CN110029109A

CN110029109A - A kind of sialic acid inducing expression element and application

Info

Publication number: CN110029109A
Application number: CN201910358479.9A
Authority: CN
Inventors: 刘延峰; 堵国成; 刘龙; 张晓龙; 王凤玲; 袁烁栎; 陈坚
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2019-04-30
Filing date: 2019-04-30
Publication date: 2019-07-19
Anticipated expiration: 2039-04-30
Also published as: CN110029109B

Abstract

The invention discloses a kind of sialic acid inducing expression element and applications, belong to field of genetic engineering.The present invention is using pHT plasmid as carrier, in bacillus subtilis, P_ydjOPromoter expresses transcriptional regulation protein NanR, optimizes and combines the strong promoter P of NanR identification binding sequence_veg, realize the leakage expression of extremely low level in the environment of containing sialic acid of bacillus subtilis (Bacillus subtilis) 168, leakage expression rate can be made to be reduced to 2% or so, be with a wide range of applications.

Description

A kind of sialic acid inducing expression element and application

Technical field

The present invention relates to a kind of sialic acid inducing expression element and applications, belong to field of genetic engineering.

Background technique

In bacillus subtilis, it can induce the promoter element of activation expression, be widely used in metabolic engineering field.Mesh Before, common evoked promoter in bacillus subtilis has xylose evoked promoter P_xylWith IPTG evoked promoter P_grac.So And xylose evoked promoter P_xylInducer xylose can be by bacillus subtilis metabolic exhaustion, IPTG evoked promoter P_grac's There is certain toxicity to cell in inducer IPTG.Especially, there are higher leakages for xylose and IPTG evoked promoter Problem.Disadvantages described above seriously limits it in the application in bacillus subtilis metabolic engineering field.Sialic acid is as a kind of simple Carbon source, and to cytotoxic, and will not be a kind of suitable inducer by bacillus subtilis metabolic exhaustion.Pass through gene work Promoter is transformed in journey, can obtain the response element for being more appropriate to bacillus subtilis based on sialic acid induction.However, how Promoter is transformed, to reduce the problem of its leakage expression is a worth further investigation.In addition, bacillus subtilis lacks saliva The natural transporting pathway of acid cannot transport extracellular sialic acid to intracellular, and which also limits sialic acid inducing expression elements in withered grass bud The application in spore bacillus metabolic engineering field.

Summary of the invention

In order to solve the above technical problems, inducing expression promoter element of the building in response to sialic acid, the present invention is to form Type promoter P_ydjOOr strong promoter P_hbsTranscriptional regulation protein NanR is expressed, further by constitutive promoter P_vegIn, Transcriptional regulation protein NanR binding sequence TTNANNTGGTATAACAGGTATANAGNTANNNNNTNN is integrated, realizes addition saliva After acid, inducing expression of the Expression element in bacillus subtilis BSNanT.Further pass through replacement NanR promoter P_ydjOFor Strong promoter P_hbs, in P_vegThe NanR binding sequence of a copy is further increased in promoter, realizes sialic acid response element The extremely low leakage expression quantity in asialo addition.

The first purpose of the invention is to provide a kind of inducing expression promoter elements for responding sialic acid；Containing (a) or (b)；

(a) constitutive promoter P_ydjO, transcriptional regulation protein NanR, constitutive promoter P_veg, transcriptional regulation protein NanR Binding sequence, the composing type P_ydjOPromoter expresses transcriptional regulation protein NanR；The constitutive promoter P_vegIt is integrated with and turns Record modulin NanR binding sequence；The promoter P_ydjOAnd P_vegOpposite direction connection；

(b) constitutive promoter P_hbs, transcriptional regulation protein NanR, constitutive promoter P_veg, two copies transcription tune Control albumen NanR binding sequence, the composing type P_ydjOPromoter expresses transcriptional regulation protein NanR；The constitutive promoter P_vegIntegrate transcriptional regulation protein NanR binding sequence；The promoter P_ydjOAnd P_vegOpposite direction connection.

In one embodiment of the invention, the composing type P_ydjOThe nucleotide sequence of promoter such as SEQ ID Shown in NO.1.

In one embodiment of the invention, transcriptional regulation protein P_hbsThe nucleotide sequence of promoter such as SEQ NO.2 It is shown.

In one embodiment of the invention, the nucleotide sequence of NanR binding site sequence is as shown in SEQ NO.3.

In one embodiment of the invention, transcriptional regulation protein NanR amino acid sequence is as shown in SEQ NO.4.

In one embodiment of the invention, sialic acid transport protein NanT amino acid sequence is as shown in SEQ NO.5.

In one embodiment of the invention, the P of NanR binding site sequence is integrated_vegPromoter base sequence such as SEQ Shown in NO.6.

In one embodiment of the invention, the P of 2 NanR binding site sequences is integrated_vegPromoter base sequence is such as Shown in SEQ NO.7.

In one embodiment of the invention, the plasmid tool of the inducing expression promoter for constructing sialic acid is matter Grain pHT01.

In one embodiment of the invention, the P_vegPromoter also regulates and controls the expression of marker.

In one embodiment of the invention, the marker is fluorescin.

In one embodiment of the invention, the marker is green fluorescent protein, amino acid sequence such as SEQ Shown in NO.8

In one embodiment of the invention, the inducing expression promoter element building is on pHT01 plasmid.

A second object of the present invention is to provide a kind of methods for constructing the inducing expression element plasmid, including walk as follows It is rapid:

1) building genome recombination integrates NanT segment:

By fusion DNA vaccine, the saliva acid transporter enzyme coding gene NanT of source Escherichia coli is inserted into bacillus subtilis After 168 genome adeC genes, 1000bp is left homology arm before adeC gene end codon TAA, and 1000 be the right side later Homology arm, zeocin resistant gene and P₄₃Promoter gene and NanT genetic fragment amount to 5 genetic fragment fusions, obtain NanT recombinant fragment；

2) Transshipment Permitted sialic acid recombined bacillus subtilis is constructed:

By above-mentioned steps 1) in recombinant fragment recombination to bacillus subtilis (Bacillus subtilis) 168 genomes On, recombined bacillus subtilis engineering bacteria is obtained, BSNanT is named as；

3) sialic acid response element tool plasmid pHT-ydjO-veg plasmid is constructed:

Clone transcriptional regulation protein encoding gene NanR genetic fragment, P_ydjOPromoter gene segment, P_vegGenetic fragment and GFP genetic fragment and pHT plasmid fragments, totally 5 segments by NEB Gibson Assembly Master Mix Kit into Row assembling, constructs sialic acid response element tool plasmid pHT-ydjO-veg plasmid.

4) sialic acid inducing expression element bacillus subtilis BSNanT-pHT-ydjO-veg is constructed

By above-mentioned steps 3) in sialic acid response element tool plasmid pHT-ydjO-veg plasmid, conversion is to above-mentioned steps 2) Engineered strain BSNanT in, obtain recombined bacillus subtilis engineering bacteria, be named as BSNanT-pHT-ydjO-veg.

5) building optimization sialic acid response element tool plasmid pHT-hbs-veg plasmid

Using bacillus subtilis (Bacillus subtilis 168) genome as template, strong promoter P is expanded_hbsGene Segment, to replace P_ydjOPromoter, to improve transcriptional regulation protein NanR expression quantity；Using pHT-ydjO-veg plasmid as template Plasmid backbone genetic fragment, totally 2 segments, are assembled, structure by NEB Gibson Assembly Master Mix Kit Build sialic acid induction expression plasmid pHT-hbs-veg plasmid.

6) building optimization sialic acid inducing expression element bacillus subtilis BSNanT-pHT-hbs-veg

By above-mentioned steps 5) in sialic acid response element tool plasmid pHT-hbs-veg plasmid, conversion is to above-mentioned steps 2) Engineered strain BSNanT in, obtain recombined bacillus subtilis engineering bacteria, be named as BSNanT-pHT-hbs-veg.

7) building optimization sialic acid inducing expression element plasmid pHT-hbs-veg-2

Using pHT-hbs-veg plasmid as template, by increasing a NanR binding sequence on primer, building sialic acid is lured Lead expression plasmid pHT-hbs-veg-2 plasmid.

8) building optimization sialic acid inducing expression element bacillus subtilis BSNanT-pHT-hbs-veg-2

By above-mentioned steps 7) in sialic acid response element tool plasmid pHT-hbs-veg-2 plasmid, conversion is to above-mentioned steps 2) in engineered strain BSNanT, recombined bacillus subtilis engineering bacteria is obtained, BSNanT-pHT-hbs-veg-2 is named as.

Third mesh of the invention is to provide the genetic engineering bacterium containing the sialic acid inducing expression element.

In one embodiment of the invention, the genetic engineering bacterium is host with bacillus subtilis.

Fourth object of the present invention is to provide the sialic acid inducing expression element plasmid and is metabolized in bacillus subtilis The application of engineering field.

In one embodiment of the invention, the application includes but is not limited under activating under sialic acid existence condition Swim the expression of target gene.

In one embodiment of the invention, the induction is in 30~37 DEG C and 220rpm, in the fermentation medium Under conditions of culture 48h.

The utility model has the advantages that

(1) present invention is by by transcriptional regulation protein NanR binding site sequence TTNANNTGGTATAACAGGTATANAG NTANNNNNTNN is integrated into composition type expression promoter P_vegIn, obtain sialic acid inducing expression promoter element pHT- ydjO-veg。

(2) sialic acid inducing expression promoter element provided by the invention, in bacillus subtilis, pHT-ydjO- Veg activation expression intensity reaches 4000a.u..Sialic acid inducing expression promoter element letting out under asialo existence condition Leaking expression is only 10% or so.

(3) by by NanR promoter P_ydjOFor strong promoter P_hbs, obtain sialic acid inducing expression promoter element pHT- Hbs-veg, activation expression intensity are 3900a.u..Leakage expression under asialo existence condition is reduced from 10% To 6%.

(4) by P_vegA NanR binding sequence is further increased in promoter, obtains the starting of sialic acid inducing expression Subcomponent pHT-hbs-veg-2, activation expression intensity are 3700a.u..Water is expressed in leakage under asialo existence condition It is flat, further 2% is reduced to from 6%.For further by genetic engineering, transformed bacillus bacillus sialic acid inducing expression is opened Mover is laid a good foundation.Optimization sialic acid inducing expression promoter construction method provided by the invention is simple, is easy to use, has Good metabolic engineering application prospect.

Specific embodiment

The bacillus subtilis condition of culture of the promoter element of inducing expression containing sialic acid:

Fermentation medium (g/L): sialic acid 5, tryptone 6, yeast powder 12, ammonium sulfate 6, dipotassium hydrogen phosphate 12.5, phosphorus Acid dihydride potassium 2.5, magnesium sulfate 3.

Condition of culture: 37 DEG C, 200rpm, under the conditions of cultivate 48h.

Green fluorescent protein and cell concentration detection method:

Tecan microplate reader: green fluorescent protein detection, excitation wavelength 490nm, launch wavelength 530nm, gain 60.Thallus Concentration Testing wavelength is 600nm.

Reveal expression quantity calculation formula (%): x=(a-b)/c

Wherein, a is sialic acid induction director's element, and the fluorescence intensity when being not added with sialic acid, b is bacillus subtilis Fluorescence intensity of 168 bacterial strains as control strain, c are fluorescence intensity of the sialic acid induction director's element when adding sialic acid.

Embodiment 1 constructs genome recombination and integrates NanT segment

Design primer L-F:5 '-GTATGTCATGATGCGTGAAGGATCAGTCGCCAAAAACACGC-3 ' and L-R:5 '- GTTATCCGCTCAAAAAGAGGCACTCCCTAAGGGAGTGCCTCTTTTTATTGCAGTG- 3 ', with bacillus subtilis 168 Genome is template, expands the left arm gene order of NanT transport protein recombinant fragment shown in SEQ ID NO.9；Design primer S- F:5 '-CCTTAGGGAGTGCCTCTTTTTGAGCGGATAACAATTTCACACAGGAAACAG-3 ' and S-R:5 '-CACCTATC ATAACGCCAGGGTTTTCCCAGTCACGAC-3 ', using P7S6 plasmid as template (be disclosed in Zhang, X., Liu, Y., Liu, L.,Wang,M.,Li,J.,Du,G.et al.,2018.Modular pathway engineering of key carbon- precursor supply-pathways for improved N-acetylneuraminic acid production in Bacillus subtilis.Biotechnol.Bioeng.115, in 2217-31), amplification NanT transport protein recombinant fragment Spectinomycin resistance left arm gene order SEQ ID NO.10；Design primer P-F:5 '-GACTGGGAAAACCCTGGCGTTATG ATAGGTGGTATGTTTTCGCTTGAACTTTTA-3 ' and P-R:5 '-GGATATTCTGGGTTGTAGTACTCATGTGTACATT CCTCTCTTACCTATAATGGTACCGC-3 ' expands NanT transport protein recombinant fragment with 168 templates of bacillus subtilis P₄₃Promoter gene sequence SEQ ID NO.11；Design primer N-F:5 '-TAGGTAAGAGAGGAATGTACACATGAGTAC TACAACCCAGAATATCCCGTGGTATCGCCATCTCAACCG-3 ' and N-R:5 '-GGGGTTGACGACCGAGTAGTTCACC TTAACTTTTGGTTTTGACTAAATCGTTTTTGGCGCTGCCAAACGGCACG-3 ', using e. coli k12 genome as mould Plate expands the saliva acid transporter enzyme NanT gene order of NanT transport protein recombinant fragment shown in SEQ ID NO.12；Design Primer R-F:5 '-TTAAGGTGAACTACTCGGTCGTCAACCCCATTAAACCTCCATAATGATCGGCAGGA TCATTGGAC GGCGCTTTG-3 ' and R-R:5 '-CCATGTCTGAGCGCCGTGTAGGAGAAAGCATTCATGACATTTTCCG-3 ', with withered grass 168 genome of bacillus is template, expands recombinant fragment right arm gene order SEQ ID NO.13；By above 5 gene pieces Section (SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12 and SEQ ID NO.13) passes through fusion Round pcr is built into genome conformity expression NanT genetic fragment, is named as LSPNR.

The building of 2 Transshipment Permitted sialic acid recombined bacillus subtilis of embodiment

Recombination and integration NanT genetic fragment LSPNR is converted to bacillus subtilis (Bacillus subtilis) 168, It recombinates on genome, obtains recombined bacillus subtilis engineering bacteria, be named as BSNanT.

Embodiment 3 constructs sialic acid response element tool plasmid pHT-ydjO-veg plasmid

Design primer N-1F:5-AACGACGGCCAGTGAATTCGAGCTCTTATTTCTTTTTGTTGGTGGTCTG ACCG AAAG-3 ' and N-1R:5-ACGTAAAAACAAAGGAGGTGAAATGTACACATGGGCCTTATGAACGCAT TTGATTCGCA- 3 ', using 168 genome of bacillus subtilis as template, clone transcriptional regulation protein encoding gene NanR genetic fragment SEQ ID NO.4；Design primer N-2F:5-GTGTACATTTCACCTCCTTTGTTTTTACGTAATACGATAAATAGGGCCA AAGGT-3 ' With N-2R:5-GTATTACGGAGCACTTCCCATATTATCAAGAAAGCGGGGAATTGTCCTA TACC-3 ', with withered grass gemma 168 genome of bacillus is template, clones P_ydjOPromoter gene segment SEQ ID NO.1, design primer N-3F:5-CCCGCTT TCTTGATAATATGGGAAGTGCTCCGTAATACGCTGACAAGAGA-3 ' and N-3R:5-CTTTAAACGATATACCTTTAT ACCTGTTATACCATTGTACAACACGAGCCCATTTTTGTCAAATAAAATTTAAATT- 3 ', with bacillus subtilis 168 Genome is template, clones P_vegGenetic fragment SEQ ID NO.6, design primer N-4F:5-ATAACAGGTATAAAGGTATAT CGTTTAAAGGAGGTGAAATGTACACATGGGTAAGGGAGAAGAACTTTTCACT-3 ' and N-4R:5-GCGTGACGTGAA TTATTTGTATAGTTCATCCATGCCATGTGTAATCCCAGCAG-3 ', using laboratory preservation plasmid as template, cloned sequence The GFP genetic fragment as shown in SEQ ID NO.8；Design primer N-5F:5-GAACTATACAAATAATTCACGTCACGCGTC CATGGAGA-3 ' and N-5R:5-GAGCTCGAATTCACTGGCCGTCGTTTTACAAC-3 ', using plasmid pHT01 as template, gram Grand pHT01 skeleton segment SEQ ID NO.14, above totally 5 segments pass through NEB Gibson Assembly Master Mix Kit is assembled, and sialic acid response element tool plasmid pHT-ydjO-veg plasmid is constructed.

Embodiment 4 constructs sialic acid inducing expression element bacillus subtilis BSNanT-pHT-ydjO-veg

By sialic acid response element tool plasmid pHT-ydjO-veg plasmid, supreme bacillus subtilis engineered strain is converted In BSNanT, recombined bacillus subtilis engineering bacteria is obtained, BSNanT-pHT-ydjO-veg is named as.

5 bacillus subtilis BSNanT-pHT-ydjO-veg of embodiment adds sialic acid induction fermentation

By the bacterial strain BSNanT-pHT-ydjO-veg prepared according to the method for embodiment 4 under 37 DEG C, 200rpm, containing 48h is cultivated in the fermentation medium for having 5g/L sialic acid.Final measurement fermentation liquid green fluorescent protein intensity is 4000a.u., at Function obtains the sialic acid inducing expression element of strong inducing expression intensity.When not adding sialic acid in fermentation medium, fermentation 48h, fermentation liquid green fluorescent protein intensity are 400a.u., and leakage expression quantity is 10%.

The building optimization sialic acid response element tool plasmid pHT-hbs-veg plasmid of embodiment 6

Design primer hbs-F:5-TGTGTACATTTCACCTCCTTTGAATGTTTGTCCAACAAAGTGAAGAAT TTCT GTATGTA-3 ' and hbs-R:5-GTATTACGGAGCACTTCCCATAAGGATCAAGGAATAGGATGAAAAAAG GAAAAAAA GGA-3 ', using 168 genome of bacillus subtilis as template, cloning promoter P_hbsGenetic fragment SEQ ID NO.2；Design is drawn Object hbs-2F:5-TATGGGAAGTGCTCCGTAATACGCTGA-3 ' and hbs-2R:5- AAAGGAGGTGAAATGTACACATGGGCCT-3 ' is cloned shown in SEQ ID NO.15 using pHT-ydjO-veg plasmid as template Plasmid backbone genetic fragment, assembled by NEB Gibson Assembly Master Mix Kit, construct sialic acid Response element tool plasmid pHT-hbs-veg plasmid.

Embodiment 7 constructs sialic acid inducing expression element bacillus subtilis BSNanT-pHT-hbs-veg

By sialic acid response element tool plasmid pHT-hbs-veg plasmid, supreme bacillus subtilis engineered strain is converted In BSNanT, recombined bacillus subtilis engineering bacteria is obtained, BSNanT-pHT-hbs-veg is named as.

8 bacillus subtilis BSNanT-pHT-hbs-veg of embodiment adds sialic acid induction fermentation

By the bacterial strain BSNanT-pHT-hbs-veg prepared according to the method for embodiment 4 under 37 DEG C, 200rpm, containing 48h is cultivated in the fermentation medium of 5g/L sialic acid.Final measurement fermentation liquid green fluorescent protein intensity is 3900a.u., success Obtain the sialic acid inducing expression element of strong inducing expression intensity.When not adding sialic acid in fermentation medium, ferment 48h, Fermentation liquid green fluorescent protein intensity is 230a.u., and leakage expression quantity is 6%.

The building optimization sialic acid response element tool plasmid pHT-hbs-veg-2 plasmid of embodiment 9

Design primer veg2-F:5-TTGATCTGGTATAACAGGTATAAAGGTATACACTTTAAAGGAGGTGA AATG TACACATGGGTAAGG-3 ' and veg2-R:5-CTTTATACCTGTTATACCAGATCAAAAACGATATACCTTTATACCTG TTATACCATTGTACAACACGA-3 ', using pHT-hbs-veg plasmid as template, amplified production directly converts Escherichia coli, structure Build sialic acid response element tool plasmid pHT-hbs-veg-2 plasmid.

Embodiment 10 constructs sialic acid inducing expression element bacillus subtilis BSNanT-pHT-hbs-veg-2

By sialic acid response element tool plasmid pHT-hbs-veg-2 plasmid, supreme bacillus subtilis engineering bacteria is converted In strain BSNanT, recombined bacillus subtilis engineering bacteria is obtained, BSNanT-pHT-hbs-veg-2 is named as.

11 bacillus subtilis BSNanT-pHT-hbs-veg-2 of embodiment adds sialic acid induction fermentation

By the bacterial strain BSNanT-pHT-hbs-veg-2 prepared according to the method for embodiment 4 under 37 DEG C, 200rpm, containing 48h is cultivated in the fermentation medium for having 5g/L sialic acid.Final measurement fermentation liquid green fluorescent protein intensity is 3700a.u., at Function obtains the sialic acid inducing expression element of strong inducing expression intensity.When not adding sialic acid in fermentation medium, fermentation 48h, fermentation liquid green fluorescent protein intensity are 75a.u., and leakage expression quantity is 2%.

Adjust sialic acid concentration, other condition of culture are constant, the results show that in fermentation medium sialic acid content be 1~ When 10g/L, fluorescence intensity is 3500~3700a.u., and Strength Changes are little.

Comparative example 1:

Expression element library is constructed according to Examples 1 to 8 same policy, chooses P_asdPromoter, P_gltXPromoter, P_yvyDIt opens Mover, P_csbAPromoter, P_phrFPromoter and P_yceCPromoter (it is disclosed in paper Yang, S., Du, G., Chen, J., Kang, Z.,2017.Characterization and application of endogenous phase-dependent Promoters in Bacillus subtilis.Appl.Microbiol.Biotechnol.101, in 4151-61.), totally 6 A promoter integrates NanR binding sequence, the results show that P_asdPromoter, P_gltXPromoter, P_yvyDPromoter, P_csbAPromoter, P_phrFPromoter and P_yceCPromoter, totally 6 promoters, cannot be expressed by saliva acid active.

Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention Enclosing subject to the definition of the claims.

SEQUENCE LISTING

<110>Southern Yangtze University

<120>a kind of sialic acid inducing expression element and application

<160> 15

<170> PatentIn version 3.3

<210> 1

<211> 300

<212> DNA

<213>artificial sequence

<400> 1

ttatcaagaa agcggggaat tgtcctatac cggtccggct gtcccgccgc cgccaagtga 60

aaagggctgg aaagacacca ttcaagcgca tgcaggtgaa gtcctgagaa tcgcggcgac 120

attcggtccg tacagcggac gatacgtatg gcattgccat attctagagc atgaagacta 180

tgacatgatg agaccgatgg atataactga tccccataaa taacccgaca aacttgcctc 240

tagcaggcaa gttttttctt tatgaaacct ttggccctat ttatcgtatt acgtaaaaac 300

<210> 2

<211> 164

<212> DNA

<213>artificial sequence

<400> 2

aggatcaagg aataggatga aaaaaggaaa aaaaggaata ttcgttcggt aaatcacctt 60

aaatccttga cgagcaaggg attgacgctt taaaatgctt gatatggctt tttatatgtg 120

ttactctaca tacagaaatt cttcactttg ttggacaaac attc 164

<210> 3

<211> 36

<212> DNA

<213>artificial sequence

<220>

<221> misc_feature

<222> (3)..(3)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (5)..(6)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (23)..(23)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (26)..(26)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (29)..(33)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (35)..(36)

<223> n is a, c, g, or t

<400> 3

ttnanntggt ataacaggta tanagntann nnntnn 36

<210> 4

<211> 263

<212> PRT

<213>artificial sequence

<400> 4

Met Gly Leu Met Asn Ala Phe Asp Ser Gln Thr Glu Asp Ser Ser Pro

1 5 10 15

Ala Ile Gly Arg Asn Leu Arg Ser Arg Pro Leu Ala Arg Lys Lys Leu

20 25 30

Ser Glu Met Val Glu Glu Glu Leu Glu Gln Met Ile Arg Arg Arg Glu

35 40 45

Phe Gly Glu Gly Glu Gln Leu Pro Ser Glu Arg Glu Leu Met Ala Phe

50 55 60

Phe Asn Val Gly Arg Pro Ser Val Arg Glu Ala Leu Ala Ala Leu Lys

65 70 75 80

Arg Lys Gly Leu Val Gln Ile Asn Asn Gly Glu Arg Ala Arg Val Ser

85 90 95

Arg Pro Ser Ala Asp Thr Ile Ile Gly Glu Leu Ser Gly Met Ala Lys

100 105 110

Asp Phe Leu Ser His Pro Gly Gly Ile Ala His Phe Glu Gln Leu Arg

115 120 125

Leu Phe Phe Glu Ser Ser Leu Val Arg Tyr Ala Ala Glu His Ala Thr

130 135 140

Asp Glu Gln Ile Asp Leu Leu Ala Lys Ala Leu Glu Ile Asn Ser Gln

145 150 155 160

Ser Leu Asp Asn Asn Ala Ala Phe Ile Arg Ser Asp Val Asp Phe His

165 170 175

Arg Val Leu Ala Glu Ile Pro Gly Asn Pro Ile Phe Met Ala Ile His

180 185 190

Val Ala Leu Leu Asp Trp Leu Ile Ala Ala Arg Pro Thr Val Thr Asp

195 200 205

Gln Ala Leu His Glu His Asn Asn Val Ser Tyr Gln Gln His Ile Ala

210 215 220

Ile Val Asp Ala Ile Arg Arg His Asp Pro Asp Glu Ala Asp Arg Ala

225 230 235 240

Leu Gln Ser His Leu Asn Ser Val Ser Ala Thr Trp His Ala Phe Gly

245 250 255

Gln Thr Thr Asn Lys Lys Lys

260

<210> 5

<211> 496

<212> PRT

<213>artificial sequence

<400> 5

Met Ser Thr Thr Thr Gln Asn Ile Pro Trp Tyr Arg His Leu Asn Arg

1 5 10 15

Ala Gln Trp Arg Ala Phe Ser Ala Ala Trp Leu Gly Tyr Leu Leu Asp

20 25 30

Gly Phe Asp Phe Val Leu Ile Ala Leu Val Leu Thr Glu Val Gln Gly

35 40 45

Glu Phe Gly Leu Thr Thr Val Gln Ala Ala Ser Leu Ile Ser Ala Ala

50 55 60

Phe Ile Ser Arg Trp Phe Gly Gly Leu Met Leu Gly Ala Met Gly Asp

65 70 75 80

Arg Tyr Gly Arg Arg Leu Ala Met Val Thr Ser Ile Val Leu Phe Ser

85 90 95

Ala Gly Thr Leu Ala Cys Gly Phe Ala Pro Gly Tyr Ile Thr Met Phe

100 105 110

Ile Ala Arg Leu Val Ile Gly Met Gly Met Ala Gly Glu Tyr Gly Ser

115 120 125

Ser Ala Thr Tyr Val Ile Glu Ser Trp Pro Lys His Leu Arg Asn Lys

130 135 140

Ala Ser Gly Phe Leu Ile Ser Gly Phe Ser Val Gly Ala Val Val Ala

145 150 155 160

Ala Gln Val Tyr Ser Leu Val Val Pro Val Trp Gly Trp Arg Ala Leu

165 170 175

Phe Phe Ile Gly Ile Leu Pro Ile Ile Phe Ala Leu Trp Leu Arg Lys

180 185 190

Asn Ile Pro Glu Ala Glu Asp Trp Lys Glu Lys His Ala Gly Lys Ala

195 200 205

Pro Val Arg Thr Met Val Asp Ile Leu Tyr Arg Gly Glu His Arg Ile

210 215 220

Ala Asn Ile Val Met Thr Leu Ala Ala Ala Thr Ala Leu Trp Phe Cys

225 230 235 240

Phe Ala Gly Asn Leu Gln Asn Ala Ala Ile Val Ala Val Leu Gly Leu

245 250 255

Leu Cys Ala Ala Ile Phe Ile Ser Phe Met Val Gln Ser Ala Gly Lys

260 265 270

Arg Trp Pro Thr Gly Val Met Leu Met Val Val Val Leu Phe Ala Phe

275 280 285

Leu Tyr Ser Trp Pro Ile Gln Ala Leu Leu Pro Thr Tyr Leu Lys Thr

290 295 300

Asp Leu Ala Tyr Asn Pro His Thr Val Ala Asn Val Leu Phe Phe Ser

305 310 315 320

Gly Phe Gly Ala Ala Val Gly Cys Cys Val Gly Gly Phe Leu Gly Asp

325 330 335

Trp Leu Gly Thr Arg Lys Ala Tyr Val Cys Ser Leu Leu Ala Ser Gln

340 345 350

Leu Leu Ile Ile Pro Val Phe Ala Ile Gly Gly Ala Asn Val Trp Val

355 360 365

Leu Gly Leu Leu Leu Phe Phe Gln Gln Met Leu Gly Gln Gly Ile Ala

370 375 380

Gly Ile Leu Pro Lys Leu Ile Gly Gly Tyr Phe Asp Thr Asp Gln Arg

385 390 395 400

Ala Ala Gly Leu Gly Phe Thr Tyr Asn Val Gly Ala Leu Gly Gly Ala

405 410 415

Leu Ala Pro Ile Ile Gly Ala Leu Ile Ala Gln Arg Leu Asp Leu Gly

420 425 430

Thr Ala Leu Ala Ser Leu Ser Phe Ser Leu Thr Phe Val Val Ile Leu

435 440 445

Leu Ile Gly Leu Asp Met Pro Ser Arg Val Gln Arg Trp Leu Arg Pro

450 455 460

Glu Ala Leu Arg Thr His Asp Ala Ile Asp Gly Lys Pro Phe Ser Gly

465 470 475 480

Ala Val Pro Phe Gly Ser Ala Lys Asn Asp Leu Val Lys Thr Lys Ser

485 490 495

<210> 6

<211> 319

<212> DNA

<213>artificial sequence

<400> 6

tatgggaagt gctccgtaat acgctgacaa gagagaaagg gcttggaggt attgaaacaa 60

gaggagttct gagaattggt atgccttata agtccaatta acagttgaaa acctgcatag 120

gagagctatg cgggtttttt attttacata atgatacata atttaccgaa acttgcggaa 180

cataattgag gaatcataga attttgtcaa aataatttta ttgacaacgt cttattaacg 240

ttgatataat ttaaatttta tttgacaaaa atgggctcgt gttgtacaat ggtataacag 300

gtataaaggt atatcgttt 319

<210> 7

<211> 355

<212> DNA

<213>artificial sequence

<400> 7

tatgggaagt gctccgtaat acgctgacaa gagagaaagg gcttggaggt attgaaacaa 60

gaggagttct gagaattggt atgccttata agtccaatta acagttgaaa acctgcatag 120

gagagctatg cgggtttttt attttacata atgatacata atttaccgaa acttgcggaa 180

cataattgag gaatcataga attttgtcaa aataatttta ttgacaacgt cttattaacg 240

ttgatataat ttaaatttta tttgacaaaa atgggctcgt gttgtacaat ggtataacag 300

gtataaaggt atatcgtttt tgatctggta taacaggtat aaaggtatac acttt 355

<210> 8

<211> 238

<212> PRT

<213>artificial sequence

<400> 8

Met Gly Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val

1 5 10 15

Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu

20 25 30

Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys

35 40 45

Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu

50 55 60

Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Arg

65 70 75 80

His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg

85 90 95

Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val

100 105 110

Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile

115 120 125

Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn

130 135 140

Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly

145 150 155 160

Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val

165 170 175

Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro

180 185 190

Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser

195 200 205

Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val

210 215 220

Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys

225 230 235

<210> 9

<211> 1068

<212> DNA

<213>artificial sequence

<400> 9

gtatgtcatg atgcgtgaag gatcagtcgc caaaaacacg ctcaatgtgc tgccggcggt 60

gaatgaaaag aacgcacgcc ggttcttttt ctgtacggat gataagcatg tggatgattt 120

attgtcagag ggaagtgtaa accatcaggt gaaaatggcg attcaagccg gacttaatcc 180

gtttttagcc tatcagctag gaagcctcaa tgcagccgaa tgctacggat tagatacaaa 240

gggagcgatt gccccgggtt ttgacgctga tttgcttttt gtatctgatc tggaaaatgt 300

cactgtcaca atgacgatgg taaaagggca gactgttgct gaagacagca aagcggtcta 360

tcaggatcat gcttcaactg cagcaccaga tcaggcactg cttgattctg ttaagcttgc 420

tgctcctctt aacaaacagg attttcatat gccaatcgat tcagagcagc agatcaatgt 480

cattcaaatc ataccaaatc agcttgaaac acgattagta caagttccgg ctcctgttgc 540

ccgcgaattt gagcctgaca ctgagcttga tttgttaaag attgcagttg tcgagcggca 600

taaaggatta aaagaaaccg gacttggtgt tgtgaaaggt tttggattca agagcggagc 660

gattgccaca accatttcac acgactccca taatattatt gccgtcggaa cgaatgatga 720

ggatatcgcg gcggcagtta ataagctgca ggaaattggc ggaggattaa caattataaa 780

aaatggggaa gagctccatt cagtaccgct gccgattgca gggttattat ccgaccaatc 840

tgcagagcaa gtgaatcaaa gcttgctgac gcttcatgat aaattgtcgt taatcggttt 900

cacaggcgga tttaatccat ttttgacatt gtcgttttta gcgttgcctg tcattcctga 960

tattaaaatg acgactacgg gattattcga tgtaaaatca tttcaacaca tatcactgca 1020

ataaaaagag gcactccctt agggagtgcc tctttttgag cggataac 1068

<210> 10

<211> 1267

<212> DNA

<213>artificial sequence

<400> 10

gagcggataa caatttcaca caggaaacag ctatgaccat gattacgaat tcgagctcgg 60

tacccgggga tcctctagag attgtaccgt tcgtatagca tacattatac gaagttatcg 120

attttcgttc gtgaatacat gttataataa ctataactaa taacgtaacg tgactggcaa 180

gagatatttt taaaacaatg aataggttta cacttacttt agttttatgg aaatgaaaga 240

tcatatcata tataatctag aataaaatta actaaaataa ttattatcta gataaaaaat 300

ttagaagcca atgaaatcta taaataaact aaattaagtt tatttaatta acaactatgg 360

atataaaata ggtactaatc aaaatagtga ggaggatata tttgaataca tacgaacaag 420

ttaataaagt gaaaaaaata cttcggaaac atttaaaaaa taaccttatt ggtacttaca 480

tgtttggatc aggagttgag agtggactaa aaccaaatag tgatcttgac tttttagtcg 540

tcgtatctga accattgaca gatcaaagta aagaaatact tatacaaaaa attagaccta 600

tttcaaaaaa aataggagat aaaagcaact tacgatatat tgaattaaca attattattc 660

agcaagaaat ggtaccgtgg aatcatcctc ccaaacaaga atttatttat ggagaatggt 720

tacaagagct ttatgaacaa ggatacattc ctcagaagga attaaattca gatttaacca 780

taatgcttta ccaagcaaaa cgaaaaaata aaagaatata cggaaattat gacttagagg 840

aattactacc tgatattcca ttttctgatg tgagaagagc cattatggat tcgtcagagg 900

aattaataga taattatcag gatgatgaaa ccaactctat attaacttta tgccgtatga 960

ttttaactat ggacacgggt aaaatcatac caaaagatat tgcgggaaat gcagtggctg 1020

aatcttctcc attagaacat agggagagaa ttttgttagc agttcgtagt tatcttggag 1080

agaatattga atggactaat gaaaatgtaa atttaactat aaactattta aataacagat 1140

taaaaaaatt ataaataact tcgtatagca tacattatac gaacggtaga atcgtcgacc 1200

tgcaggcatg caagcttggc actggccgtc gttttacaac gtcgtgactg ggaaaaccct 1260

ggcgtta 1267

<210> 11

<211> 300

<212> DNA

<213>artificial sequence

<400> 11

tgataggtgg tatgttttcg cttgaacttt taaatacagc cattgaacat acggttgatt 60

taataactga caaacatcac cctcttgcta aagcggccaa ggacgccgcc gccggggctg 120

tttgcgttct tgccgtgatt tcgtgtacca ttggtttact tatttttttg ccaaggctgt 180

aatggctgaa aattcttaca tttattttac atttttagaa atgggcgtga aaaaaagcgc 240

gcgattatgt aaaatataaa gtgatagcgg taccattata ggtaagagag gaatgtacac 300

<210> 12

<211> 1491

<212> DNA

<213>artificial sequence

<400> 12

atgagtacta caacccagaa tatcccgtgg tatcgccatc tcaaccgtgc acaatggcgc 60

gcattttccg ctgcctggtt gggatatctg cttgacggtt ttgatttcgt tttaatcgcc 120

ctggtactca ccgaagtaca aggtgaattc gggctgacga cggtgcaggc ggcaagtctg 180

atctctgcag cctttatctc tcgctggttc ggcggcctga tgctcggcgc tatgggtgac 240

cgctacgggc gtcgtctggc aatggtcacc agcatcgttc tcttctcggc cgggacgctg 300

gcctgcggct ttgcgccagg ctacatcacc atgtttatcg ctcgtctggt catcggcatg 360

gggatggcgg gtgaatacgg ttccagcgcc acctatgtca ttgaaagctg gccaaaacat 420

ctgcgtaaca aagccagtgg ttttttgatt tcaggcttct ctgtgggggc cgtcgttgcc 480

gctcaggtct atagcctggt ggttccggtc tggggctggc gtgcgctgtt ctttatcggc 540

attttgccaa tcatctttgc tctctggctg cgtaaaaaca tcccggaagc ggaagactgg 600

aaagagaaac acgcaggtaa agcaccagta cgcacaatgg tggatattct ctaccgtggt 660

gaacatcgca ttgccaatat cgtaatgaca ctggcggcgg ctactgcgct gtggttctgc 720

ttcgccggta acctgcaaaa tgccgcgatc gtcgctgttc ttgggctgtt atgcgccgca 780

atctttatca gctttatggt gcagagtgca ggcaaacgct ggccaacggg cgtaatgctg 840

atggtggtcg tgttgtttgc tttcctctac tcatggccga ttcaggcgct gctgccaacg 900

tatctgaaaa ccgatctggc ttataacccg catactgtag ccaatgtgct gttctttagt 960

ggctttggcg cggcggtggg atgctgcgta ggtggcttcc tcggtgactg gctgggaacc 1020

cgcaaagcgt acgtttgtag cctgctggcc tcgcagctgc tgattattcc ggtatttgcg 1080

attggcggcg caaacgtctg ggtgctcggt ctgttactgt tcttccagca aatgcttgga 1140

caagggatcg ccgggatctt accaaaactg attggcggtt atttcgatac cgaccagcgt 1200

gcagcgggcc tgggctttac ctacaacgtt ggcgcattgg gcggtgcact ggccccaatc 1260

atcggcgcgt tgatcgctca acgtctggat ctgggtactg cgctggcatc gctctcgttc 1320

agtctgacgt tcgtggtgat cctgctgatt gggctggata tgccttctcg cgttcagcgt 1380

tggttgcgcc cggaagcgtt gcgtactcat gacgctatcg acggtaaacc attcagcggt 1440

gccgtgccgt ttggcagcgc caaaaacgat ttagtcaaaa ccaaaagtta a 1491

<210> 13

<211> 1081

<212> DNA

<213>artificial sequence

<400> 13

ggtgaactac tcggtcgtca accccattaa acctccataa tgatcggcag gatcattgga 60

cggcgctttg ttttttcgta caagaaaggt gcaagcgtgt ctgtaatttc gtttttgatt 120

tcagaccatt gagtcgtttt tcgttccatt actttttgta agtgatttga aatgagctct 180

tgagcgtcgt tgatcaagtc accagattct ctcatgtaca caaatcctct ggaaatcaaa 240

tcaggacccg ctgaaatctt gaagtcgtcc atgtcaatgc tgacaacaac gatgacaagt 300

ccttcttcag agagaattct gcgatcacga agtacgatat tgccaatatc accgataccg 360

cttccgtcaa tgtacactga accggacggg atttttcctg caactgaagc ctcatcgcct 420

ttaagtgcta atacttcacc attatccatg ataaagcagt tttcctctgg gatgccacaa 480

tctgttgcaa gtttgacatg catcttttgc attctgtact caccgtgaat cggcatgaag 540

aatttaggct tgattaaacg aagcatcagc ttctgttctt cctgtccgcc gtgaccggat 600

gtatggatat cgttaagagg gccgtgaata acctcagcac ccgcacgata cagctggttg 660

attgttcgac tcacgctgat tgtgttgcct gggatagggg atgaagaaaa tacgactgta 720

tccccaggat tgattgaaat ttggcggtgt gtgccgtttg caattcttga taacgccgcc 780

attggttccc cttggcttcc tgtacataaa attgttactt tattagcagg catacgattg 840

atttcgttat gctcaataaa cgtattttta ggacagttaa tataaccgag tgtctgtcca 900

atttcgatag ccgattccat actgcgtcca aatacggcaa cttttcttcc attttgtaca 960

gcagcttcaa ttacctgctg caagcggtga atattcgacg caaatgtggc gaagataatt 1020

cggccgtcca ccttgcggaa aatgtcatga atgctttctc ctacacggcg ctcagacatg 1080

g 1081

<210> 14

<211> 6420

<212> DNA

<213>artificial sequence

<400> 14

gaactataca aataattcac gtcacgcgtc catggagaga actatacaaa taattcacgt 60

cacgcgtcca tggagatctt tgtctgcaac tgaaaagttt ataccttacc tggaacaaat 120

ggttgaaaca tacgaggcta atatcggctt attaggaata gtccctgtac taataaaatc 180

aggtggatca gttgatcagt atattttgga cgaagctcgg aaagaatttg gagatgactt 240

gcttaattcc acaattaaat taagggaaag aataaagcga tttgatgttc aaggaatcac 300

ggaagaagat actcatgata aagaagctct aaaactattc aataacctta caatggaatt 360

gatcgaaagg gtggaaggtt aatggtacga aaattagggg atctacctag aaagccacaa 420

ggcgataggt caagcttaaa gaacccttac atggatctta cagattctga aagtaaagaa 480

acaacagagg ttaaacaaac agaaccaaaa agaaaaaaag cattgttgaa aacaatgaaa 540

gttgatgttt caatccataa taagattaaa tcgctgcacg aaattctggc agcatccgaa 600

gggaattcat attacttaga ggatactatt gagagagcta ttgataagat ggttgagaca 660

ttacctgaga gccaaaaaac tttttatgaa tatgaattaa aaaaaagaac caacaaaggc 720

tgagacagac tccaaacgag tctgtttttt taaaaaaaat attaggagca ttgaatatat 780

attagagaat taagaaagac atgggaataa aaatatttta aatccagtaa aaatatgata 840

agattatttc agaatatgaa gaactctgtt tgtttttgat gaaaaaacaa acaaaaaaaa 900

tccacctaac ggaatctcaa tttaactaac agcggccaaa ctgagaagtt aaatttgaga 960

aggggaaaag gcggatttat acttgtattt aactatctcc attttaacat tttattaaac 1020

cccatacaag tgaaaatcct cttttacact gttcctttag gtgatcgcgg agggacatta 1080

tgagtgaagt aaacctaaaa ggaaatacag atgaattagt gtattatcga cagcaaacca 1140

ctggaaataa aatcgccagg aagagaatca aaaaagggaa agaagaagtt tattatgttg 1200

ctgaaacgga agagaagata tggacagaag agcaaataaa aaacttttct ttagacaaat 1260

ttggtacgca tataccttac atagaaggtc attatacaat cttaaataat tacttctttg 1320

atttttgggg ctatttttta ggtgctgaag gaattgcgct ctatgctcac ctaactcgtt 1380

atgcatacgg cagcaaagac ttttgctttc ctagtctaca aacaatcgct aaaaaaatgg 1440

acaagactcc tgttacagtt agaggctact tgaaactgct tgaaaggtac ggttttattt 1500

ggaaggtaaa cgtccgtaat aaaaccaagg ataacacaga ggaatccccg atttttaaga 1560

ttagacgtaa ggttcctttg ctttcagaag aacttttaaa tggaaaccct aatattgaaa 1620

ttccagatga cgaggaagca catgtaaaga aggctttaaa aaaggaaaaa gagggtcttc 1680

caaaggtttt gaaaaaagag cacgatgaat ttgttaaaaa aatgatggat gagtcagaaa 1740

caattaatat tccagaggcc ttacaatatg acacaatgta tgaagatata ctcagtaaag 1800

gagaaattcg aaaagaaatc aaaaaacaaa tacctaatcc tacaacatct tttgagagta 1860

tatcaatgac aactgaagag gaaaaagtcg acagtacttt aaaaagcgaa atgcaaaatc 1920

gtgtctctaa gccttctttt gatacctggt ttaaaaacac taagatcaaa attgaaaata 1980

aaaattgttt attacttgta ccgagtgaat ttgcatttga atggattaag aaaagatatt 2040

tagaaacaat taaaacagtc cttgaagaag ctggatatgt tttcgaaaaa atcgaactaa 2100

gaaaagtgca ataaactgct gaagtatttc agcagttttt tttatttaga aatagtgaaa 2160

aaaatataat cagggaggta tcaatattta atgagtactg atttaaattt atttagactg 2220

gaattaataa ttaacacgta gactaattaa aatttaatga gggataaaga ggatacaaaa 2280

atattaattt caatccctat taaattttaa caaggggggg attaaaattt aattagaggt 2340

ttatccacaa gaaaagaccc taataaaatt tttactaggg ttataacact gattaatttc 2400

ttaatggggg agggattaaa atttaatgac aaagaaaaca atcttttaag aaaagctttt 2460

aaaagataat aataaaaaga gctttgcgat taagcaaaac tctttacttt ttcattgaca 2520

ttatcaaatt catcgatttc aaattgttgt tgtatcataa agttaattct gttttgcaca 2580

accttttcag gaatataaaa cacatctgag gcttgtttta taaactcagg gtcgctaaag 2640

tcaatgtaac gtagcatatg atatggtata gcttccaccc aagttagcct ttctgcttct 2700

tctgaatgtt tttcatatac ttccatgggt atctctaaat gattttcctc atgtagcaag 2760

gtatgagcaa aaagtttatg gaattgatag ttcctctctt tttcttcaac ttttttatct 2820

aaaacaaaca ctttaacatc tgagtcaatg taagcataag atgtttttcc agtcataatt 2880

tcaatcccaa atcttttaga cagaaattct ggacgtaaat cttttggtga aagaattttt 2940

ttatgtagca atatatccga tacagcacct tctaaaagcg ttggtgaata gggcatttta 3000

cctatctcct ctcattttgt ggaataaaaa tagtcatatt cgtccatcta cctatcctat 3060

tatcgaacag ttgaactttt taatcaagga tcagtccttt ttttcattat tcttaaactg 3120

tgctcttaac tttaacaact cgatttgttt ttccagatct cgagggtaac tagcctcgcc 3180

gatcccgcaa gaggcccggc agtcaggtgg cacttttcgg ggaaatgtgc gcggaacccc 3240

tatttgttta tttttctaaa tacattcaaa tatgtatccg ctcatgagac aataaccctg 3300

ataaatgctt caataatatt gaaaaaggaa gagtatgagt attcaacatt tccgtgtcgc 3360

ccttattccc ttttttgcgg cattttgcct tcctgttttt gctcacccag aaacgctggt 3420

gaaagtaaaa gatgctgaag atcagttggg tgcacgagtg ggttacatcg aactggatct 3480

caacagcggt aagatccttg agagttttcg ccccgaagaa cgttttccaa tgatgagcac 3540

ttttaaagtt ctgctatgtg gcgcggtatt atcccgtatt gacgccgggc aagagcaact 3600

cggtcgccgc atacactatt ctcagaatga cttggttgag tactcaccag tcacagaaaa 3660

gcatcttacg gatggcatga cagtaagaga attatgcagt gctgccataa ccatgagtga 3720

taacactgcg gccaacttac ttctgacaac gatcggagga ccgaaggagc taaccgcttt 3780

tttgcacaac atgggggatc atgtaactcg ccttgatcgt tgggaaccgg agctgaatga 3840

agccatacca aacgacgagc gtgacaccac gatgcctgta gcaatggcaa caacgttgcg 3900

caaactatta actggcgaac tacttactct agcttcccgg caacaattaa tagactggat 3960

ggaggcggat aaagttgcag gaccacttct gcgctcggcc cttccggctg gctggtttat 4020

tgctgataaa tctggagccg gtgagcgtgg gtctcgcggt atcattgcag cactggggcc 4080

agatggtaag ccctcccgta tcgtagttat ctacacgacg gggagtcagg caactatgga 4140

tgaacgaaat agacagatcg ctgagatagg tgcctcactg attaagcatt ggtaactgtc 4200

agaccaagtt tactcatata tactttagat tgatttaaaa cttcattttt aatttaaaag 4260

gatctaggtg aagatccttt ttgataatct catgaccaaa atcccttaac gtgagttttc 4320

gttccactga gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag atcctttttt 4380

tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt 4440

gccggatcaa gagctaccaa ctctttttcc gaaggtaact ggcttcagca gagcgcagat 4500

accaaatact gtccttctag tgtagccgta gttaggccac cacttcaaga actctgtagc 4560

accgcctaca tacctcgctc tgctaatcct gttaccagtg gctgctgcca gtggcgataa 4620

gtcgtgtctt accgggttgg actcaagacg atagttaccg gataaggcgc agcggtcggg 4680

ctgaacgggg ggttcgtgca cacagcccag cttggagcga acgacctaca ccgaactgag 4740

atacctacag cgtgagctat gagaaagcgc cacgcttccc gaagggagaa aggcggacag 4800

gtatccggta agcggcaggg tcggaacagg agagcgcacg agggagcttc cagggggaaa 4860

cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt 4920

gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg cctttttacg 4980

gttcctggcc ttttgctggc cttttgctca catgttcttt cctgcgttat cccctgattc 5040

tgtggataac cgtattaccg cctttgagtg agctgatacc gctcgccgca gccgaacgac 5100

cgagcgcagc gagtcagtga gcgaggaagc ggaagagcgc ccaatacgca tgcttaagtt 5160

attggtatga ctggttttaa gcgcaaaaaa agttgctttt tcgtacctat taatgtatcg 5220

ttttagaaaa ccgactgtaa aaagtacagt cggcattatc tcatattata aaagccagtc 5280

attaggccta tctgacaatt cctgaataga gttcataaac aatcctgcat gataaccatc 5340

acaaacagaa tgatgtacct gtaaagatag cggtaaatat attgaattac ctttattaat 5400

gaattttcct gctgtaataa tgggtagaag gtaattacta ttattattga tatttaagtt 5460

aaacccagta aatgaagtcc atggaataat agaaagagaa aaagcatttt caggtatagg 5520

tgttttggga aacaatttcc ccgaaccatt atatttctct acatcagaaa ggtataaatc 5580

ataaaactct ttgaagtcat tctttacagg agtccaaata ccagagaatg ttttagatac 5640

accatcaaaa attgtataaa gtggctctaa cttatcccaa taacctaact ctccgtcgct 5700

attgtaacca gttctaaaag ctgtatttga gtttatcacc cttgtcacta agaaaataaa 5760

tgcagggtaa aatttatatc cttcttgttt tatgtttcgg tataaaacac taatatcaat 5820

ttctgtggtt atactaaaag tcgtttgttg gttcaaataa tgattaaata tctcttttct 5880

cttccaattg tctaaatcaa ttttattaaa gttcatttga tatgcctcct aaatttttat 5940

ctaaagtgaa tttaggaggc ttacttgtct gctttcttca ttagaatcaa tcctttttta 6000

aaagtcaata ttactgtaac ataaatatat attttaaaaa tatcccactt tatccaattt 6060

tcgtttgttg aactaatggg tgctttagtt gaagaataaa agaccacatt aaaaaatgtg 6120

gtcttttgtg tttttttaaa ggatttgagc gtagcgaaaa atccttttct ttcttatctt 6180

gataataagg gtaactattg ccgatcgtcc attccgacag catcgccagt cactatggcg 6240

tgctgctagc gccattcgcc attcaggctg cgcaactgtt gggaagggcg atcggtgcgg 6300

gcctcttcgc tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg attaagttgg 6360

gtaacgccag ggttttccca gtcacgacgt tgtaaaacga cggccagtga attcgagctc 6420

<210> 15

<211> 8261

<212> DNA

<213>artificial sequence

<400> 15

cccgctttct tgataatatg ggaagtgctc cgtaatacgc tgacaagaga gaaagggctt 60

ggaggtattg aaacaagagg agttctgaga attggtatgc cttataagtc caattaacag 120

ttgaaaacct gcataggaga gctatgcggg ttttttattt tacataatga tacataattt 180

accgaaactt gcggaacata attgaggaat catagaattt tgtcaaaata attttattga 240

caacgtctta ttaacgttga tataatttaa attttatttg acaaaaatgg gctcgtgttg 300

tacaatggta taacaggtat aaaggtatat cgtttaaagg aggtgaaatg tacacatggg 360

taagggagaa gaacttttca ctggagttgt cccaattctt gttgaattag atggtgatgt 420

taatgggcac aaattttctg tcagtggaga gggtgaaggt gatgcaacat acggaaaact 480

tacccttaaa tttatttgca ctactggaaa gcttcctgtt ccttggccaa cacttgtcac 540

tactcttact tatggtgttc aatgcttttc aagataccca gatcatatga agcggcacga 600

cttcttcaag agcgccatgc ctgagggata cgtgcaggag aggaccatct tcttcaagga 660

cgacgggaac tacaagacac gtgctgaagt caagtttgag ggagacaccc tcgtcaacag 720

aatcgagctt aagggaatcg atttcaagga ggacggaaac atcctcggcc acaagttgga 780

atacaactac aactcccaca acgtatacat catggcagac aaacaaaaga atggaatcaa 840

agttaacttc aaaattagac acaacattga agatggaagc gttcaactag cagaccatta 900

tcaacaaaat actccaattg gcgatggccc tgtcctttta ccagacaacc attacctgtc 960

cacacaatct gccctttcga aagatcccaa cgaaaagaga gaccacatgg tccttcttga 1020

gtttgtaaca gctgctggga ttacacatgg catggatgaa ctatacaaat aattcacgtc 1080

acgcgtccat ggagatcttt gtctgcaact gaaaagttta taccttacct ggaacaaatg 1140

gttgaaacat acgaggctaa tatcggctta ttaggaatag tccctgtact aataaaatca 1200

ggtggatcag ttgatcagta tattttggac gaagctcgga aagaatttgg agatgacttg 1260

cttaattcca caattaaatt aagggaaaga ataaagcgat ttgatgttca aggaatcacg 1320

gaagaagata ctcatgataa agaagctcta aaactattca ataaccttac aatggaattg 1380

atcgaaaggg tggaaggtta atggtacgaa aattagggga tctacctaga aagccacaag 1440

gcgataggtc aagcttaaag aacccttaca tggatcttac agattctgaa agtaaagaaa 1500

caacagaggt taaacaaaca gaaccaaaaa gaaaaaaagc attgttgaaa acaatgaaag 1560

ttgatgtttc aatccataat aagattaaat cgctgcacga aattctggca gcatccgaag 1620

ggaattcata ttacttagag gatactattg agagagctat tgataagatg gttgagacat 1680

tacctgagag ccaaaaaact ttttatgaat atgaattaaa aaaaagaacc aacaaaggct 1740

gagacagact ccaaacgagt ctgttttttt aaaaaaaata ttaggagcat tgaatatata 1800

ttagagaatt aagaaagaca tgggaataaa aatattttaa atccagtaaa aatatgataa 1860

gattatttca gaatatgaag aactctgttt gtttttgatg aaaaaacaaa caaaaaaaat 1920

ccacctaacg gaatctcaat ttaactaaca gcggccaaac tgagaagtta aatttgagaa 1980

ggggaaaagg cggatttata cttgtattta actatctcca ttttaacatt ttattaaacc 2040

ccatacaagt gaaaatcctc ttttacactg ttcctttagg tgatcgcgga gggacattat 2100

gagtgaagta aacctaaaag gaaatacaga tgaattagtg tattatcgac agcaaaccac 2160

tggaaataaa atcgccagga agagaatcaa aaaagggaaa gaagaagttt attatgttgc 2220

tgaaacggaa gagaagatat ggacagaaga gcaaataaaa aacttttctt tagacaaatt 2280

tggtacgcat ataccttaca tagaaggtca ttatacaatc ttaaataatt acttctttga 2340

tttttggggc tattttttag gtgctgaagg aattgcgctc tatgctcacc taactcgtta 2400

tgcatacggc agcaaagact tttgctttcc tagtctacaa acaatcgcta aaaaaatgga 2460

caagactcct gttacagtta gaggctactt gaaactgctt gaaaggtacg gttttatttg 2520

gaaggtaaac gtccgtaata aaaccaagga taacacagag gaatccccga tttttaagat 2580

tagacgtaag gttcctttgc tttcagaaga acttttaaat ggaaacccta atattgaaat 2640

tccagatgac gaggaagcac atgtaaagaa ggctttaaaa aaggaaaaag agggtcttcc 2700

aaaggttttg aaaaaagagc acgatgaatt tgttaaaaaa atgatggatg agtcagaaac 2760

aattaatatt ccagaggcct tacaatatga cacaatgtat gaagatatac tcagtaaagg 2820

agaaattcga aaagaaatca aaaaacaaat acctaatcct acaacatctt ttgagagtat 2880

atcaatgaca actgaagagg aaaaagtcga cagtacttta aaaagcgaaa tgcaaaatcg 2940

tgtctctaag ccttcttttg atacctggtt taaaaacact aagatcaaaa ttgaaaataa 3000

aaattgttta ttacttgtac cgagtgaatt tgcatttgaa tggattaaga aaagatattt 3060

agaaacaatt aaaacagtcc ttgaagaagc tggatatgtt ttcgaaaaaa tcgaactaag 3120

aaaagtgcaa taaactgctg aagtatttca gcagtttttt ttatttagaa atagtgaaaa 3180

aaatataatc agggaggtat caatatttaa tgagtactga tttaaattta tttagactgg 3240

aattaataat taacacgtag actaattaaa atttaatgag ggataaagag gatacaaaaa 3300

tattaatttc aatccctatt aaattttaac aaggggggga ttaaaattta attagaggtt 3360

tatccacaag aaaagaccct aataaaattt ttactagggt tataacactg attaatttct 3420

taatggggga gggattaaaa tttaatgaca aagaaaacaa tcttttaaga aaagctttta 3480

aaagataata ataaaaagag ctttgcgatt aagcaaaact ctttactttt tcattgacat 3540

tatcaaattc atcgatttca aattgttgtt gtatcataaa gttaattctg ttttgcacaa 3600

ccttttcagg aatataaaac acatctgagg cttgttttat aaactcaggg tcgctaaagt 3660

caatgtaacg tagcatatga tatggtatag cttccaccca agttagcctt tctgcttctt 3720

ctgaatgttt ttcatatact tccatgggta tctctaaatg attttcctca tgtagcaagg 3780

tatgagcaaa aagtttatgg aattgatagt tcctctcttt ttcttcaact tttttatcta 3840

aaacaaacac tttaacatct gagtcaatgt aagcataaga tgtttttcca gtcataattt 3900

caatcccaaa tcttttagac agaaattctg gacgtaaatc ttttggtgaa agaatttttt 3960

tatgtagcaa tatatccgat acagcacctt ctaaaagcgt tggtgaatag ggcattttac 4020

ctatctcctc tcattttgtg gaataaaaat agtcatattc gtccatctac ctatcctatt 4080

atcgaacagt tgaacttttt aatcaaggat cagtcctttt tttcattatt cttaaactgt 4140

gctcttaact ttaacaactc gatttgtttt tccagatctc gagggtaact agcctcgccg 4200

atcccgcaag aggcccggca gtcaggtggc acttttcggg gaaatgtgcg cggaacccct 4260

atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga 4320

taaatgcttc aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc 4380

cttattccct tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg 4440

aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc 4500

aacagcggta agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact 4560

tttaaagttc tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc 4620

ggtcgccgca tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag 4680

catcttacgg atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat 4740

aacactgcgg ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt 4800

ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa 4860

gccataccaa acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc 4920

aaactattaa ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg 4980

gaggcggata aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt 5040

gctgataaat ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca 5100

gatggtaagc cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat 5160

gaacgaaata gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca 5220

gaccaagttt actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg 5280

atctaggtga agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg 5340

ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt 5400

ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg 5460

ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata 5520

ccaaatactg tccttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca 5580

ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag 5640

tcgtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc 5700

tgaacggggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga 5760

tacctacagc gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg 5820

tatccggtaa gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac 5880

gcctggtatc tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg 5940

tgatgctcgt caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg 6000

ttcctggcct tttgctggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct 6060

gtggataacc gtattaccgc ctttgagtga gctgataccg ctcgccgcag ccgaacgacc 6120

gagcgcagcg agtcagtgag cgaggaagcg gaagagcgcc caatacgcat gcttaagtta 6180

ttggtatgac tggttttaag cgcaaaaaaa gttgcttttt cgtacctatt aatgtatcgt 6240

tttagaaaac cgactgtaaa aagtacagtc ggcattatct catattataa aagccagtca 6300

ttaggcctat ctgacaattc ctgaatagag ttcataaaca atcctgcatg ataaccatca 6360

caaacagaat gatgtacctg taaagatagc ggtaaatata ttgaattacc tttattaatg 6420

aattttcctg ctgtaataat gggtagaagg taattactat tattattgat atttaagtta 6480

aacccagtaa atgaagtcca tggaataata gaaagagaaa aagcattttc aggtataggt 6540

gttttgggaa acaatttccc cgaaccatta tatttctcta catcagaaag gtataaatca 6600

taaaactctt tgaagtcatt ctttacagga gtccaaatac cagagaatgt tttagataca 6660

ccatcaaaaa ttgtataaag tggctctaac ttatcccaat aacctaactc tccgtcgcta 6720

ttgtaaccag ttctaaaagc tgtatttgag tttatcaccc ttgtcactaa gaaaataaat 6780

gcagggtaaa atttatatcc ttcttgtttt atgtttcggt ataaaacact aatatcaatt 6840

tctgtggtta tactaaaagt cgtttgttgg ttcaaataat gattaaatat ctcttttctc 6900

ttccaattgt ctaaatcaat tttattaaag ttcatttgat atgcctccta aatttttatc 6960

taaagtgaat ttaggaggct tacttgtctg ctttcttcat tagaatcaat ccttttttaa 7020

aagtcaatat tactgtaaca taaatatata ttttaaaaat atcccacttt atccaatttt 7080

cgtttgttga actaatgggt gctttagttg aagaataaaa gaccacatta aaaaatgtgg 7140

tcttttgtgt ttttttaaag gatttgagcg tagcgaaaaa tccttttctt tcttatcttg 7200

ataataaggg taactattgc cgatcgtcca ttccgacagc atcgccagtc actatggcgt 7260

gctgctagcg ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg 7320

cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg 7380

taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgaa ttcgagctct 7440

tatttctttt tgttggtggt ctgaccgaaa gcgtgccagg tagcagagac gctgttgaga 7500

tgcgattgca acgcacgatc ggcttcgtca ggatcatgac ggcggatcgc atcaacgatc 7560

gcaatatgct gttgataact aacgttgtta tgttcgtgca gtgcctgatc ggtaaccgtt 7620

gggcgtgcgg caataagcca gtcgagcagg gcaacgtgga tcgccatgaa gattgggtta 7680

ccggggatct ccgccagcac gcggtggaaa tcaacgtctg aacgaatgaa tgccgcgttg 7740

ttatccagcg actgactgtt gatttccagt gcttttgcca gcaaatcgat ttgctcatcg 7800

gtggcatgtt cagccgcata gcgcaccaga ctggattcaa agaacagacg taattgttcg 7860

aaatgggcaa tcccaccggg atgagaaagg aaatctttcg ccatgccgga aagctcaccg 7920

atgatagtgt ccgcagaagg acgcgagacg cgagcgcgtt cgccgttgtt tatttgcacc 7980

agacctttgc gttttaacgc tgccagcgct tcacgcaccg aaggacgccc gacgttaaag 8040

aacgccatca gttcgcgttc agacggtaat tgttcacctt cgccaaattc acgacggcgg 8100

atcatctgtt ccagctcttc ttccaccatt tcggagagtt ttttacgcgc cagcgggcgg 8160

ctacgcaagt tgcgaccaat tgcaggtgaa gaatcttcgg tttgcgaatc aaatgcgttc 8220

ataaggccca tgtgtacatt tcacctcctt tgtttttacg t 8261

Claims

1. a kind of inducing expression element for responding sialic acid；It is characterized in that, containing (a) or (b)；

(a) constitutive promoter P_ydjO, transcriptional regulation protein NanR, the composition for being integrated with transcriptional regulation protein NanR binding sequence Type promoter P_veg, the composing type P_ydjOPromoter expresses transcriptional regulation protein NanR；The promoter P_ydjOAnd P_vegTranscription side To opposite；

(b) constitutive promoter P_hbs, transcriptional regulation protein NanR, the composition for being integrated with transcriptional regulation protein NanR binding sequence Type promoter P_veg, the composing type P_ydjOPromoter expresses transcriptional regulation protein NanR；The promoter P_ydjOAnd P_vegTranscription side To opposite.

2. inducing expression element according to claim 1, which is characterized in that the constitutive promoter P_vegIntegration 2 is copied The transcriptional regulation protein NanR binding sequence of shellfish.

3. inducing expression element according to claim 1 or 2, which is characterized in that the nucleotide of NanR binding site sequence Sequence is as shown in SEQ NO.3.

4. any inducing expression element according to claim 1~3, which is characterized in that also contain sialic acid transport protein NanT, amino acid sequence is as shown in SEQ NO.5.

5. inducing expression element according to any one of claims 1 to 4, which is characterized in that also contain marker；The label Object passes through promoter P_vegRegulating and expressing.

6. the plasmid containing any inducing expression element of Claims 1 to 5.

7. a kind of genetic engineering bacterium, which is characterized in that it with bacillus subtilis is host, it is any described containing Claims 1 to 4 Inducing expression element.

8. any inducing expression element of Claims 1 to 5 is in the application in bacillus subtilis metabolic engineering field.

9. application according to claim 8, which is characterized in that activating genes of interest in the culture environment existing for sialic acid Expression.

10. application according to claim 9, which is characterized in that be at 30~37 DEG C, 180~250rpm is cultivated at least 24h。