttaaataata tttcattctg gttgttgcca 240
ccaagtctct tgctcctatt aagcccagcc ttagtagaag tgggtagcgg cactgggtgg 300
acggtctatc cgcccttaag tggtattacc agccattctg gaggagcagt tgattcagca 360
atttctagtc ctcatctatc tggtgtttca tccattttag gttctatcaa ttttataaca 420
actatctcca acatgcgtgg acctggaatg actatgcata gatcacccct atttgtgtgg 480
tccgttctag tgacagcatt cccactttta ttatcacttc cggtactggc aggggcaatt 540
accatgttat taaccgatcg aaactttaat acaacctttt ctgatcccgc tgggggggga 600
gaccccatat tataccagca tctctttcgg ttcttcggcc atccagaggt gtatattccc 660
attctgcctg gatccggtat cataagtcat atcgtttcta ctttttcggg aaaaccggtc 720
ttcgggtatc taggcatggt ttatgccatg atcagtatag gtgttcttgg atttcttgtt 780
tgggctcatc atatgtttac tgtgggctta gacgttgata cccgtgccta cttcaccgca 840
gctaccatga tcatagctgt ccccactgga atcaaaatct ttagttggat cgctaccatg 900
tgggggggtt cgatacaata caaaacaccc atgttatttg ctgtagggtc catctttttg 960
ttcaccatag gaggactcac tggaatagtt ctggcaaatt ctgggctaga cattgctcta 1020
catgatactt attatgtggt tgcacatttc cattatgtac tttctatggg agccgttttt 1080
gctttatttg caggatttca ctattgggta ggtaaaatct ttggtcggac atatcctgaa 1140
actttaggtc aaatccattt ttggatcact tttttcgggg tgaatccgac cttctttccc 1200
atgcatttct tagggctttc gggtatgcca cgtcgcattc cagattatcc agatgcttac 1260
gctggatgga atgcccttag cagttctggc tcttatatat ccgtagttgg gatttgtcgt 1320
ttcttcgtgg tcgtaacaat cacttcaagc agtggaaaca acaaaagatg cgctccaagt 1380
ccttgggctg ttgaacagaa tccaaacaca ccggaatgga tgatacaaag tcctccagcc 1440
tttcatactt ttggagaact tcctgctatc aaggagacga aaggaagaaa gggcgaacta 1500
acgattacta aaacaaaagg ggctatgcta ggagggggaa gtctatcaag actttcaata 1560
ctcctagcag tgtgtctccc gttttacgcc ctttcttggt tcttcggcca atcttctctt 1620
tatttctttt ttttgacgaa gggagccggt ttggcattcc ttcgccttac tttggcaagt 1680
ctaaaaagga tagggtgccc taccgtagtc acccttcctt tttattccct tctttgtatt 1740
acttggggta tggattcggg atcttcagga tcttcgatca atatcccccc catctctatg 1800
actcgatcgg aagaggaagt tttgaatgat atttgtgcac attcttcttc ctcggcgaac 1860
cagccggcgc cagcacaagg gggagaaata atggccccgc cggttctgcc gccggtgcct 1920
caacctattg tgccggaatt gcaccagccg atcttttcgg atgaagtaag gaggaacatc 1980
ctgtatgaca ggtacttact tctcaatttt gggggggatc aggacttccg gcgtatggga 2040
gccattatcg acgctcaggt cagagtggaa cgatatgtag aagctgcttt agtggctgat 2100
ggatttactc cggagtccat agtccatcgg gctagtgatc tcaggagctt aattcattct 2160
ccacatggag aactttttag tgcgcgtacc tatgaattgt acgtcactaa aatccaagaa 2220
catggaacac gcgaaagcgt gccgtatcgg cgcgttataa gagcaatcca aggctatgat 2280
ctacttttag accgccccgc cggatag 2307
Claims (10)
1. detect in celery genome to be measured whether the substance containing nucleotide shown in sequence 3 or derivatives thereof following 1) -6)
At least one of in application:
1) it identifies or assists to identify celery fertility to be measured；
2) preparation identification or auxiliary identify the product of celery fertility to be measured；
3) breeding infertility celery；
4) product of breeding infertility celery is prepared；
5) the fertile celery of breeding；
6) product of the fertile celery of breeding is prepared.
2. application according to claim 1, it is characterised in that: the derivative of nucleotide shown in the sequence 3 is by sequence
Column 3 divide by the substitution and/or deletion and/or addition of one or several nucleotide and with the DNA with the same function of sequence 3
Son.
3. applying according to claim 1 or shown in 2, it is characterised in that:
In detection celery genome to be measured whether the substance containing nucleotide shown in sequence 3 or derivatives thereof be it is following 1)
Or 2):
1) primer set, primer set single strand dna as shown in sequence 1 in sequence table or derivatives thereof and sequence table
Single strand dna shown in middle sequence 2 or derivatives thereof；
2) contain the PCR reagent or kit of the primer set.
4. application according to claim 3, it is characterised in that:
The derivative of single strand dna shown in sequence 1 is by sequence 1 by one or several nucleotide in the sequence table
Replace and/or deletion and/or addition and with the DNA molecular with the same function of sequence 1；
The derivative of single strand dna shown in sequence 2 is by sequence 2 by one or several nucleotide in the sequence table
Replace and/or deletion and/or addition and with the DNA molecular with the same function of sequence 2.
5. whether containing shown in sequence 3 in a kind of product, including detection celery genome to be measured described in claim 3 or 4
The substance of nucleotide or derivatives thereof；
At least one of the product has the function of following 1) -3):
1) it identifies or assists to identify celery fertility to be measured；
2) breeding infertility celery；
3) the fertile celery of breeding.
6.DNA molecule, nucleotides sequence be classified as it is following 1) or 2):
1) nucleotide shown in sequence 3 in sequence table；
2) sequence 3 by the substitution and/or deletion and/or addition of one or several nucleotide and had into identical function with sequence 3
The DNA molecular of energy.
7. DNA molecular as claimed in claim 6 is following 1) -3) at least one of in application:
1) it identifies or assists to identify celery fertility to be measured；
2) breeding infertility celery；
3) the fertile celery of breeding.
8. a kind of method that identification or auxiliary identify celery fertility to be measured, includes the following steps: to detect in celery genome to be measured
Whether containing nucleotide shown in sequence 3 or derivatives thereof, if containing nucleotide shown in sequence 3 in the genome of celery to be measured
Or derivatives thereof, then celery infertility to be measured or candidate are sterile, if without containing nucleosides shown in sequence 3 in the genome of celery to be measured
Acid or derivatives thereof, then celery to be measured is fertile or candidate fertile；
The derivative of nucleotide shown in the sequence 3 is the substitution and/or missing by sequence 3 by one or several nucleotide
And/or addition and with the DNA molecular with the same function of sequence 3.
9. a kind of method of breeding infertility celery includes the following steps: to detect in celery genome to be measured whether contain 3 institute of sequence
Nucleotide shown or derivatives thereof, the celery to be measured containing nucleotide shown in sequence 3 or derivatives thereof in breeding genome are
Sterile celery；
Or, a kind of method of the fertile celery of breeding, includes the following steps: to detect in celery genome to be measured whether contain sequence 3
Shown in nucleotide or derivatives thereof, the celery to be measured without containing nucleotide shown in sequence 3 or derivatives thereof in breeding genome
Dish, for sterile celery；
The derivative of nucleotide shown in the sequence 3 is the substitution and/or missing by sequence 3 by one or several nucleotide
And/or addition and with the DNA molecular with the same function of sequence 3.
10. method according to claim 8 or claim 9, it is characterised in that: whether contain in the detection celery genome to be measured
The method of nucleotide shown in sequence 3 or derivatives thereof is as follows:
1) direct Sequencing；
2) primer set described in claim 3 or 4 expands the celery to be measured, detects amplified production；
If the amplified production size is 2307bp, contain nucleotide shown in sequence 3 in the genome of the celery to be measured
Or derivatives thereof；
If the amplified production size is not 2307bp, without containing core shown in sequence 3 in the genome of the celery to be measured
Thuja acid or derivatives thereof.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910393232.0A CN110029189B (en) | 2019-05-13 | 2019-05-13 | Molecular marker coseparated with celery cytoplasmic male sterility gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910393232.0A CN110029189B (en) | 2019-05-13 | 2019-05-13 | Molecular marker coseparated with celery cytoplasmic male sterility gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110029189A true CN110029189A (en) | 2019-07-19 |
| CN110029189B CN110029189B (en) | 2020-09-01 |
Family
ID=67241993
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910393232.0A Active CN110029189B (en) | 2019-05-13 | 2019-05-13 | Molecular marker coseparated with celery cytoplasmic male sterility gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110029189B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1742560A (en) * | 2005-09-30 | 2006-03-08 | 中国农业大学 | Method for producing hybrid of celery and seedling-stage purity appraising method |
| CN101999311A (en) * | 2010-09-13 | 2011-04-06 | 天津市农业高新技术示范园区管理中心 | Celery cytoplasmic male sterile line breeding method and cross-breeding method using celery cytoplasmic male sterile line |
| CN104046694A (en) * | 2014-06-25 | 2014-09-17 | 中国科学院植物研究所 | Method for identifying or aiding identifying whether to-be-detected arabidopsis is male sterile strain or not |
| CN109468410A (en) * | 2019-01-11 | 2019-03-15 | 中国农业大学 | The gene molecule marker and its application that a kind of and capsicum genic male sterile gene msc-2 is isolated |
-
2019
- 2019-05-13 CN CN201910393232.0A patent/CN110029189B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1742560A (en) * | 2005-09-30 | 2006-03-08 | 中国农业大学 | Method for producing hybrid of celery and seedling-stage purity appraising method |
| CN101999311A (en) * | 2010-09-13 | 2011-04-06 | 天津市农业高新技术示范园区管理中心 | Celery cytoplasmic male sterile line breeding method and cross-breeding method using celery cytoplasmic male sterile line |
| CN104046694A (en) * | 2014-06-25 | 2014-09-17 | 中国科学院植物研究所 | Method for identifying or aiding identifying whether to-be-detected arabidopsis is male sterile strain or not |
| CN109468410A (en) * | 2019-01-11 | 2019-03-15 | 中国农业大学 | The gene molecule marker and its application that a kind of and capsicum genic male sterile gene msc-2 is isolated |
Non-Patent Citations (2)
| Title |
|---|
| QUIROS, C.F等: " Cytological and genetical studies of a male sterile celery", 《EUPHYTICA》 * |
| 高国训等: "芹菜雄性不育株的发现及其植物学特征", 《天津农业科学》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110029189B (en) | 2020-09-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Singh et al. | Evaluation of microsatellite markers for genetic diversity analysis among sugarcane species and commercial hybrids | |
| CN104711361B (en) | The method of the red peaceful hybrid seed purity of Rapid identification new water melon breed and the primer and kit of use | |
| CN102134586A (en) | High-efficiency screening method for microsatellite marker of Marbled Sand Goby and application of same | |
| CN104131012A (en) | Molecular marker for identifying soybean nucleus male sterility line and identification method thereof | |
| CN108728571A (en) | The InDel molecular labeling and application chain with gossypium harknessii brand fertility restorer gene | |
| CN107190094A (en) | The application of capsicum annuum mark and its polymorphism in identification capsicum pollens fertility | |
| CN110106279A (en) | Unit point SSR primer sets and its application based on the exploitation of siberian wildrye genome sequence | |
| CN106119360A (en) | A kind of SCAR molecular marker identifying banana blight resistance and authentication method thereof | |
| CN109280665A (en) | Rye molecular specificity labeled primers, application method and its application | |
| CN105543373A (en) | Rapid molecular identification method for glycyrrhiza uralensis, glycyrrhiza glabra, glycyrrhiza inflate and hybrid variety thereof | |
| CN109609676B (en) | SNP (Single nucleotide polymorphism) marker co-separated from corn gray spot resistant major QTL-qRgls1 and application | |
| Moniruzzaman et al. | Development of microsatellites: a powerful genetic marker. | |
| KR101426466B1 (en) | Complete sequencing of Chloroplast genomes of Panax ginseng-derived Maker, DNA primer sets and Kits for discrimination of Panax ginseng cultivars and Panax species and uses thereof | |
| CN110029189A (en) | The molecular labeling and application that a kind of and celery cell matter male sterility gene isolates | |
| CN110157835A (en) | One kind InDel molecular marker and primer thereof relevant to Rice Heading blooming stage heat resistance and application | |
| CN109825625A (en) | For identifying the primer sets and its application of Chinese white poplar monoploid or zygoid | |
| CN113462802B (en) | SSR marker closely linked with cotton cytoplasmic male sterility restoring gene and application thereof | |
| CN107794261B (en) | Molecular marker closely linked with major QTL (quantitative trait loci) of rape grain number per pod and application thereof | |
| CN108148920A (en) | The functional form molecular labeling of capsicum nuclear male sterility related gene and its application | |
| Lavania | Fluorescence in situ hybridization in genome, chromosome and gene identification in plants | |
| KR101649589B1 (en) | SSR primer derived from apple and use thereof | |
| KR101401980B1 (en) | Specific primer for selecting Phytophthora blight resistant pepper and uses thereof | |
| CN111778354A (en) | Molecular marker closely linked with photosensitive male sterility character of cotton PSM4, molecular identification method and application | |
| Suprun et al. | Molecular genetic identification of alleles of self-incompatibility gene in Russian apple varieties | |
| KR101736670B1 (en) | Primer sets for identification of Phalaenopsis and composition of marker comprising the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |