CN110029109A - A kind of sialic acid inducing expression element and application - Google Patents
A kind of sialic acid inducing expression element and application Download PDFInfo
- Publication number
- CN110029109A CN110029109A CN201910358479.9A CN201910358479A CN110029109A CN 110029109 A CN110029109 A CN 110029109A CN 201910358479 A CN201910358479 A CN 201910358479A CN 110029109 A CN110029109 A CN 110029109A
- Authority
- CN
- China
- Prior art keywords
- promoter
- veg
- leu
- sialic acid
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a kind of sialic acid inducing expression element and applications, belong to field of genetic engineering.The present invention is using pHT plasmid as carrier, in bacillus subtilis, PydjOPromoter expresses transcriptional regulation protein NanR, optimizes and combines the strong promoter P of NanR identification binding sequenceveg, realize the leakage expression of extremely low level in the environment of containing sialic acid of bacillus subtilis (Bacillus subtilis) 168, leakage expression rate can be made to be reduced to 2% or so, be with a wide range of applications.
Description
Technical field
The present invention relates to a kind of sialic acid inducing expression element and applications, belong to field of genetic engineering.
Background technique
In bacillus subtilis, it can induce the promoter element of activation expression, be widely used in metabolic engineering field.Mesh
Before, common evoked promoter in bacillus subtilis has xylose evoked promoter PxylWith IPTG evoked promoter Pgrac.So
And xylose evoked promoter PxylInducer xylose can be by bacillus subtilis metabolic exhaustion, IPTG evoked promoter Pgrac's
There is certain toxicity to cell in inducer IPTG.Especially, there are higher leakages for xylose and IPTG evoked promoter
Problem.Disadvantages described above seriously limits it in the application in bacillus subtilis metabolic engineering field.Sialic acid is as a kind of simple
Carbon source, and to cytotoxic, and will not be a kind of suitable inducer by bacillus subtilis metabolic exhaustion.Pass through gene work
Promoter is transformed in journey, can obtain the response element for being more appropriate to bacillus subtilis based on sialic acid induction.However, how
Promoter is transformed, to reduce the problem of its leakage expression is a worth further investigation.In addition, bacillus subtilis lacks saliva
The natural transporting pathway of acid cannot transport extracellular sialic acid to intracellular, and which also limits sialic acid inducing expression elements in withered grass bud
The application in spore bacillus metabolic engineering field.
Summary of the invention
In order to solve the above technical problems, inducing expression promoter element of the building in response to sialic acid, the present invention is to form
Type promoter PydjOOr strong promoter PhbsTranscriptional regulation protein NanR is expressed, further by constitutive promoter PvegIn,
Transcriptional regulation protein NanR binding sequence TTNANNTGGTATAACAGGTATANAGNTANNNNNTNN is integrated, realizes addition saliva
After acid, inducing expression of the Expression element in bacillus subtilis BSNanT.Further pass through replacement NanR promoter PydjOFor
Strong promoter Phbs, in PvegThe NanR binding sequence of a copy is further increased in promoter, realizes sialic acid response element
The extremely low leakage expression quantity in asialo addition.
The first purpose of the invention is to provide a kind of inducing expression promoter elements for responding sialic acid;Containing (a) or
(b);
(a) constitutive promoter PydjO, transcriptional regulation protein NanR, constitutive promoter Pveg, transcriptional regulation protein NanR
Binding sequence, the composing type PydjOPromoter expresses transcriptional regulation protein NanR;The constitutive promoter PvegIt is integrated with and turns
Record modulin NanR binding sequence;The promoter PydjOAnd PvegOpposite direction connection;
(b) constitutive promoter Phbs, transcriptional regulation protein NanR, constitutive promoter Pveg, two copies transcription tune
Control albumen NanR binding sequence, the composing type PydjOPromoter expresses transcriptional regulation protein NanR;The constitutive promoter
PvegIntegrate transcriptional regulation protein NanR binding sequence;The promoter PydjOAnd PvegOpposite direction connection.
In one embodiment of the invention, the composing type PydjOThe nucleotide sequence of promoter such as SEQ ID
Shown in NO.1.
In one embodiment of the invention, transcriptional regulation protein PhbsThe nucleotide sequence of promoter such as SEQ NO.2
It is shown.
In one embodiment of the invention, the nucleotide sequence of NanR binding site sequence is as shown in SEQ NO.3.
In one embodiment of the invention, transcriptional regulation protein NanR amino acid sequence is as shown in SEQ NO.4.
In one embodiment of the invention, sialic acid transport protein NanT amino acid sequence is as shown in SEQ NO.5.
In one embodiment of the invention, the P of NanR binding site sequence is integratedvegPromoter base sequence such as SEQ
Shown in NO.6.
In one embodiment of the invention, the P of 2 NanR binding site sequences is integratedvegPromoter base sequence is such as
Shown in SEQ NO.7.
In one embodiment of the invention, the plasmid tool of the inducing expression promoter for constructing sialic acid is matter
Grain pHT01.
In one embodiment of the invention, the PvegPromoter also regulates and controls the expression of marker.
In one embodiment of the invention, the marker is fluorescin.
In one embodiment of the invention, the marker is green fluorescent protein, amino acid sequence such as SEQ
Shown in NO.8
In one embodiment of the invention, the inducing expression promoter element building is on pHT01 plasmid.
A second object of the present invention is to provide a kind of methods for constructing the inducing expression element plasmid, including walk as follows
It is rapid:
1) building genome recombination integrates NanT segment:
By fusion DNA vaccine, the saliva acid transporter enzyme coding gene NanT of source Escherichia coli is inserted into bacillus subtilis
After 168 genome adeC genes, 1000bp is left homology arm before adeC gene end codon TAA, and 1000 be the right side later
Homology arm, zeocin resistant gene and P43Promoter gene and NanT genetic fragment amount to 5 genetic fragment fusions, obtain
NanT recombinant fragment;
2) Transshipment Permitted sialic acid recombined bacillus subtilis is constructed:
By above-mentioned steps 1) in recombinant fragment recombination to bacillus subtilis (Bacillus subtilis) 168 genomes
On, recombined bacillus subtilis engineering bacteria is obtained, BSNanT is named as;
3) sialic acid response element tool plasmid pHT-ydjO-veg plasmid is constructed:
Clone transcriptional regulation protein encoding gene NanR genetic fragment, PydjOPromoter gene segment, PvegGenetic fragment and
GFP genetic fragment and pHT plasmid fragments, totally 5 segments by NEB Gibson Assembly Master Mix Kit into
Row assembling, constructs sialic acid response element tool plasmid pHT-ydjO-veg plasmid.
4) sialic acid inducing expression element bacillus subtilis BSNanT-pHT-ydjO-veg is constructed
By above-mentioned steps 3) in sialic acid response element tool plasmid pHT-ydjO-veg plasmid, conversion is to above-mentioned steps 2)
Engineered strain BSNanT in, obtain recombined bacillus subtilis engineering bacteria, be named as BSNanT-pHT-ydjO-veg.
5) building optimization sialic acid response element tool plasmid pHT-hbs-veg plasmid
Using bacillus subtilis (Bacillus subtilis 168) genome as template, strong promoter P is expandedhbsGene
Segment, to replace PydjOPromoter, to improve transcriptional regulation protein NanR expression quantity;Using pHT-ydjO-veg plasmid as template
Plasmid backbone genetic fragment, totally 2 segments, are assembled, structure by NEB Gibson Assembly Master Mix Kit
Build sialic acid induction expression plasmid pHT-hbs-veg plasmid.
6) building optimization sialic acid inducing expression element bacillus subtilis BSNanT-pHT-hbs-veg
By above-mentioned steps 5) in sialic acid response element tool plasmid pHT-hbs-veg plasmid, conversion is to above-mentioned steps 2)
Engineered strain BSNanT in, obtain recombined bacillus subtilis engineering bacteria, be named as BSNanT-pHT-hbs-veg.
7) building optimization sialic acid inducing expression element plasmid pHT-hbs-veg-2
Using pHT-hbs-veg plasmid as template, by increasing a NanR binding sequence on primer, building sialic acid is lured
Lead expression plasmid pHT-hbs-veg-2 plasmid.
8) building optimization sialic acid inducing expression element bacillus subtilis BSNanT-pHT-hbs-veg-2
By above-mentioned steps 7) in sialic acid response element tool plasmid pHT-hbs-veg-2 plasmid, conversion is to above-mentioned steps
2) in engineered strain BSNanT, recombined bacillus subtilis engineering bacteria is obtained, BSNanT-pHT-hbs-veg-2 is named as.
Third mesh of the invention is to provide the genetic engineering bacterium containing the sialic acid inducing expression element.
In one embodiment of the invention, the genetic engineering bacterium is host with bacillus subtilis.
Fourth object of the present invention is to provide the sialic acid inducing expression element plasmid and is metabolized in bacillus subtilis
The application of engineering field.
In one embodiment of the invention, the application includes but is not limited under activating under sialic acid existence condition
Swim the expression of target gene.
In one embodiment of the invention, the induction is in 30~37 DEG C and 220rpm, in the fermentation medium
Under conditions of culture 48h.
The utility model has the advantages that
(1) present invention is by by transcriptional regulation protein NanR binding site sequence TTNANNTGGTATAACAGGTATANAG
NTANNNNNTNN is integrated into composition type expression promoter PvegIn, obtain sialic acid inducing expression promoter element pHT-
ydjO-veg。
(2) sialic acid inducing expression promoter element provided by the invention, in bacillus subtilis, pHT-ydjO-
Veg activation expression intensity reaches 4000a.u..Sialic acid inducing expression promoter element letting out under asialo existence condition
Leaking expression is only 10% or so.
(3) by by NanR promoter PydjOFor strong promoter Phbs, obtain sialic acid inducing expression promoter element pHT-
Hbs-veg, activation expression intensity are 3900a.u..Leakage expression under asialo existence condition is reduced from 10%
To 6%.
(4) by PvegA NanR binding sequence is further increased in promoter, obtains the starting of sialic acid inducing expression
Subcomponent pHT-hbs-veg-2, activation expression intensity are 3700a.u..Water is expressed in leakage under asialo existence condition
It is flat, further 2% is reduced to from 6%.For further by genetic engineering, transformed bacillus bacillus sialic acid inducing expression is opened
Mover is laid a good foundation.Optimization sialic acid inducing expression promoter construction method provided by the invention is simple, is easy to use, has
Good metabolic engineering application prospect.
Specific embodiment
The bacillus subtilis condition of culture of the promoter element of inducing expression containing sialic acid:
Fermentation medium (g/L): sialic acid 5, tryptone 6, yeast powder 12, ammonium sulfate 6, dipotassium hydrogen phosphate 12.5, phosphorus
Acid dihydride potassium 2.5, magnesium sulfate 3.
Condition of culture: 37 DEG C, 200rpm, under the conditions of cultivate 48h.
Green fluorescent protein and cell concentration detection method:
Tecan microplate reader: green fluorescent protein detection, excitation wavelength 490nm, launch wavelength 530nm, gain 60.Thallus
Concentration Testing wavelength is 600nm.
Reveal expression quantity calculation formula (%): x=(a-b)/c
Wherein, a is sialic acid induction director's element, and the fluorescence intensity when being not added with sialic acid, b is bacillus subtilis
Fluorescence intensity of 168 bacterial strains as control strain, c are fluorescence intensity of the sialic acid induction director's element when adding sialic acid.
Embodiment 1 constructs genome recombination and integrates NanT segment
Design primer L-F:5 '-GTATGTCATGATGCGTGAAGGATCAGTCGCCAAAAACACGC-3 ' and L-R:5 '-
GTTATCCGCTCAAAAAGAGGCACTCCCTAAGGGAGTGCCTCTTTTTATTGCAGTG- 3 ', with bacillus subtilis 168
Genome is template, expands the left arm gene order of NanT transport protein recombinant fragment shown in SEQ ID NO.9;Design primer S-
F:5 '-CCTTAGGGAGTGCCTCTTTTTGAGCGGATAACAATTTCACACAGGAAACAG-3 ' and S-R:5 '-CACCTATC
ATAACGCCAGGGTTTTCCCAGTCACGAC-3 ', using P7S6 plasmid as template (be disclosed in Zhang, X., Liu, Y., Liu,
L.,Wang,M.,Li,J.,Du,G.et al.,2018.Modular pathway engineering of key carbon-
precursor supply-pathways for improved N-acetylneuraminic acid production in
Bacillus subtilis.Biotechnol.Bioeng.115, in 2217-31), amplification NanT transport protein recombinant fragment
Spectinomycin resistance left arm gene order SEQ ID NO.10;Design primer P-F:5 '-GACTGGGAAAACCCTGGCGTTATG
ATAGGTGGTATGTTTTCGCTTGAACTTTTA-3 ' and P-R:5 '-GGATATTCTGGGTTGTAGTACTCATGTGTACATT
CCTCTCTTACCTATAATGGTACCGC-3 ' expands NanT transport protein recombinant fragment with 168 templates of bacillus subtilis
P43Promoter gene sequence SEQ ID NO.11;Design primer N-F:5 '-TAGGTAAGAGAGGAATGTACACATGAGTAC
TACAACCCAGAATATCCCGTGGTATCGCCATCTCAACCG-3 ' and N-R:5 '-GGGGTTGACGACCGAGTAGTTCACC
TTAACTTTTGGTTTTGACTAAATCGTTTTTGGCGCTGCCAAACGGCACG-3 ', using e. coli k12 genome as mould
Plate expands the saliva acid transporter enzyme NanT gene order of NanT transport protein recombinant fragment shown in SEQ ID NO.12;Design
Primer R-F:5 '-TTAAGGTGAACTACTCGGTCGTCAACCCCATTAAACCTCCATAATGATCGGCAGGA TCATTGGAC
GGCGCTTTG-3 ' and R-R:5 '-CCATGTCTGAGCGCCGTGTAGGAGAAAGCATTCATGACATTTTCCG-3 ', with withered grass
168 genome of bacillus is template, expands recombinant fragment right arm gene order SEQ ID NO.13;By above 5 gene pieces
Section (SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12 and SEQ ID NO.13) passes through fusion
Round pcr is built into genome conformity expression NanT genetic fragment, is named as LSPNR.
The building of 2 Transshipment Permitted sialic acid recombined bacillus subtilis of embodiment
Recombination and integration NanT genetic fragment LSPNR is converted to bacillus subtilis (Bacillus subtilis) 168,
It recombinates on genome, obtains recombined bacillus subtilis engineering bacteria, be named as BSNanT.
Embodiment 3 constructs sialic acid response element tool plasmid pHT-ydjO-veg plasmid
Design primer N-1F:5-AACGACGGCCAGTGAATTCGAGCTCTTATTTCTTTTTGTTGGTGGTCTG ACCG
AAAG-3 ' and N-1R:5-ACGTAAAAACAAAGGAGGTGAAATGTACACATGGGCCTTATGAACGCAT TTGATTCGCA-
3 ', using 168 genome of bacillus subtilis as template, clone transcriptional regulation protein encoding gene NanR genetic fragment SEQ ID
NO.4;Design primer N-2F:5-GTGTACATTTCACCTCCTTTGTTTTTACGTAATACGATAAATAGGGCCA AAGGT-3 '
With N-2R:5-GTATTACGGAGCACTTCCCATATTATCAAGAAAGCGGGGAATTGTCCTA TACC-3 ', with withered grass gemma
168 genome of bacillus is template, clones PydjOPromoter gene segment SEQ ID NO.1, design primer N-3F:5-CCCGCTT
TCTTGATAATATGGGAAGTGCTCCGTAATACGCTGACAAGAGA-3 ' and N-3R:5-CTTTAAACGATATACCTTTAT
ACCTGTTATACCATTGTACAACACGAGCCCATTTTTGTCAAATAAAATTTAAATT- 3 ', with bacillus subtilis 168
Genome is template, clones PvegGenetic fragment SEQ ID NO.6, design primer N-4F:5-ATAACAGGTATAAAGGTATAT
CGTTTAAAGGAGGTGAAATGTACACATGGGTAAGGGAGAAGAACTTTTCACT-3 ' and N-4R:5-GCGTGACGTGAA
TTATTTGTATAGTTCATCCATGCCATGTGTAATCCCAGCAG-3 ', using laboratory preservation plasmid as template, cloned sequence
The GFP genetic fragment as shown in SEQ ID NO.8;Design primer N-5F:5-GAACTATACAAATAATTCACGTCACGCGTC
CATGGAGA-3 ' and N-5R:5-GAGCTCGAATTCACTGGCCGTCGTTTTACAAC-3 ', using plasmid pHT01 as template, gram
Grand pHT01 skeleton segment SEQ ID NO.14, above totally 5 segments pass through NEB Gibson Assembly Master Mix
Kit is assembled, and sialic acid response element tool plasmid pHT-ydjO-veg plasmid is constructed.
Embodiment 4 constructs sialic acid inducing expression element bacillus subtilis BSNanT-pHT-ydjO-veg
By sialic acid response element tool plasmid pHT-ydjO-veg plasmid, supreme bacillus subtilis engineered strain is converted
In BSNanT, recombined bacillus subtilis engineering bacteria is obtained, BSNanT-pHT-ydjO-veg is named as.
5 bacillus subtilis BSNanT-pHT-ydjO-veg of embodiment adds sialic acid induction fermentation
By the bacterial strain BSNanT-pHT-ydjO-veg prepared according to the method for embodiment 4 under 37 DEG C, 200rpm, containing
48h is cultivated in the fermentation medium for having 5g/L sialic acid.Final measurement fermentation liquid green fluorescent protein intensity is 4000a.u., at
Function obtains the sialic acid inducing expression element of strong inducing expression intensity.When not adding sialic acid in fermentation medium, fermentation
48h, fermentation liquid green fluorescent protein intensity are 400a.u., and leakage expression quantity is 10%.
The building optimization sialic acid response element tool plasmid pHT-hbs-veg plasmid of embodiment 6
Design primer hbs-F:5-TGTGTACATTTCACCTCCTTTGAATGTTTGTCCAACAAAGTGAAGAAT TTCT
GTATGTA-3 ' and hbs-R:5-GTATTACGGAGCACTTCCCATAAGGATCAAGGAATAGGATGAAAAAAG GAAAAAAA
GGA-3 ', using 168 genome of bacillus subtilis as template, cloning promoter PhbsGenetic fragment SEQ ID NO.2;Design is drawn
Object hbs-2F:5-TATGGGAAGTGCTCCGTAATACGCTGA-3 ' and hbs-2R:5-
AAAGGAGGTGAAATGTACACATGGGCCT-3 ' is cloned shown in SEQ ID NO.15 using pHT-ydjO-veg plasmid as template
Plasmid backbone genetic fragment, assembled by NEB Gibson Assembly Master Mix Kit, construct sialic acid
Response element tool plasmid pHT-hbs-veg plasmid.
Embodiment 7 constructs sialic acid inducing expression element bacillus subtilis BSNanT-pHT-hbs-veg
By sialic acid response element tool plasmid pHT-hbs-veg plasmid, supreme bacillus subtilis engineered strain is converted
In BSNanT, recombined bacillus subtilis engineering bacteria is obtained, BSNanT-pHT-hbs-veg is named as.
8 bacillus subtilis BSNanT-pHT-hbs-veg of embodiment adds sialic acid induction fermentation
By the bacterial strain BSNanT-pHT-hbs-veg prepared according to the method for embodiment 4 under 37 DEG C, 200rpm, containing
48h is cultivated in the fermentation medium of 5g/L sialic acid.Final measurement fermentation liquid green fluorescent protein intensity is 3900a.u., success
Obtain the sialic acid inducing expression element of strong inducing expression intensity.When not adding sialic acid in fermentation medium, ferment 48h,
Fermentation liquid green fluorescent protein intensity is 230a.u., and leakage expression quantity is 6%.
The building optimization sialic acid response element tool plasmid pHT-hbs-veg-2 plasmid of embodiment 9
Design primer veg2-F:5-TTGATCTGGTATAACAGGTATAAAGGTATACACTTTAAAGGAGGTGA AATG
TACACATGGGTAAGG-3 ' and veg2-R:5-CTTTATACCTGTTATACCAGATCAAAAACGATATACCTTTATACCTG
TTATACCATTGTACAACACGA-3 ', using pHT-hbs-veg plasmid as template, amplified production directly converts Escherichia coli, structure
Build sialic acid response element tool plasmid pHT-hbs-veg-2 plasmid.
Embodiment 10 constructs sialic acid inducing expression element bacillus subtilis BSNanT-pHT-hbs-veg-2
By sialic acid response element tool plasmid pHT-hbs-veg-2 plasmid, supreme bacillus subtilis engineering bacteria is converted
In strain BSNanT, recombined bacillus subtilis engineering bacteria is obtained, BSNanT-pHT-hbs-veg-2 is named as.
11 bacillus subtilis BSNanT-pHT-hbs-veg-2 of embodiment adds sialic acid induction fermentation
By the bacterial strain BSNanT-pHT-hbs-veg-2 prepared according to the method for embodiment 4 under 37 DEG C, 200rpm, containing
48h is cultivated in the fermentation medium for having 5g/L sialic acid.Final measurement fermentation liquid green fluorescent protein intensity is 3700a.u., at
Function obtains the sialic acid inducing expression element of strong inducing expression intensity.When not adding sialic acid in fermentation medium, fermentation
48h, fermentation liquid green fluorescent protein intensity are 75a.u., and leakage expression quantity is 2%.
Adjust sialic acid concentration, other condition of culture are constant, the results show that in fermentation medium sialic acid content be 1~
When 10g/L, fluorescence intensity is 3500~3700a.u., and Strength Changes are little.
Comparative example 1:
Expression element library is constructed according to Examples 1 to 8 same policy, chooses PasdPromoter, PgltXPromoter, PyvyDIt opens
Mover, PcsbAPromoter, PphrFPromoter and PyceCPromoter (it is disclosed in paper Yang, S., Du, G., Chen, J., Kang,
Z.,2017.Characterization and application of endogenous phase-dependent
Promoters in Bacillus subtilis.Appl.Microbiol.Biotechnol.101, in 4151-61.), totally 6
A promoter integrates NanR binding sequence, the results show that PasdPromoter, PgltXPromoter, PyvyDPromoter, PcsbAPromoter,
PphrFPromoter and PyceCPromoter, totally 6 promoters, cannot be expressed by saliva acid active.
Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill
The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention
Enclosing subject to the definition of the claims.
SEQUENCE LISTING
<110>Southern Yangtze University
<120>a kind of sialic acid inducing expression element and application
<160> 15
<170> PatentIn version 3.3
<210> 1
<211> 300
<212> DNA
<213>artificial sequence
<400> 1
ttatcaagaa agcggggaat tgtcctatac cggtccggct gtcccgccgc cgccaagtga 60
aaagggctgg aaagacacca ttcaagcgca tgcaggtgaa gtcctgagaa tcgcggcgac 120
attcggtccg tacagcggac gatacgtatg gcattgccat attctagagc atgaagacta 180
tgacatgatg agaccgatgg atataactga tccccataaa taacccgaca aacttgcctc 240
tagcaggcaa gttttttctt tatgaaacct ttggccctat ttatcgtatt acgtaaaaac 300
<210> 2
<211> 164
<212> DNA
<213>artificial sequence
<400> 2
aggatcaagg aataggatga aaaaaggaaa aaaaggaata ttcgttcggt aaatcacctt 60
aaatccttga cgagcaaggg attgacgctt taaaatgctt gatatggctt tttatatgtg 120
ttactctaca tacagaaatt cttcactttg ttggacaaac attc 164
<210> 3
<211> 36
<212> DNA
<213>artificial sequence
<220>
<221> misc_feature
<222> (3)..(3)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (5)..(6)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (23)..(23)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (26)..(26)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (29)..(33)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (35)..(36)
<223> n is a, c, g, or t
<400> 3
ttnanntggt ataacaggta tanagntann nnntnn 36
<210> 4
<211> 263
<212> PRT
<213>artificial sequence
<400> 4
Met Gly Leu Met Asn Ala Phe Asp Ser Gln Thr Glu Asp Ser Ser Pro
1 5 10 15
Ala Ile Gly Arg Asn Leu Arg Ser Arg Pro Leu Ala Arg Lys Lys Leu
20 25 30
Ser Glu Met Val Glu Glu Glu Leu Glu Gln Met Ile Arg Arg Arg Glu
35 40 45
Phe Gly Glu Gly Glu Gln Leu Pro Ser Glu Arg Glu Leu Met Ala Phe
50 55 60
Phe Asn Val Gly Arg Pro Ser Val Arg Glu Ala Leu Ala Ala Leu Lys
65 70 75 80
Arg Lys Gly Leu Val Gln Ile Asn Asn Gly Glu Arg Ala Arg Val Ser
85 90 95
Arg Pro Ser Ala Asp Thr Ile Ile Gly Glu Leu Ser Gly Met Ala Lys
100 105 110
Asp Phe Leu Ser His Pro Gly Gly Ile Ala His Phe Glu Gln Leu Arg
115 120 125
Leu Phe Phe Glu Ser Ser Leu Val Arg Tyr Ala Ala Glu His Ala Thr
130 135 140
Asp Glu Gln Ile Asp Leu Leu Ala Lys Ala Leu Glu Ile Asn Ser Gln
145 150 155 160
Ser Leu Asp Asn Asn Ala Ala Phe Ile Arg Ser Asp Val Asp Phe His
165 170 175
Arg Val Leu Ala Glu Ile Pro Gly Asn Pro Ile Phe Met Ala Ile His
180 185 190
Val Ala Leu Leu Asp Trp Leu Ile Ala Ala Arg Pro Thr Val Thr Asp
195 200 205
Gln Ala Leu His Glu His Asn Asn Val Ser Tyr Gln Gln His Ile Ala
210 215 220
Ile Val Asp Ala Ile Arg Arg His Asp Pro Asp Glu Ala Asp Arg Ala
225 230 235 240
Leu Gln Ser His Leu Asn Ser Val Ser Ala Thr Trp His Ala Phe Gly
245 250 255
Gln Thr Thr Asn Lys Lys Lys
260
<210> 5
<211> 496
<212> PRT
<213>artificial sequence
<400> 5
Met Ser Thr Thr Thr Gln Asn Ile Pro Trp Tyr Arg His Leu Asn Arg
1 5 10 15
Ala Gln Trp Arg Ala Phe Ser Ala Ala Trp Leu Gly Tyr Leu Leu Asp
20 25 30
Gly Phe Asp Phe Val Leu Ile Ala Leu Val Leu Thr Glu Val Gln Gly
35 40 45
Glu Phe Gly Leu Thr Thr Val Gln Ala Ala Ser Leu Ile Ser Ala Ala
50 55 60
Phe Ile Ser Arg Trp Phe Gly Gly Leu Met Leu Gly Ala Met Gly Asp
65 70 75 80
Arg Tyr Gly Arg Arg Leu Ala Met Val Thr Ser Ile Val Leu Phe Ser
85 90 95
Ala Gly Thr Leu Ala Cys Gly Phe Ala Pro Gly Tyr Ile Thr Met Phe
100 105 110
Ile Ala Arg Leu Val Ile Gly Met Gly Met Ala Gly Glu Tyr Gly Ser
115 120 125
Ser Ala Thr Tyr Val Ile Glu Ser Trp Pro Lys His Leu Arg Asn Lys
130 135 140
Ala Ser Gly Phe Leu Ile Ser Gly Phe Ser Val Gly Ala Val Val Ala
145 150 155 160
Ala Gln Val Tyr Ser Leu Val Val Pro Val Trp Gly Trp Arg Ala Leu
165 170 175
Phe Phe Ile Gly Ile Leu Pro Ile Ile Phe Ala Leu Trp Leu Arg Lys
180 185 190
Asn Ile Pro Glu Ala Glu Asp Trp Lys Glu Lys His Ala Gly Lys Ala
195 200 205
Pro Val Arg Thr Met Val Asp Ile Leu Tyr Arg Gly Glu His Arg Ile
210 215 220
Ala Asn Ile Val Met Thr Leu Ala Ala Ala Thr Ala Leu Trp Phe Cys
225 230 235 240
Phe Ala Gly Asn Leu Gln Asn Ala Ala Ile Val Ala Val Leu Gly Leu
245 250 255
Leu Cys Ala Ala Ile Phe Ile Ser Phe Met Val Gln Ser Ala Gly Lys
260 265 270
Arg Trp Pro Thr Gly Val Met Leu Met Val Val Val Leu Phe Ala Phe
275 280 285
Leu Tyr Ser Trp Pro Ile Gln Ala Leu Leu Pro Thr Tyr Leu Lys Thr
290 295 300
Asp Leu Ala Tyr Asn Pro His Thr Val Ala Asn Val Leu Phe Phe Ser
305 310 315 320
Gly Phe Gly Ala Ala Val Gly Cys Cys Val Gly Gly Phe Leu Gly Asp
325 330 335
Trp Leu Gly Thr Arg Lys Ala Tyr Val Cys Ser Leu Leu Ala Ser Gln
340 345 350
Leu Leu Ile Ile Pro Val Phe Ala Ile Gly Gly Ala Asn Val Trp Val
355 360 365
Leu Gly Leu Leu Leu Phe Phe Gln Gln Met Leu Gly Gln Gly Ile Ala
370 375 380
Gly Ile Leu Pro Lys Leu Ile Gly Gly Tyr Phe Asp Thr Asp Gln Arg
385 390 395 400
Ala Ala Gly Leu Gly Phe Thr Tyr Asn Val Gly Ala Leu Gly Gly Ala
405 410 415
Leu Ala Pro Ile Ile Gly Ala Leu Ile Ala Gln Arg Leu Asp Leu Gly
420 425 430
Thr Ala Leu Ala Ser Leu Ser Phe Ser Leu Thr Phe Val Val Ile Leu
435 440 445
Leu Ile Gly Leu Asp Met Pro Ser Arg Val Gln Arg Trp Leu Arg Pro
450 455 460
Glu Ala Leu Arg Thr His Asp Ala Ile Asp Gly Lys Pro Phe Ser Gly
465 470 475 480
Ala Val Pro Phe Gly Ser Ala Lys Asn Asp Leu Val Lys Thr Lys Ser
485 490 495
<210> 6
<211> 319
<212> DNA
<213>artificial sequence
<400> 6
tatgggaagt gctccgtaat acgctgacaa gagagaaagg gcttggaggt attgaaacaa 60
gaggagttct gagaattggt atgccttata agtccaatta acagttgaaa acctgcatag 120
gagagctatg cgggtttttt attttacata atgatacata atttaccgaa acttgcggaa 180
cataattgag gaatcataga attttgtcaa aataatttta ttgacaacgt cttattaacg 240
ttgatataat ttaaatttta tttgacaaaa atgggctcgt gttgtacaat ggtataacag 300
gtataaaggt atatcgttt 319
<210> 7
<211> 355
<212> DNA
<213>artificial sequence
<400> 7
tatgggaagt gctccgtaat acgctgacaa gagagaaagg gcttggaggt attgaaacaa 60
gaggagttct gagaattggt atgccttata agtccaatta acagttgaaa acctgcatag 120
gagagctatg cgggtttttt attttacata atgatacata atttaccgaa acttgcggaa 180
cataattgag gaatcataga attttgtcaa aataatttta ttgacaacgt cttattaacg 240
ttgatataat ttaaatttta tttgacaaaa atgggctcgt gttgtacaat ggtataacag 300
gtataaaggt atatcgtttt tgatctggta taacaggtat aaaggtatac acttt 355
<210> 8
<211> 238
<212> PRT
<213>artificial sequence
<400> 8
Met Gly Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val
1 5 10 15
Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu
20 25 30
Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys
35 40 45
Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu
50 55 60
Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Arg
65 70 75 80
His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg
85 90 95
Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val
100 105 110
Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile
115 120 125
Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn
130 135 140
Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly
145 150 155 160
Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val
165 170 175
Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro
180 185 190
Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser
195 200 205
Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val
210 215 220
Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys
225 230 235
<210> 9
<211> 1068
<212> DNA
<213>artificial sequence
<400> 9
gtatgtcatg atgcgtgaag gatcagtcgc caaaaacacg ctcaatgtgc tgccggcggt 60
gaatgaaaag aacgcacgcc ggttcttttt ctgtacggat gataagcatg tggatgattt 120
attgtcagag ggaagtgtaa accatcaggt gaaaatggcg attcaagccg gacttaatcc 180
gtttttagcc tatcagctag gaagcctcaa tgcagccgaa tgctacggat tagatacaaa 240
gggagcgatt gccccgggtt ttgacgctga tttgcttttt gtatctgatc tggaaaatgt 300
cactgtcaca atgacgatgg taaaagggca gactgttgct gaagacagca aagcggtcta 360
tcaggatcat gcttcaactg cagcaccaga tcaggcactg cttgattctg ttaagcttgc 420
tgctcctctt aacaaacagg attttcatat gccaatcgat tcagagcagc agatcaatgt 480
cattcaaatc ataccaaatc agcttgaaac acgattagta caagttccgg ctcctgttgc 540
ccgcgaattt gagcctgaca ctgagcttga tttgttaaag attgcagttg tcgagcggca 600
taaaggatta aaagaaaccg gacttggtgt tgtgaaaggt tttggattca agagcggagc 660
gattgccaca accatttcac acgactccca taatattatt gccgtcggaa cgaatgatga 720
ggatatcgcg gcggcagtta ataagctgca ggaaattggc ggaggattaa caattataaa 780
aaatggggaa gagctccatt cagtaccgct gccgattgca gggttattat ccgaccaatc 840
tgcagagcaa gtgaatcaaa gcttgctgac gcttcatgat aaattgtcgt taatcggttt 900
cacaggcgga tttaatccat ttttgacatt gtcgttttta gcgttgcctg tcattcctga 960
tattaaaatg acgactacgg gattattcga tgtaaaatca tttcaacaca tatcactgca 1020
ataaaaagag gcactccctt agggagtgcc tctttttgag cggataac 1068
<210> 10
<211> 1267
<212> DNA
<213>artificial sequence
<400> 10
gagcggataa caatttcaca caggaaacag ctatgaccat gattacgaat tcgagctcgg 60
tacccgggga tcctctagag attgtaccgt tcgtatagca tacattatac gaagttatcg 120
attttcgttc gtgaatacat gttataataa ctataactaa taacgtaacg tgactggcaa 180
gagatatttt taaaacaatg aataggttta cacttacttt agttttatgg aaatgaaaga 240
tcatatcata tataatctag aataaaatta actaaaataa ttattatcta gataaaaaat 300
ttagaagcca atgaaatcta taaataaact aaattaagtt tatttaatta acaactatgg 360
atataaaata ggtactaatc aaaatagtga ggaggatata tttgaataca tacgaacaag 420
ttaataaagt gaaaaaaata cttcggaaac atttaaaaaa taaccttatt ggtacttaca 480
tgtttggatc aggagttgag agtggactaa aaccaaatag tgatcttgac tttttagtcg 540
tcgtatctga accattgaca gatcaaagta aagaaatact tatacaaaaa attagaccta 600
tttcaaaaaa aataggagat aaaagcaact tacgatatat tgaattaaca attattattc 660
agcaagaaat ggtaccgtgg aatcatcctc ccaaacaaga atttatttat ggagaatggt 720
tacaagagct ttatgaacaa ggatacattc ctcagaagga attaaattca gatttaacca 780
taatgcttta ccaagcaaaa cgaaaaaata aaagaatata cggaaattat gacttagagg 840
aattactacc tgatattcca ttttctgatg tgagaagagc cattatggat tcgtcagagg 900
aattaataga taattatcag gatgatgaaa ccaactctat attaacttta tgccgtatga 960
ttttaactat ggacacgggt aaaatcatac caaaagatat tgcgggaaat gcagtggctg 1020
aatcttctcc attagaacat agggagagaa ttttgttagc agttcgtagt tatcttggag 1080
agaatattga atggactaat gaaaatgtaa atttaactat aaactattta aataacagat 1140
taaaaaaatt ataaataact tcgtatagca tacattatac gaacggtaga atcgtcgacc 1200
tgcaggcatg caagcttggc actggccgtc gttttacaac gtcgtgactg ggaaaaccct 1260
ggcgtta 1267
<210> 11
<211> 300
<212> DNA
<213>artificial sequence
<400> 11
tgataggtgg tatgttttcg cttgaacttt taaatacagc cattgaacat acggttgatt 60
taataactga caaacatcac cctcttgcta aagcggccaa ggacgccgcc gccggggctg 120
tttgcgttct tgccgtgatt tcgtgtacca ttggtttact tatttttttg ccaaggctgt 180
aatggctgaa aattcttaca tttattttac atttttagaa atgggcgtga aaaaaagcgc 240
gcgattatgt aaaatataaa gtgatagcgg taccattata ggtaagagag gaatgtacac 300
<210> 12
<211> 1491
<212> DNA
<213>artificial sequence
<400> 12
atgagtacta caacccagaa tatcccgtgg tatcgccatc tcaaccgtgc acaatggcgc 60
gcattttccg ctgcctggtt gggatatctg cttgacggtt ttgatttcgt tttaatcgcc 120
ctggtactca ccgaagtaca aggtgaattc gggctgacga cggtgcaggc ggcaagtctg 180
atctctgcag cctttatctc tcgctggttc ggcggcctga tgctcggcgc tatgggtgac 240
cgctacgggc gtcgtctggc aatggtcacc agcatcgttc tcttctcggc cgggacgctg 300
gcctgcggct ttgcgccagg ctacatcacc atgtttatcg ctcgtctggt catcggcatg 360
gggatggcgg gtgaatacgg ttccagcgcc acctatgtca ttgaaagctg gccaaaacat 420
ctgcgtaaca aagccagtgg ttttttgatt tcaggcttct ctgtgggggc cgtcgttgcc 480
gctcaggtct atagcctggt ggttccggtc tggggctggc gtgcgctgtt ctttatcggc 540
attttgccaa tcatctttgc tctctggctg cgtaaaaaca tcccggaagc ggaagactgg 600
aaagagaaac acgcaggtaa agcaccagta cgcacaatgg tggatattct ctaccgtggt 660
gaacatcgca ttgccaatat cgtaatgaca ctggcggcgg ctactgcgct gtggttctgc 720
ttcgccggta acctgcaaaa tgccgcgatc gtcgctgttc ttgggctgtt atgcgccgca 780
atctttatca gctttatggt gcagagtgca ggcaaacgct ggccaacggg cgtaatgctg 840
atggtggtcg tgttgtttgc tttcctctac tcatggccga ttcaggcgct gctgccaacg 900
tatctgaaaa ccgatctggc ttataacccg catactgtag ccaatgtgct gttctttagt 960
ggctttggcg cggcggtggg atgctgcgta ggtggcttcc tcggtgactg gctgggaacc 1020
cgcaaagcgt acgtttgtag cctgctggcc tcgcagctgc tgattattcc ggtatttgcg 1080
attggcggcg caaacgtctg ggtgctcggt ctgttactgt tcttccagca aatgcttgga 1140
caagggatcg ccgggatctt accaaaactg attggcggtt atttcgatac cgaccagcgt 1200
gcagcgggcc tgggctttac ctacaacgtt ggcgcattgg gcggtgcact ggccccaatc 1260
atcggcgcgt tgatcgctca acgtctggat ctgggtactg cgctggcatc gctctcgttc 1320
agtctgacgt tcgtggtgat cctgctgatt gggctggata tgccttctcg cgttcagcgt 1380
tggttgcgcc cggaagcgtt gcgtactcat gacgctatcg acggtaaacc attcagcggt 1440
gccgtgccgt ttggcagcgc caaaaacgat ttagtcaaaa ccaaaagtta a 1491
<210> 13
<211> 1081
<212> DNA
<213>artificial sequence
<400> 13
ggtgaactac tcggtcgtca accccattaa acctccataa tgatcggcag gatcattgga 60
cggcgctttg ttttttcgta caagaaaggt gcaagcgtgt ctgtaatttc gtttttgatt 120
tcagaccatt gagtcgtttt tcgttccatt actttttgta agtgatttga aatgagctct 180
tgagcgtcgt tgatcaagtc accagattct ctcatgtaca caaatcctct ggaaatcaaa 240
tcaggacccg ctgaaatctt gaagtcgtcc atgtcaatgc tgacaacaac gatgacaagt 300
ccttcttcag agagaattct gcgatcacga agtacgatat tgccaatatc accgataccg 360
cttccgtcaa tgtacactga accggacggg atttttcctg caactgaagc ctcatcgcct 420
ttaagtgcta atacttcacc attatccatg ataaagcagt tttcctctgg gatgccacaa 480
tctgttgcaa gtttgacatg catcttttgc attctgtact caccgtgaat cggcatgaag 540
aatttaggct tgattaaacg aagcatcagc ttctgttctt cctgtccgcc gtgaccggat 600
gtatggatat cgttaagagg gccgtgaata acctcagcac ccgcacgata cagctggttg 660
attgttcgac tcacgctgat tgtgttgcct gggatagggg atgaagaaaa tacgactgta 720
tccccaggat tgattgaaat ttggcggtgt gtgccgtttg caattcttga taacgccgcc 780
attggttccc cttggcttcc tgtacataaa attgttactt tattagcagg catacgattg 840
atttcgttat gctcaataaa cgtattttta ggacagttaa tataaccgag tgtctgtcca 900
atttcgatag ccgattccat actgcgtcca aatacggcaa cttttcttcc attttgtaca 960
gcagcttcaa ttacctgctg caagcggtga atattcgacg caaatgtggc gaagataatt 1020
cggccgtcca ccttgcggaa aatgtcatga atgctttctc ctacacggcg ctcagacatg 1080
g 1081
<210> 14
<211> 6420
<212> DNA
<213>artificial sequence
<400> 14
gaactataca aataattcac gtcacgcgtc catggagaga actatacaaa taattcacgt 60
cacgcgtcca tggagatctt tgtctgcaac tgaaaagttt ataccttacc tggaacaaat 120
ggttgaaaca tacgaggcta atatcggctt attaggaata gtccctgtac taataaaatc 180
aggtggatca gttgatcagt atattttgga cgaagctcgg aaagaatttg gagatgactt 240
gcttaattcc acaattaaat taagggaaag aataaagcga tttgatgttc aaggaatcac 300
ggaagaagat actcatgata aagaagctct aaaactattc aataacctta caatggaatt 360
gatcgaaagg gtggaaggtt aatggtacga aaattagggg atctacctag aaagccacaa 420
ggcgataggt caagcttaaa gaacccttac atggatctta cagattctga aagtaaagaa 480
acaacagagg ttaaacaaac agaaccaaaa agaaaaaaag cattgttgaa aacaatgaaa 540
gttgatgttt caatccataa taagattaaa tcgctgcacg aaattctggc agcatccgaa 600
gggaattcat attacttaga ggatactatt gagagagcta ttgataagat ggttgagaca 660
ttacctgaga gccaaaaaac tttttatgaa tatgaattaa aaaaaagaac caacaaaggc 720
tgagacagac tccaaacgag tctgtttttt taaaaaaaat attaggagca ttgaatatat 780
attagagaat taagaaagac atgggaataa aaatatttta aatccagtaa aaatatgata 840
agattatttc agaatatgaa gaactctgtt tgtttttgat gaaaaaacaa acaaaaaaaa 900
tccacctaac ggaatctcaa tttaactaac agcggccaaa ctgagaagtt aaatttgaga 960
aggggaaaag gcggatttat acttgtattt aactatctcc attttaacat tttattaaac 1020
cccatacaag tgaaaatcct cttttacact gttcctttag gtgatcgcgg agggacatta 1080
tgagtgaagt aaacctaaaa ggaaatacag atgaattagt gtattatcga cagcaaacca 1140
ctggaaataa aatcgccagg aagagaatca aaaaagggaa agaagaagtt tattatgttg 1200
ctgaaacgga agagaagata tggacagaag agcaaataaa aaacttttct ttagacaaat 1260
ttggtacgca tataccttac atagaaggtc attatacaat cttaaataat tacttctttg 1320
atttttgggg ctatttttta ggtgctgaag gaattgcgct ctatgctcac ctaactcgtt 1380
atgcatacgg cagcaaagac ttttgctttc ctagtctaca aacaatcgct aaaaaaatgg 1440
acaagactcc tgttacagtt agaggctact tgaaactgct tgaaaggtac ggttttattt 1500
ggaaggtaaa cgtccgtaat aaaaccaagg ataacacaga ggaatccccg atttttaaga 1560
ttagacgtaa ggttcctttg ctttcagaag aacttttaaa tggaaaccct aatattgaaa 1620
ttccagatga cgaggaagca catgtaaaga aggctttaaa aaaggaaaaa gagggtcttc 1680
caaaggtttt gaaaaaagag cacgatgaat ttgttaaaaa aatgatggat gagtcagaaa 1740
caattaatat tccagaggcc ttacaatatg acacaatgta tgaagatata ctcagtaaag 1800
gagaaattcg aaaagaaatc aaaaaacaaa tacctaatcc tacaacatct tttgagagta 1860
tatcaatgac aactgaagag gaaaaagtcg acagtacttt aaaaagcgaa atgcaaaatc 1920
gtgtctctaa gccttctttt gatacctggt ttaaaaacac taagatcaaa attgaaaata 1980
aaaattgttt attacttgta ccgagtgaat ttgcatttga atggattaag aaaagatatt 2040
tagaaacaat taaaacagtc cttgaagaag ctggatatgt tttcgaaaaa atcgaactaa 2100
gaaaagtgca ataaactgct gaagtatttc agcagttttt tttatttaga aatagtgaaa 2160
aaaatataat cagggaggta tcaatattta atgagtactg atttaaattt atttagactg 2220
gaattaataa ttaacacgta gactaattaa aatttaatga gggataaaga ggatacaaaa 2280
atattaattt caatccctat taaattttaa caaggggggg attaaaattt aattagaggt 2340
ttatccacaa gaaaagaccc taataaaatt tttactaggg ttataacact gattaatttc 2400
ttaatggggg agggattaaa atttaatgac aaagaaaaca atcttttaag aaaagctttt 2460
aaaagataat aataaaaaga gctttgcgat taagcaaaac tctttacttt ttcattgaca 2520
ttatcaaatt catcgatttc aaattgttgt tgtatcataa agttaattct gttttgcaca 2580
accttttcag gaatataaaa cacatctgag gcttgtttta taaactcagg gtcgctaaag 2640
tcaatgtaac gtagcatatg atatggtata gcttccaccc aagttagcct ttctgcttct 2700
tctgaatgtt tttcatatac ttccatgggt atctctaaat gattttcctc atgtagcaag 2760
gtatgagcaa aaagtttatg gaattgatag ttcctctctt tttcttcaac ttttttatct 2820
aaaacaaaca ctttaacatc tgagtcaatg taagcataag atgtttttcc agtcataatt 2880
tcaatcccaa atcttttaga cagaaattct ggacgtaaat cttttggtga aagaattttt 2940
ttatgtagca atatatccga tacagcacct tctaaaagcg ttggtgaata gggcatttta 3000
cctatctcct ctcattttgt ggaataaaaa tagtcatatt cgtccatcta cctatcctat 3060
tatcgaacag ttgaactttt taatcaagga tcagtccttt ttttcattat tcttaaactg 3120
tgctcttaac tttaacaact cgatttgttt ttccagatct cgagggtaac tagcctcgcc 3180
gatcccgcaa gaggcccggc agtcaggtgg cacttttcgg ggaaatgtgc gcggaacccc 3240
tatttgttta tttttctaaa tacattcaaa tatgtatccg ctcatgagac aataaccctg 3300
ataaatgctt caataatatt gaaaaaggaa gagtatgagt attcaacatt tccgtgtcgc 3360
ccttattccc ttttttgcgg cattttgcct tcctgttttt gctcacccag aaacgctggt 3420
gaaagtaaaa gatgctgaag atcagttggg tgcacgagtg ggttacatcg aactggatct 3480
caacagcggt aagatccttg agagttttcg ccccgaagaa cgttttccaa tgatgagcac 3540
ttttaaagtt ctgctatgtg gcgcggtatt atcccgtatt gacgccgggc aagagcaact 3600
cggtcgccgc atacactatt ctcagaatga cttggttgag tactcaccag tcacagaaaa 3660
gcatcttacg gatggcatga cagtaagaga attatgcagt gctgccataa ccatgagtga 3720
taacactgcg gccaacttac ttctgacaac gatcggagga ccgaaggagc taaccgcttt 3780
tttgcacaac atgggggatc atgtaactcg ccttgatcgt tgggaaccgg agctgaatga 3840
agccatacca aacgacgagc gtgacaccac gatgcctgta gcaatggcaa caacgttgcg 3900
caaactatta actggcgaac tacttactct agcttcccgg caacaattaa tagactggat 3960
ggaggcggat aaagttgcag gaccacttct gcgctcggcc cttccggctg gctggtttat 4020
tgctgataaa tctggagccg gtgagcgtgg gtctcgcggt atcattgcag cactggggcc 4080
agatggtaag ccctcccgta tcgtagttat ctacacgacg gggagtcagg caactatgga 4140
tgaacgaaat agacagatcg ctgagatagg tgcctcactg attaagcatt ggtaactgtc 4200
agaccaagtt tactcatata tactttagat tgatttaaaa cttcattttt aatttaaaag 4260
gatctaggtg aagatccttt ttgataatct catgaccaaa atcccttaac gtgagttttc 4320
gttccactga gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag atcctttttt 4380
tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt 4440
gccggatcaa gagctaccaa ctctttttcc gaaggtaact ggcttcagca gagcgcagat 4500
accaaatact gtccttctag tgtagccgta gttaggccac cacttcaaga actctgtagc 4560
accgcctaca tacctcgctc tgctaatcct gttaccagtg gctgctgcca gtggcgataa 4620
gtcgtgtctt accgggttgg actcaagacg atagttaccg gataaggcgc agcggtcggg 4680
ctgaacgggg ggttcgtgca cacagcccag cttggagcga acgacctaca ccgaactgag 4740
atacctacag cgtgagctat gagaaagcgc cacgcttccc gaagggagaa aggcggacag 4800
gtatccggta agcggcaggg tcggaacagg agagcgcacg agggagcttc cagggggaaa 4860
cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt 4920
gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg cctttttacg 4980
gttcctggcc ttttgctggc cttttgctca catgttcttt cctgcgttat cccctgattc 5040
tgtggataac cgtattaccg cctttgagtg agctgatacc gctcgccgca gccgaacgac 5100
cgagcgcagc gagtcagtga gcgaggaagc ggaagagcgc ccaatacgca tgcttaagtt 5160
attggtatga ctggttttaa gcgcaaaaaa agttgctttt tcgtacctat taatgtatcg 5220
ttttagaaaa ccgactgtaa aaagtacagt cggcattatc tcatattata aaagccagtc 5280
attaggccta tctgacaatt cctgaataga gttcataaac aatcctgcat gataaccatc 5340
acaaacagaa tgatgtacct gtaaagatag cggtaaatat attgaattac ctttattaat 5400
gaattttcct gctgtaataa tgggtagaag gtaattacta ttattattga tatttaagtt 5460
aaacccagta aatgaagtcc atggaataat agaaagagaa aaagcatttt caggtatagg 5520
tgttttggga aacaatttcc ccgaaccatt atatttctct acatcagaaa ggtataaatc 5580
ataaaactct ttgaagtcat tctttacagg agtccaaata ccagagaatg ttttagatac 5640
accatcaaaa attgtataaa gtggctctaa cttatcccaa taacctaact ctccgtcgct 5700
attgtaacca gttctaaaag ctgtatttga gtttatcacc cttgtcacta agaaaataaa 5760
tgcagggtaa aatttatatc cttcttgttt tatgtttcgg tataaaacac taatatcaat 5820
ttctgtggtt atactaaaag tcgtttgttg gttcaaataa tgattaaata tctcttttct 5880
cttccaattg tctaaatcaa ttttattaaa gttcatttga tatgcctcct aaatttttat 5940
ctaaagtgaa tttaggaggc ttacttgtct gctttcttca ttagaatcaa tcctttttta 6000
aaagtcaata ttactgtaac ataaatatat attttaaaaa tatcccactt tatccaattt 6060
tcgtttgttg aactaatggg tgctttagtt gaagaataaa agaccacatt aaaaaatgtg 6120
gtcttttgtg tttttttaaa ggatttgagc gtagcgaaaa atccttttct ttcttatctt 6180
gataataagg gtaactattg ccgatcgtcc attccgacag catcgccagt cactatggcg 6240
tgctgctagc gccattcgcc attcaggctg cgcaactgtt gggaagggcg atcggtgcgg 6300
gcctcttcgc tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg attaagttgg 6360
gtaacgccag ggttttccca gtcacgacgt tgtaaaacga cggccagtga attcgagctc 6420
<210> 15
<211> 8261
<212> DNA
<213>artificial sequence
<400> 15
cccgctttct tgataatatg ggaagtgctc cgtaatacgc tgacaagaga gaaagggctt 60
ggaggtattg aaacaagagg agttctgaga attggtatgc cttataagtc caattaacag 120
ttgaaaacct gcataggaga gctatgcggg ttttttattt tacataatga tacataattt 180
accgaaactt gcggaacata attgaggaat catagaattt tgtcaaaata attttattga 240
caacgtctta ttaacgttga tataatttaa attttatttg acaaaaatgg gctcgtgttg 300
tacaatggta taacaggtat aaaggtatat cgtttaaagg aggtgaaatg tacacatggg 360
taagggagaa gaacttttca ctggagttgt cccaattctt gttgaattag atggtgatgt 420
taatgggcac aaattttctg tcagtggaga gggtgaaggt gatgcaacat acggaaaact 480
tacccttaaa tttatttgca ctactggaaa gcttcctgtt ccttggccaa cacttgtcac 540
tactcttact tatggtgttc aatgcttttc aagataccca gatcatatga agcggcacga 600
cttcttcaag agcgccatgc ctgagggata cgtgcaggag aggaccatct tcttcaagga 660
cgacgggaac tacaagacac gtgctgaagt caagtttgag ggagacaccc tcgtcaacag 720
aatcgagctt aagggaatcg atttcaagga ggacggaaac atcctcggcc acaagttgga 780
atacaactac aactcccaca acgtatacat catggcagac aaacaaaaga atggaatcaa 840
agttaacttc aaaattagac acaacattga agatggaagc gttcaactag cagaccatta 900
tcaacaaaat actccaattg gcgatggccc tgtcctttta ccagacaacc attacctgtc 960
cacacaatct gccctttcga aagatcccaa cgaaaagaga gaccacatgg tccttcttga 1020
gtttgtaaca gctgctggga ttacacatgg catggatgaa ctatacaaat aattcacgtc 1080
acgcgtccat ggagatcttt gtctgcaact gaaaagttta taccttacct ggaacaaatg 1140
gttgaaacat acgaggctaa tatcggctta ttaggaatag tccctgtact aataaaatca 1200
ggtggatcag ttgatcagta tattttggac gaagctcgga aagaatttgg agatgacttg 1260
cttaattcca caattaaatt aagggaaaga ataaagcgat ttgatgttca aggaatcacg 1320
gaagaagata ctcatgataa agaagctcta aaactattca ataaccttac aatggaattg 1380
atcgaaaggg tggaaggtta atggtacgaa aattagggga tctacctaga aagccacaag 1440
gcgataggtc aagcttaaag aacccttaca tggatcttac agattctgaa agtaaagaaa 1500
caacagaggt taaacaaaca gaaccaaaaa gaaaaaaagc attgttgaaa acaatgaaag 1560
ttgatgtttc aatccataat aagattaaat cgctgcacga aattctggca gcatccgaag 1620
ggaattcata ttacttagag gatactattg agagagctat tgataagatg gttgagacat 1680
tacctgagag ccaaaaaact ttttatgaat atgaattaaa aaaaagaacc aacaaaggct 1740
gagacagact ccaaacgagt ctgttttttt aaaaaaaata ttaggagcat tgaatatata 1800
ttagagaatt aagaaagaca tgggaataaa aatattttaa atccagtaaa aatatgataa 1860
gattatttca gaatatgaag aactctgttt gtttttgatg aaaaaacaaa caaaaaaaat 1920
ccacctaacg gaatctcaat ttaactaaca gcggccaaac tgagaagtta aatttgagaa 1980
ggggaaaagg cggatttata cttgtattta actatctcca ttttaacatt ttattaaacc 2040
ccatacaagt gaaaatcctc ttttacactg ttcctttagg tgatcgcgga gggacattat 2100
gagtgaagta aacctaaaag gaaatacaga tgaattagtg tattatcgac agcaaaccac 2160
tggaaataaa atcgccagga agagaatcaa aaaagggaaa gaagaagttt attatgttgc 2220
tgaaacggaa gagaagatat ggacagaaga gcaaataaaa aacttttctt tagacaaatt 2280
tggtacgcat ataccttaca tagaaggtca ttatacaatc ttaaataatt acttctttga 2340
tttttggggc tattttttag gtgctgaagg aattgcgctc tatgctcacc taactcgtta 2400
tgcatacggc agcaaagact tttgctttcc tagtctacaa acaatcgcta aaaaaatgga 2460
caagactcct gttacagtta gaggctactt gaaactgctt gaaaggtacg gttttatttg 2520
gaaggtaaac gtccgtaata aaaccaagga taacacagag gaatccccga tttttaagat 2580
tagacgtaag gttcctttgc tttcagaaga acttttaaat ggaaacccta atattgaaat 2640
tccagatgac gaggaagcac atgtaaagaa ggctttaaaa aaggaaaaag agggtcttcc 2700
aaaggttttg aaaaaagagc acgatgaatt tgttaaaaaa atgatggatg agtcagaaac 2760
aattaatatt ccagaggcct tacaatatga cacaatgtat gaagatatac tcagtaaagg 2820
agaaattcga aaagaaatca aaaaacaaat acctaatcct acaacatctt ttgagagtat 2880
atcaatgaca actgaagagg aaaaagtcga cagtacttta aaaagcgaaa tgcaaaatcg 2940
tgtctctaag ccttcttttg atacctggtt taaaaacact aagatcaaaa ttgaaaataa 3000
aaattgttta ttacttgtac cgagtgaatt tgcatttgaa tggattaaga aaagatattt 3060
agaaacaatt aaaacagtcc ttgaagaagc tggatatgtt ttcgaaaaaa tcgaactaag 3120
aaaagtgcaa taaactgctg aagtatttca gcagtttttt ttatttagaa atagtgaaaa 3180
aaatataatc agggaggtat caatatttaa tgagtactga tttaaattta tttagactgg 3240
aattaataat taacacgtag actaattaaa atttaatgag ggataaagag gatacaaaaa 3300
tattaatttc aatccctatt aaattttaac aaggggggga ttaaaattta attagaggtt 3360
tatccacaag aaaagaccct aataaaattt ttactagggt tataacactg attaatttct 3420
taatggggga gggattaaaa tttaatgaca aagaaaacaa tcttttaaga aaagctttta 3480
aaagataata ataaaaagag ctttgcgatt aagcaaaact ctttactttt tcattgacat 3540
tatcaaattc atcgatttca aattgttgtt gtatcataaa gttaattctg ttttgcacaa 3600
ccttttcagg aatataaaac acatctgagg cttgttttat aaactcaggg tcgctaaagt 3660
caatgtaacg tagcatatga tatggtatag cttccaccca agttagcctt tctgcttctt 3720
ctgaatgttt ttcatatact tccatgggta tctctaaatg attttcctca tgtagcaagg 3780
tatgagcaaa aagtttatgg aattgatagt tcctctcttt ttcttcaact tttttatcta 3840
aaacaaacac tttaacatct gagtcaatgt aagcataaga tgtttttcca gtcataattt 3900
caatcccaaa tcttttagac agaaattctg gacgtaaatc ttttggtgaa agaatttttt 3960
tatgtagcaa tatatccgat acagcacctt ctaaaagcgt tggtgaatag ggcattttac 4020
ctatctcctc tcattttgtg gaataaaaat agtcatattc gtccatctac ctatcctatt 4080
atcgaacagt tgaacttttt aatcaaggat cagtcctttt tttcattatt cttaaactgt 4140
gctcttaact ttaacaactc gatttgtttt tccagatctc gagggtaact agcctcgccg 4200
atcccgcaag aggcccggca gtcaggtggc acttttcggg gaaatgtgcg cggaacccct 4260
atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga 4320
taaatgcttc aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc 4380
cttattccct tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg 4440
aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc 4500
aacagcggta agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact 4560
tttaaagttc tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc 4620
ggtcgccgca tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag 4680
catcttacgg atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat 4740
aacactgcgg ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt 4800
ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa 4860
gccataccaa acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc 4920
aaactattaa ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg 4980
gaggcggata aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt 5040
gctgataaat ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca 5100
gatggtaagc cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat 5160
gaacgaaata gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca 5220
gaccaagttt actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg 5280
atctaggtga agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg 5340
ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt 5400
ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg 5460
ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata 5520
ccaaatactg tccttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca 5580
ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag 5640
tcgtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc 5700
tgaacggggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga 5760
tacctacagc gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg 5820
tatccggtaa gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac 5880
gcctggtatc tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg 5940
tgatgctcgt caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg 6000
ttcctggcct tttgctggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct 6060
gtggataacc gtattaccgc ctttgagtga gctgataccg ctcgccgcag ccgaacgacc 6120
gagcgcagcg agtcagtgag cgaggaagcg gaagagcgcc caatacgcat gcttaagtta 6180
ttggtatgac tggttttaag cgcaaaaaaa gttgcttttt cgtacctatt aatgtatcgt 6240
tttagaaaac cgactgtaaa aagtacagtc ggcattatct catattataa aagccagtca 6300
ttaggcctat ctgacaattc ctgaatagag ttcataaaca atcctgcatg ataaccatca 6360
caaacagaat gatgtacctg taaagatagc ggtaaatata ttgaattacc tttattaatg 6420
aattttcctg ctgtaataat gggtagaagg taattactat tattattgat atttaagtta 6480
aacccagtaa atgaagtcca tggaataata gaaagagaaa aagcattttc aggtataggt 6540
gttttgggaa acaatttccc cgaaccatta tatttctcta catcagaaag gtataaatca 6600
taaaactctt tgaagtcatt ctttacagga gtccaaatac cagagaatgt tttagataca 6660
ccatcaaaaa ttgtataaag tggctctaac ttatcccaat aacctaactc tccgtcgcta 6720
ttgtaaccag ttctaaaagc tgtatttgag tttatcaccc ttgtcactaa gaaaataaat 6780
gcagggtaaa atttatatcc ttcttgtttt atgtttcggt ataaaacact aatatcaatt 6840
tctgtggtta tactaaaagt cgtttgttgg ttcaaataat gattaaatat ctcttttctc 6900
ttccaattgt ctaaatcaat tttattaaag ttcatttgat atgcctccta aatttttatc 6960
taaagtgaat ttaggaggct tacttgtctg ctttcttcat tagaatcaat ccttttttaa 7020
aagtcaatat tactgtaaca taaatatata ttttaaaaat atcccacttt atccaatttt 7080
cgtttgttga actaatgggt gctttagttg aagaataaaa gaccacatta aaaaatgtgg 7140
tcttttgtgt ttttttaaag gatttgagcg tagcgaaaaa tccttttctt tcttatcttg 7200
ataataaggg taactattgc cgatcgtcca ttccgacagc atcgccagtc actatggcgt 7260
gctgctagcg ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg 7320
cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg 7380
taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgaa ttcgagctct 7440
tatttctttt tgttggtggt ctgaccgaaa gcgtgccagg tagcagagac gctgttgaga 7500
tgcgattgca acgcacgatc ggcttcgtca ggatcatgac ggcggatcgc atcaacgatc 7560
gcaatatgct gttgataact aacgttgtta tgttcgtgca gtgcctgatc ggtaaccgtt 7620
gggcgtgcgg caataagcca gtcgagcagg gcaacgtgga tcgccatgaa gattgggtta 7680
ccggggatct ccgccagcac gcggtggaaa tcaacgtctg aacgaatgaa tgccgcgttg 7740
ttatccagcg actgactgtt gatttccagt gcttttgcca gcaaatcgat ttgctcatcg 7800
gtggcatgtt cagccgcata gcgcaccaga ctggattcaa agaacagacg taattgttcg 7860
aaatgggcaa tcccaccggg atgagaaagg aaatctttcg ccatgccgga aagctcaccg 7920
atgatagtgt ccgcagaagg acgcgagacg cgagcgcgtt cgccgttgtt tatttgcacc 7980
agacctttgc gttttaacgc tgccagcgct tcacgcaccg aaggacgccc gacgttaaag 8040
aacgccatca gttcgcgttc agacggtaat tgttcacctt cgccaaattc acgacggcgg 8100
atcatctgtt ccagctcttc ttccaccatt tcggagagtt ttttacgcgc cagcgggcgg 8160
ctacgcaagt tgcgaccaat tgcaggtgaa gaatcttcgg tttgcgaatc aaatgcgttc 8220
ataaggccca tgtgtacatt tcacctcctt tgtttttacg t 8261
Claims (10)
1. a kind of inducing expression element for responding sialic acid;It is characterized in that, containing (a) or (b);
(a) constitutive promoter PydjO, transcriptional regulation protein NanR, the composition for being integrated with transcriptional regulation protein NanR binding sequence
Type promoter Pveg, the composing type PydjOPromoter expresses transcriptional regulation protein NanR;The promoter PydjOAnd PvegTranscription side
To opposite;
(b) constitutive promoter Phbs, transcriptional regulation protein NanR, the composition for being integrated with transcriptional regulation protein NanR binding sequence
Type promoter Pveg, the composing type PydjOPromoter expresses transcriptional regulation protein NanR;The promoter PydjOAnd PvegTranscription side
To opposite.
2. inducing expression element according to claim 1, which is characterized in that the constitutive promoter PvegIntegration 2 is copied
The transcriptional regulation protein NanR binding sequence of shellfish.
3. inducing expression element according to claim 1 or 2, which is characterized in that the nucleotide of NanR binding site sequence
Sequence is as shown in SEQ NO.3.
4. any inducing expression element according to claim 1~3, which is characterized in that also contain sialic acid transport protein
NanT, amino acid sequence is as shown in SEQ NO.5.
5. inducing expression element according to any one of claims 1 to 4, which is characterized in that also contain marker;The label
Object passes through promoter PvegRegulating and expressing.
6. the plasmid containing any inducing expression element of Claims 1 to 5.
7. a kind of genetic engineering bacterium, which is characterized in that it with bacillus subtilis is host, it is any described containing Claims 1 to 4
Inducing expression element.
8. any inducing expression element of Claims 1 to 5 is in the application in bacillus subtilis metabolic engineering field.
9. application according to claim 8, which is characterized in that activating genes of interest in the culture environment existing for sialic acid
Expression.
10. application according to claim 9, which is characterized in that be at 30~37 DEG C, 180~250rpm is cultivated at least
24h。
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910358479.9A CN110029109B (en) | 2019-04-30 | 2019-04-30 | Sialic acid induced expression element and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910358479.9A CN110029109B (en) | 2019-04-30 | 2019-04-30 | Sialic acid induced expression element and application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN110029109A true CN110029109A (en) | 2019-07-19 |
CN110029109B CN110029109B (en) | 2021-03-02 |
Family
ID=67241011
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910358479.9A Active CN110029109B (en) | 2019-04-30 | 2019-04-30 | Sialic acid induced expression element and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN110029109B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110066801A (en) * | 2019-04-30 | 2019-07-30 | 江南大学 | Sialic acid inducing expression element and construction method in a kind of bacillus subtilis |
CN112342234A (en) * | 2020-10-27 | 2021-02-09 | 江南大学 | Recombinant bacillus subtilis for regulating and controlling yield increase of N-acetylneuraminic acid |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103602627A (en) * | 2013-11-25 | 2014-02-26 | 武汉中科光谷绿色生物技术有限公司 | Novel N-acetylneuraminic acid-producing escherichia coli engineering bacteria as well as construction method and application thereof |
CN106929462A (en) * | 2017-04-25 | 2017-07-07 | 江南大学 | One kind accumulation N n acetylneuraminic acid ns recombined bacillus subtilis and its application |
CN108504678A (en) * | 2018-04-12 | 2018-09-07 | 江南大学 | A method of improving recombined bacillus subtilis chitin oligo saccharide yield |
-
2019
- 2019-04-30 CN CN201910358479.9A patent/CN110029109B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103602627A (en) * | 2013-11-25 | 2014-02-26 | 武汉中科光谷绿色生物技术有限公司 | Novel N-acetylneuraminic acid-producing escherichia coli engineering bacteria as well as construction method and application thereof |
CN106929462A (en) * | 2017-04-25 | 2017-07-07 | 江南大学 | One kind accumulation N n acetylneuraminic acid ns recombined bacillus subtilis and its application |
CN108504678A (en) * | 2018-04-12 | 2018-09-07 | 江南大学 | A method of improving recombined bacillus subtilis chitin oligo saccharide yield |
Non-Patent Citations (4)
Title |
---|
GERT PETERS等: "Development of N-acetylneuraminic acid responsive biosensors based on the transcriptional regulator NanR", 《DEVELOPMENT OF N-ACETYLNEURAMINIC ACID RESPONSIVE BIOSENSORS BASED ON THE TRANSCRIPTIONAL REGULATOR NANR》 * |
余小霞等: "枯草芽孢杆菌表达系统及其启动子研究进展", 《生物技术通报》 * |
杨森: "Bacillus subtilis基因调控表达系统构建及其在发酵工程中的应用", 《中国博士学位论文全文数据库基础科学辑》 * |
郑志永 等: "聚唾液酸和唾液酸寡糖的生物合成及其在营养食品中的应用前景", 《食品科学》 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110066801A (en) * | 2019-04-30 | 2019-07-30 | 江南大学 | Sialic acid inducing expression element and construction method in a kind of bacillus subtilis |
CN110066801B (en) * | 2019-04-30 | 2021-01-29 | 江南大学 | Sialic acid induced expression element in bacillus subtilis and construction method |
CN112342234A (en) * | 2020-10-27 | 2021-02-09 | 江南大学 | Recombinant bacillus subtilis for regulating and controlling yield increase of N-acetylneuraminic acid |
CN112342234B (en) * | 2020-10-27 | 2023-02-21 | 江南大学 | Recombinant bacillus subtilis for regulating and controlling yield increase of N-acetylneuraminic acid |
Also Published As
Publication number | Publication date |
---|---|
CN110029109B (en) | 2021-03-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN110117551B (en) | Saccharomyces cerevisiae engineering bacterium for producing valencene, and construction method and application thereof | |
KR101229418B1 (en) | Method for manufacturing active recombinant blood coagulation factor ix | |
CN112552380A (en) | Immunogen of SARS-CoV-2 virus and its application | |
CN113046355B (en) | Intermediate-temperature prokaryotic Argonaute protein PbAgo characterization and application | |
CN110029109B (en) | Sialic acid induced expression element and application | |
CN110438053B (en) | Biological sequestration system suitable for synechococcus, construction method and application | |
CN112877351A (en) | Recombinant plasmid for preventing and treating new coronavirus infection, recombinant lactobacillus expression system and application thereof | |
CN113308482B (en) | Tetrahydropyrimidine synthetic gene cluster from Yunnan tengcong and application thereof | |
CN114807202B (en) | Phage-assisted cellooligosaccharide transporter continuous directed evolution system and method | |
CN110184292A (en) | A method of yeast cell surface display functionality Infliximab Fab segment is improved using molecular chaperones | |
CN114277190B (en) | Specific DNA fragment, primer, kit and detection method for detecting exogenous gene residues in hiPSC | |
CN109872774B (en) | YESS-based method for analyzing protein interaction in prokaryote | |
CN110938648B (en) | Fungus secretion expression vector, construction method and application thereof | |
CN108277208A (en) | The vesicular stomatitis virus infection clones and preparation method and application of Carrying Green Fluorescent Protein and transferrins | |
CN109735558B (en) | Recombinant CAR19-IL24 gene, lentiviral vector, CAR19-IL24-T cell and application | |
CN107142259A (en) | A kind of promoter of expression alien gene and its application | |
CN111909850B (en) | Astaxanthin-producing engineering bacteria based on Dunaliella salina metabolic pathway and CBFD and HBFD of Adonis amurensis, construction and application thereof | |
CN112940999B (en) | Streptomyces xiamenensis and method for biologically synthesizing benzopyran and 4-hydroquinoline compounds by Streptomyces xiamenensis | |
CN114480470A (en) | Method for preparing model biological gene editing mutant with high throughput and related plasmid | |
CN115161294B (en) | Newcastle disease vaccine strain, construction method thereof, poultry immune recognition method and application | |
CN111909945B (en) | Method for improving protein expression efficiency in clostridium | |
CN111118051B (en) | Saccharomyces cerevisiae-based double-stranded RNA synthesis optimization and application | |
CN102134562B (en) | Construction and screening of rabies virus Evelyn-Rokitnicki-Abelseth (ERA) attenuated live vaccine candidate strain | |
WO1994019472A2 (en) | Bi-functional expression system | |
CN110904142A (en) | Construction technology and application method of diatom expressing shell surface anchoring protein |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |