Summary of the invention
The present invention provides a kind of specific primer of Tibetan mastiff molecular labeling and friendship precisely in order to the defect that solves the above problems
For detailed detection method, the hereditary feature of tibetan mastiff, pedigree geographic patterns, the analysis of group structure and germplasm are provided
The scientific conservation in source and utilization all have important application value.
The present invention adopts the following technical scheme that realization.
A kind of SNP marker primer, the present invention molecular labeling primer select one and include following primer pair;
TM-P1:F:TGCAAGGAGGAGGAAGAAGG,
R:CTCCCAGTCTCTTGCCTCTG;
TM-P2:F:TGCAAGGAGGAGGAAGAAGG,
R:CTCCCAGTCTCTTGCCTCTG;
TM-E:F:CATTCAGTCAGCATTTCTGC
R:GGGCTGCAGGTTGCGAGGGT;
TM-M:F:TTCTTACATGGCAGCTGGTG,
R:CTTTTCCCTGTGAGCTCTGG;
TM-M1:F:GCTGCAATCCACAATGAAGA,
R:ATGCAGTCAGAACCCCAAGT;
TM-H1:F:GAGGCTTCAAATGCCTTGAG,
R:CATGCCTTAGGGGCAGTAAA;
TM-H2:F:GAGGCTTCAAATGCCTTGAG,
R:CATGCCTTAGGGGCAGTAAA;
TM-C:F:AGTCCCCAGAAGGTTCCATG,
R:GCAACCGGTGGAAAGTTTCT;
TM-S:F:GGCCTCCATGCTTAGCTCTA,
R:AGCACCTTACAGACTCCACC;Wherein F is upstream primer, and R is downstream primer.
A kind of SNP marker primer sets, the present invention primer sets include following any two groups of primer pairs and its more than
Combination;TM-P1,TM-P2,TM-E,TM-M,TM-M1,TM-H1,TM-H2,TM-C,TM-S;For example above-mentioned record of particular sequence.
A kind of SSR molecular marker primer, the present invention molecular labeling primer select one and include following primer pair;
TM-CAS5:F:TCCCTCCTCAGCAGAGAGTC,
R:AACCTCAGGGCTATTCATTTCA;
TM-CAS6:F:TCCCTCTCCCTGTGTCTCTG,
R:CAATCCTTGAGCATGAAACG;
TM-CAS7:F:ACTGTCCTGGTGCCACCTAC,
R:CAACATCCTCTCCCCTGAAA;
TM-CAS8:F:CCACAAAAGACCCACCCATA,
R:CTTCATGGAGCCTGCTTTTC;
TM-CAS9:F:GCTTTTGCTGTGTCCCAAAG,
R:AACTGTGGCCATCATTAGCA;
TM-CAS10:F:TGGCAACATGCTGAAAGTGT,
R:AGGTGGGCTCTGTGACCATA;
TM-CAS11:F:CTCCCTCTGCCTGTCTTCTG,
R:CTTGGGTGCAGAGCTAGTCC;
TM-CAS12:F:TACATCAGCCCCTGCTTTCT,
R:TTGGCTTTAGTTCAGATGGAAG;Wherein F is upstream primer, and R is downstream primer.
A kind of SSR molecular marker primer sets, the present invention primer sets include following any two groups of primer pairs and its more than
Combination;TM-CAS5,TM-CAS6,TM-CAS7,TM-CAS8,TM-CAS9,TM-CAS10,TM-CAS11,TM-CAS12;Specifically
For example above-mentioned record of sequence.
A kind of combination SNP and SSR molecular marker primer sets, the present invention primer sets include at least two groups primer pair, it may be assumed that are drawn
Object is to A and primer pair B;The primer pair A is the primer pair belonged in SNP marker primer sets;The primer pair B is
Belong to the primer pair in SSR molecular marker primer sets;Primer pair in SNP marker primer sets is TM-P1, TM-P2, TM-
E,TM-M,TM-M1,TM-H1,TM-H2,TM-C,TM-S;For example above-mentioned record of particular sequence.Belong in SSR molecular marker primer sets
Primer pair be TM-P1, TM-P2, TM-E, TM-M, TM-M1, TM-H1, TM-H2, TM-C, TM-S;For example above-mentioned note of particular sequence
It carries.
Using above-mentioned primer or the purposes of primer sets, which is to identify or distinguish tibetan mastiff and other domesticated dogs.
The present invention provides a kind of detection method of Tibetan mastiff mononucleotide label, comprising the following steps:
(1), Tibetan mastiff genomic DNA is extracted;
(2), the genomic DNA extracted using step (1) utilizes the specificity of the Tibetan mastiff mononucleotide label as template
The specific primer of each mononucleotide polymorphic site in primer carries out PCR amplification respectively;
(3), pcr amplification product is sequenced using ABI3730 sequenator;
(4) mononucleotide polymorphic site is detected.
The present invention screens the mononucleotide polymorphic that there is Tibetan mastiff specifically to make a variation by building Tibetan mastiff group genome database
The specific primer of mononucleotide polymorphic site is designed in site, and special in Tibetan mastiff to these mononucleotide polymorphic sites
Property detected, develop 9 has the mononucleotide polymorphic site that specifically makes a variation in Tibetan mastiff.9 mononucleotide polymorphics
The number in site is respectively as follows: TM-P1, TM-P2, TM-E, TM-M, TM-M1, TM-H1, TM-H2, TM-C, TM-S;Its nucleotides sequence
Column are as shown in table 1 respectively.
Specific primer using the Tibetan mastiff mononucleotide label in the present invention (includes 50 hiding to 100 domesticated dog samples
Large fierce dog, 50 other kind of dog) it is detected, the results showed that, 9 mononucleotide polymorphic sites can be expanded effectively, amplification efficiency
Reach 100%, shows that 9 mononucleotide polymorphic sites show the special change of Tibetan mastiff using the detection of ABI3730 sequenator
It is different, illustrate that the specific primer of 9 in the present invention pairs of mononucleotides label can be used in the kind hereditary feature identification work of Tibetan mastiff
Make.
The specific primer for capableing of efficient amplification Tibetan mastiff group's mononucleotide label the invention discloses one group and detection side
Method, and the variation that mononucleotide polymorphic site of the invention has Tibetan mastiff group special, therefore, Tibetan mastiff monokaryon provided by the invention
The specific primer and detection method of thuja acid label can be applied in fields such as the kind hereditary feature identifications of Tibetan mastiff.
The present invention provides a kind of detection method of Tibetan mastiff microsatellite marker, which comprises the following steps:
(1), Tibetan mastiff genomic DNA is extracted;
(2), the genomic DNA extracted using step (1) as template, draw by the specificity using the Tibetan mastiff microsatellite marker
The specific primer of each microsatellite locus in object carries out PCR amplification respectively;
(3), polymorphic detection is carried out to pcr amplification product using ABI3730 sequenator.
The present invention screens the DNA sequence dna containing microsatellite sequence by building Tibetan mastiff group genome database, designs micro-
The specific primer in satellite site, and polymorphic detection has been carried out to these microsatellite locus, develop 8 rich polymorphisms
Tibetan mastiff microsatellite locus.The number of 8 microsatellite locus is respectively as follows: TM-CAS5, TM-CAS6, TM-CAS7, TM-CAS8, TM-
CAS9, TM-CAS10, TM-CAS11, TM-CAS12;Its nucleotide sequence difference is as shown in table 2.
Using the Tibetan mastiff microsatellite marker in the present invention specific primer to 100 domesticated dog samples (include 50 Tibetan mastiffs,
50 other kind of dog) it is detected, the results showed that, 9 microsatellite locus can be expanded effectively, and amplification efficiency reaches 100%,
Show that 9 microsatellite locus show relatively rich state property using the detection of ABI3730 sequenator, with the special change of Tibetan mastiff
Different feature, and meet Hardy-Weinberg equilibrium.Illustrate that the specific primer of 9 in the present invention pairs of microsatellite markers can be used
In work such as the identifications of kind hereditary feature, Genetic Constitution of Population analysis, Relationship iden- tification of Tibetan mastiff.
The invention discloses specific primer and detection method that one group is capable of efficient amplification Tibetan mastiff group microsatellite marker,
And microsatellite locus rich polymorphism of the invention, with the special variation of Tibetan mastiff group, therefore, Tibetan mastiff provided by the invention is micro-
The specific primer and detection method of satellite markers can be applied in the kind hereditary feature identification of Tibetan mastiff, Genetic Constitution of Population point
The fields such as analysis, Relationship iden- tification are laid a good foundation for next step molecule genetics research.
The present invention is further explained with reference to the accompanying drawings and detailed description.
Embodiment:
One, the extraction of Tibetan mastiff genomic DNA
1, preparation of reagents:
Digestion buffer: weighing Tris1.2114g, EDTA37.224g, SDS5g, with sterilizing ultrapure water constant volume 1000mL
(final concentration of Tris10mmol/L, EDTA0.1mol/L, SDS0.5%) is adjusted to pH value and saves backup to 8.0,4 degree.
2, DNA is extracted:
100 200 μ L of domesticated dog blood sample are extracted respectively, and 400 μ L is added to digest buffer, 40 μ L Proteinase K (10mg/
ML), digested 5 hours after mixing in 55 DEG C;Digest it is clear after, be added 600 μ L water-saturated phenols, be gently mixed by inversion 30 minutes,
6000rpm/min is centrifuged 10 minutes, extracts supernatant;Add 300 μ L water-saturated phenols, 300 μ L chloroforms/isoamyl alcohol (24:1), gently
It is gently mixed by inversion 30 minutes, 6000rpm/min is centrifuged 10 minutes, extracts supernatant;600 μ L chloroforms/isoamyl alcohol (24:1) is added,
It is gently mixed by inversion 30 minutes, 6000rpm/min is centrifuged 10 minutes, extracts supernatant;The isopropanol for adding 800 μ L pre-cooling, in-
20 DEG C stand overnight, and 13000rpm/min is centrifuged 10 minutes, abandon supernatant;Again plus 70% ethyl alcohol of pre-cooling, careful piping and druming washing are heavy
It forms sediment, 13000rpm/min is centrifuged 10 minutes, abandons supernatant;Ethyl alcohol is dried, 50 μ L ultrapure waters dissolution precipitating is added, is placed in -20 DEG C of guarantors
It deposits spare.
Two, the excavation of Tibetan mastiff specific single nucleotide and microsatellite molecular marker
Domesticated dog group genome database is constructed by extensive gene order-checking, by comparing Tibetan mastiff group and other families
The genome difference of dog group, the special mononucleotide polymorphic site variation of identification Tibetan mastiff and Tibetan mastiff genome are by selection region
Microsatellite locus.
Three, specific primer design
With 3 software design mononucleotide of Primer and micro-satellite primers, primer annealing temperature is controlled at 50 DEG C or more.It is single
Nucleotide PCR product length controls between 350~800bp, and microsatellite PCR product length controls between 150~500bp.
8 mononucleotide polymorphic site TM-P1, TM-P2, TM-E, TM-M, TM-M1, TM-H1, TM-C, TM-S and 1 are inserted
The primer sequence, mutation type, annealing temperature for entering deletion mutation site TM-H2 are as shown in table 1.
1. 8 mononucleotide polymorphic sites of table and the specific primer sequence of 1 insertion and deletion variant sites, mutation class
Type and annealing temperature
F indicates upstream primer in table, and R indicates downstream primer.
8 microsatellite locus CAST5, CAST6, CAST7, CAST8, CAST9, CAST10, CAST11, CAST12's draws
Object sequence, core repeat, annealing temperature is as shown in table 2.
2. 8 microsatellite locus specific primer sequences of table, core repeats and annealing temperature
F indicates upstream primer in table, and R indicates downstream primer
Four, mononucleotide polymorphic site primer and micro-satellite primers expand in domesticated dog group
PCR expansion is carried out to 100 domesticated dog samples using mononucleotide polymorphic site primer and micro-satellite primers of the invention
Increase.PCR reaction system is as shown in table 3:
Table 3.PCR reaction system
PCR response procedures are as shown in table 4.
Table 4.PCR response procedures
Five, agarose gel electrophoresis detects PCR product
1, preparation of reagents:
10 × TBE:54.495gTris, 27.81g boric acid, 14.615gEDTA, pH are adjusted to 8.0~8.2, are settled to 500ml
(final concentration 0.9mol/LTris, 0.9mol/L boric acid, 0.1mol/LEDTA), high pressure sterilization, room temperature preservation are spare;
0.5 × TBE: 10 × TBE of 50ml solution is measured, adds ultrapure water to be settled to 1000ml, room temperature preservation is spare.2, it makes
Glue:
0.2g agar Icing Sugar is weighed, 0.5 × TBE is added to be settled to 100ml (final concentration 2%), high-temperature digestion, gel sets.
3, electrophoresis
1,5 μ L 6 × loading buffer, loading after mixing, electrophoresis is added in 10 μ L of mononucleotide PCR product.Voltage
120V/cm, constant pressure electrophoresis 40 minutes.
2,0.5 μ L 6 × loading buffer, loading after mixing, electrophoresis is added in 1 μ L of microsatellite PCR product.Voltage
120V/cm, constant pressure electrophoresis 40 minutes.
The agarose gel electrophoresis of part PCR product, due to length relationship, only provides part PCR as shown in Fig. 1 a, 1b, 1c
The agarose gel electrophoresis figure of product.DNA Macker be DL2000 (be successively 2000bp, 1000bp, 750bp from top to bottom,
500bp, 250bp, 100bp)
Six, mononucleotide PCR product is sequenced
1, PCR product recycles:
Under ultraviolet light irradiation, purpose band is cut, is put into clean EP pipe, according to general " DNA product purification and recovery
The step of kit " provides is recycled and purifying.
2, sequencing reaction, reaction system such as 5 institute of table are carried out with positive downstream primer respectively using recovery product as DNA profiling
Show.
5. sequencing reaction system of table
Sequencing reaction program is as shown in table 6.
6. sequencing reaction program of table
3, sequencing reaction product is purified:
75% isopropanol of 30 μ L pre-cooling is drawn, sequencing reaction product is added, is placed 30 minutes after mixing in -20 DEG C.
It is centrifuged 30 minutes under 4 DEG C of environment with the speed of 3800rpm/min.
Supernatant is abandoned, sequencing reaction product is dried.
75 μ L ddH2O are added, places 2 hours for 4 DEG C and dissolves.
4, it is sequenced:
It is sequenced by 3730 sequenator of ABI.
Seven, allele type analysis
Eight, the allelotype of seqman software analysis SNP site is utilized
Nine, the genetic parameters of mononucleotide polymorphic site calculate
Gene frequency, observation heterozygosity and expectation heterozygosity are calculated with plink software;Whether detection site meets Kazakhstan
Enlightening-Weinberg equilibrium;Site is assessed in the differentiation degree of Tibetan mastiff group and other domesticated dog groups, calculates FSTValue.The present invention uses
It states method and obtains 9 mononucleotide polymorphic site labels, the genetic parameters of each mononucleotide polymorphic site are as shown in table 7, institute
There is site to show differentiated between Tibetan mastiff and other domesticated dog groups, and all meets Hardy-Weinberg equilibrium.
Genetic parameters of 7. mononucleotide polymorphic site of table in domesticated dog group
Nine, microsatellite PCR product length measures
1, PCR product is denaturalized:
It draws 900 μ L Hidye to be put into EP pipe, the LIZ500 endogenous control of 7.4 μ L is added, 96 holes are dispensed into after mixing
Plate, every hole add 9 μ L mixed liquors.
1 μ LPCR product is drawn to be added in the Hidye mixed liquor dispensed
95 DEG C are denaturalized 10 minutes
It is immediately placed into -20 DEG C of coolings 5 minutes
4 DEG C are placed 2 hours
2, PCR product length measurment
Length measurment is carried out by ABI3730 sequenator
Ten, the genetic parameters of microsatellite locus calculate
The length of each microsatellite PCR product is read with genescan software;Allele is calculated with geneAlEx software
Number, Population Differentiation coefficient Fst, Hardy-Weinberg equilibrium;The polymorphic letter of each microsatellite locus is calculated with Cervus3.0 software
Cease content.The present invention obtains 8 microsatellite markers in aforementioned manners, and the genetic parameters of each microsatellite locus are as shown in table 8, institute
Having site is high polymorphic locus (polymorphism information content > 0.5), and all meets Hardy-Weinberg equilibrium (P > 0.05).
Genetic parameters of 8. microsatellite locus of table in domesticated dog group
11, mononucleotide polymorphic site and microsatellite locus information cluster domesticated dog individual are integrated
The mononucleotide polymorphic site and microsatellite locus heredity letter of each domesticated dog individual are analyzed with STRUCTURE software
Breath, and all domesticated dog individuals are carried out by clustering with this.The present invention obtains 9 mononucleotide polymorphic site marks in aforementioned manners
Note, 8 microsatellite markers, the hereditary information for integrating 17 sites carries out MCMC analysis by STRUCTURE software, such as Fig. 2 institute
Show and differentiate Tibetan mastiff and other domesticated dogs, differentiates Tibetan mastiff subpopulation as shown in Figure 3.
The clustering in the site Fig. 2 .17, it is assumed that have 2 groups.
The clustering in the site Fig. 3 .17, it is assumed that have 3 groups.
Above-described is only specific embodiments of the present invention, and the common sense such as well known design parameter were not made herein in scheme
More descriptions.It should be pointed out that above-described embodiment is not limit the invention in any way, it is for those skilled in the art, all
It is that the technical solution obtained by the way of equivalent substitution or equivalent transformation is fallen within the scope of protection of the present invention.The application wants
The protection scope asked should be subject to the content of its claim, and the records such as specific embodiment in specification can be used for solving
Release the content of claim.
<110>section Tibetan mastiff germ plasm resource technological development Co., Ltd in Yunnan
<120>specific primer and detection method of Tibetan mastiff molecular labeling
<160> 34
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
TGCAAGGAGGAGGAAGAAGG
<210> 2
<211>20
<212> DNA
<213>artificial sequence
<400> 1
CTCCCAGTCTCTTGCCTCTG
<210> 3
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
TGCAAGGAGGAGGAAGAAGG
<210> 4
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
CTCCCAGTCTCTTGCCTCTG
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
CATTCAGTCAGCATTTCTGC
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
GGGCTGCAGGTTGCGAGGGT
<210> 7
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
TTCTTACATGGCAGCTGGTG
<210>8
<211>20
<212> DNA
<213>artificial sequence
<400> 1
CTTTTCCCTGTGAGCTCTGG
<210> 9
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
GCTGCAATCCACAATGAAGA
<210> 10
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
ATGCAGTCAGAACCCCAAGT
<210> 11
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
GAGGCTTCAAATGCCTTGAG
<210> 12
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
CATGCCTTAGGGGCAGTAAA
<210> 13
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
GAGGCTTCAAATGCCTTGAG
<210> 14
<211>20
<212> DNA
<213>artificial sequence
<400> 1
CATGCCTTAGGGGCAGTAAA
<210> 15
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
AGTCCCCAGAAGGTTCCATG
<210> 16
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
GCAACCGGTGGAAAGTTTCT
<210> 17
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
GGCCTCCATGCTTAGCTCTA
<210> 18
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
AGCACCTTACAGACTCCACC
<210> 19
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
TCCCTCCTCAGCAGAGAGTC
<210> 20
<211> 22
<212> DNA
<213>artificial sequence
<400> 1
AACCTCAGGGCTATTCATTTCA
<210> 21
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
TCCCTCTCCCTGTGTCTCTG
<210> 22
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
CAATCCTTGAGCATGAAACG
<210> 23
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
ACTGTCCTGGTGCCACCTAC
<210> 24
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
CAACATCCTCTCCCCTGAAA
<210> 25
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
CCACAAAAGACCCACCCATA
<210> 26
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
CTTCATGGAGCCTGCTTTTC
<210> 27
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
GCTTTTGCTGTGTCCCAAAG
<210> 28
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
AACTGTGGCCATCATTAGCA
<210> 29
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
TGGCAACATGCTGAAAGTGT
<210> 30
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
AGGTGGGCTCTGTGACCATA
<210> 31
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
CTCCCTCTGCCTGTCTTCTG
<210> 32
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
CTTGGGTGCAGAGCTAGTCC
<210> 33
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
TACATCAGCCCCTGCTTTCT
<210> 34
<211> 22
<212> DNA
<213>artificial sequence
<400> 1
TTGGCTTTAGTTCAGATGGAAG