CN109963598A

CN109963598A - The composition and method based on CRISPR/CAS9 for treating cancer

Info

Publication number: CN109963598A
Application number: CN201780054063.7A
Authority: CN
Inventors: V.贾斯库拉-兰加; D.扎克; F.班斯
Original assignee: Johns Hopkins University
Current assignee: Johns Hopkins University
Priority date: 2016-07-05
Filing date: 2017-07-05
Publication date: 2019-07-02
Also published as: MX2019000188A; US20200069818A1; KR20190039115A; CL2019000023A1; BR112019000107A2; EP3481431A1; AU2017292772A1; WO2018009525A8; WO2018009525A1; CA3029908A1; IL264034A; SG11201900028VA; JP2019520394A; EP3481431A4; EA201990214A1

Abstract

The method for preventing, inhibiting or treat the cancer in subject is described herein.The method that the expression of one of change cell, such as cancer cell or several genes product is also provided herein.This method may include the nucleic acid enzyme system using modification, such as the short palindrome of cluster aturegularaintervals repeats (CRISPR)/CRISPR correlation (Cas) 9 (CRISPR-Cas9), it includes two-way H1 promoter and for the gRNA of the oncogene (rAAV-Onco-CRISPR) or tumor suppressor gene (rAAV-TSG) that are packaged in fine and close adeno-associated virus (AAV) particle.This method may include that recombinant adeno-associated virus packaging adenovirus (Ad-rAAVpack) is co-administered or provided simultaneously with nucleic acid enzyme system.

Description

The composition and method based on CRISPR/CAS9 for treating cancer

Cross reference

This application claims the equity for the U.S. Provisional Application No. 62/358,339 that on July 5th, 2016 submits, entire contents pass through It is incorporated herein by reference.

Governmental support statement

The present invention is completed under the governmental support for the R01CA157535 that National Cancer Institute authorizes.Government possesses this hair Bright certain rights.

Background

One of the significant challenge of success or cancer-specific molecular related to efficient targeting cancer (such as gene, protein, enzyme) It is a lack of specificity.The chemotherapy in preclinical validation and reagent are effective in terms of inhibiting selected molecule at present, but It is not specific to target.In fact, this is usually the experienced undesirable and undesirable toxicity of chemotherapy The main reason for.Although strategies in gene therapy such as shRNA or siRNA is very special to molecular target, they are to tumour Selectively delivering is a significant challenge.

In addition, siRNA has the ratio inactivation with 1:1 or neutralizes the limitation of target, this will need constant and high-caliber Specific RNA is delivered to tumour.On the other hand, shRNA is once introduced into tumour, so that it may is integrated into host genome simultaneously Generate the continuous antisense scant polymer that can interfere particular target.

It is preclinical report show cancer it is molecular targeted significantly improve therapeutic effect (Gharwan, H. Groninger, H. Nat. Rev. Clin. Oncol.(2015)).However, the successful clinical conversion of most of anticancer agents is still one and chooses Fight (Rothenberg, ML et al.Nat. Rev. Cancer. 3, 303-309(2003)；Le Tourneau, C et al.Target Oncol. 5, 65-72(2010)).Although the antisense therapy method (such as siRNA, shRNA) based on nucleic acid is being divided Sub- specificity and effectively inhibit aspect that there is advantage, but certain intrinsic limitations interfere their successes in clinical application (Ganapathy-Kanniappan S et al.Mol Cancer. 2013；12: 152,4598-12-152., Pecot, CV Et al.Nat. Rev. Cancer. 11, 59-67(2011))。

Therefore, strong to need to develop in cancer treatment the Innovative therapeutic strategies with the target-specific of enhancing and combination Object.

Summary

Unless otherwise indicated, practice of the invention usually will using in the technology of this field cell biology, cell culture, Molecular biology, transgcnic biology, microbiology, recombinant nucleic acid (such as DNA) technology, immunology and RNA interference (RNAi) Routine techniques.Certain non restrictive descriptions in these technologies can be found in following publication: Ausubel, F., etc. People, (eds.),Current Protocols in Molecular Biology, Current Protocols in Immunology, Current Protocols in Protein Science, andCurrent Protocols in Cell Biology, all it is the version in Sons, N.Y., 2008 years December of John Wiley；Sambrook, Russell, and Sambrook, Molecular Cloning. A Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 2001；Harlow, E. and Lane, D., Antibodies- A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1988；Freshney, R. I., "Culture of Animal Cells, A Manual of Basic Technique", 5th edition, John Wiley & Sons, Hoboken, N.J., 2005.About the non-limiting of therapeutic agent and human diseases Information can in the The Pharmacological Basis of Therapeutics of Goodman and Gilman, the 11st edition, McGraw Hill, 2005, Katzung, B.(ed.) Basic and Clinical Pharmacology, McGraw- Hill/Appleton Lange the 10th edition (2006) is found in the 11st edition (in July, 2009).About gene and genetic block Non-limiting information can find in the following: McKusick, V. A.:Mendelian Inheritance in Man. A Catalog of Human Genes and Genetic Disorders. Baltimore:Johns Hopkins University Press, 1998 (the 12nd editions) or online database more recently: Online Mendelian Inheritance in Man, OMIM™. McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University(Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine(Bethesda, Md.), 2010 On May 1, in (can be in World Wide Web:http: being obtained on //www.ncbi.nlm.nih.gov/omim/) and Online Mendelian Inheritance in Animals (OMIA) (gene of animal species (people and mouse except), heredity The database of obstacle and feature, can be in World Wide Web:http: //omia.angis.org.au/contact.shtml On obtain).All patents, patent application and the other publications being mentioned above are (for example, Science article, books, website and data Library) it is integrally incorporated by reference.It, should be with specification if there is conflict between specification and any bibliography being incorporated to Subject to (including its any modification, can be based on the bibliography being incorporated to).Unless otherwise stated, using the sheet of standard herein The term meaning that field receives.The standardized abbreviations of various terms is used herein.

The method for treating cancer is described herein.This method uses between the nucleic acid enzyme system modified, such as cluster rule (CRISPR)/CRISPR correlation (Cas) 9 (CRISPR-Cas9) is repeated every the short palindrome, for targeting oncogene mutation in the treatment Or repair deficiency tumor suppressor gene.Gene editing based on CRISPR-Cas9, which can be used for inactivating or correcting, leads to cancer Oncogene mutation, to provide the gene therapy method for being used for treating cancer potential cause.

Therefore, one aspect of the present invention is related to preventing, the method for inhibiting or treating the cancer in subject, this method packet The nucleic acid enzyme system (for example, CRISPR-Cas9) that therapeutically effective amount is applied to subject is included, it includes genome targeted nucleases (for example, Cas9 albumen) and comprising at least one target gene group sequence, such as Cancer-causing mutation (such as rAAV-Onco- ) or the guide RNA of tumor suppressor gene (such as rAAV-TSG) CRISPR.This method, which may further include, to be had in vivo The adenovirus of the ability of recombinant adeno-associated virus is packed (for example, adeno-associated virus packs adenovirus；" Ad-rAAVpack ") with RAAV-Onco-CRISPR or rAAV-TSG is combined or is co-administered simultaneously, as described herein.

Another aspect of the present invention provides the method for prevention, inhibition or treating cancer, using comprising previously in WO2015/ The combination of the modification of non-naturally occurring CRISPR-Cas system described in 195621 (being incorporated herein by reference in their entirety) Object.This modification uses certain gRNA of target on cancer Cancer-causing mutation, such as, but not limited to KRAS, PIK3CA or IDH1, or swollen Mutation in tumor suppressor.In some embodiments, composition includes that (a) is deposited comprising the non-natural of one or more carriers Nucleic acid enzyme system (for example, CRISPR-Cas9), the carrier includes: i) being operably connected at least one coding core The promoter (for example, two-way H1 promoter) of the nucleotide sequence of sour enzyme system guide RNA (gRNA), wherein gRNA and subject Cell in DNA molecular target sequence hybridization, and wherein one or more genes for expressing in cell of DNA molecular coding produce Object；Ii) be operably connected to the nucleotide sequence of encoding gene group targeted nuclease (such as Cas9 albumen) in cell Operable regulating element, wherein component (i) and (ii) are located on the identical or different carrier of system, wherein gRNA target and with Target sequence hybridization, and nuclease cutting DNA molecule is to change the expression of one or more gene products.In some embodiments In, it is simultaneously or total that adeno-associated virus packs adenovirus (for example, Ad-rAAVpack) and the adeno-associated virus containing nucleic acid enzyme system With application.Ad-rAAVpack can also with not code nucleic acid enzyme-gRNA system, but coding can promote tumour destruction or Increase immune system the rAAV of the gene of the identification of tumour is used together.For example, Ad-rAAVpack can instruct coding to turn base Because of the packaging of the companion rAAV of such as interferon-' alpha ' or wild type p53.For example, AAV-onco-CRISPR or AAV-TSG can be independent Or delivering of connecting with Ad-rAAVpack.In contrast, Ad-rAAVpack can be used together with any rAAV, no matter it whether It is engineered to deliver nuclease-gRNA.In some embodiments, nucleic acid enzyme system is packaged into single adeno-associated virus (AAV) in particle.In some embodiments, promoter includes: a) the one of the nucleotide sequence of at least one coding gRNA The control element of transcription is provided on a direction；And b) in the opposite direction of the nucleotide sequence of encoding gene group targeted nuclease The control element of transcription is provided.

Another aspect of the present invention provides the method for changing one of eukaryocyte or several genes product expression, wherein The cell includes the DNA molecular for encoding one or more gene products, and the method includes introducing into the cell The previously non-naturally occurring CRISPR- of the modification described in WO2015/195621 (being incorporated herein by reference in their entirety) Cas system.This modification uses targeting Cancer-causing mutation, such as, but not limited to KRAS, PIK3CA or IDH1 or tumor suppressor gene Certain gRNA.In some embodiments, the method includes introducing composition into cell, the composition includes (a) Non-naturally occurring nucleic acid enzyme system (for example, CRISPR-Cas9) comprising one or more carriers, the carrier includes: i) The promoter of the nucleotide sequence of at least one code nucleic acid enzyme system guide RNA (gRNA) is operably connected to (for example, double To H1 promoter), wherein gRNA hybridizes with the target sequence of the DNA molecular in the cell of subject, and wherein DNA molecular coding one Kind or a variety of gene products expressed in cell；And ii) be operably connected to encoding gene group targeted nuclease (for example, Cas9 albumen) nucleotide sequence the operable regulating element in cell, wherein component (i) and (ii) are located at the phase of system On same or different carriers, wherein gRNA is targeted and is hybridized with target sequence, and nuclease cutting DNA molecule is one or more to change The expression of gene product.In some embodiments, adeno-associated virus is packed adenovirus (for example, Ad-rAAVpack) and is contained The adeno-associated virus of nucleic acid enzyme system while or co-administration.In some embodiments, nucleic acid enzyme system is packaged into individually In adeno-associated virus (AAV) particle.In some embodiments, promoter includes: a) in the nucleosides of at least one coding gRNA The control element of transcription is provided on one direction of acid sequence；And b) in the nucleotide sequence of encoding gene group targeted nuclease The control element of transcription is provided in opposite direction.

One aspect of the present invention is related to preventing, the method for inhibiting or treating the cancer in subject in need, the party Method includes:

(a) the non-naturally occurring nucleic acid enzyme system comprising one or more carriers is provided, the carrier includes: i) operationally Be connected to the promoter of the nucleotide sequence of at least one code nucleic acid enzyme system guide RNA (gRNA), wherein the gRNA with The target sequence of DNA molecular in the cell of subject hybridizes, and the one or more cancers wherein expressed in DNA molecular Codocyte Gene product；And ii) nucleotide sequence that is operably connected to encoding gene group targeted nuclease can operate in cell Regulating element, wherein component (i) and (ii) are located on the identical or different carrier of system, and wherein gRNA targeting is simultaneously and target sequence Hybridization and nuclease cutting DNA molecule is to change the expression of one or more gene products；(b) applying treatment to subject has The system of effect amount.

In some embodiments, this method further includes providing recombinant adeno-associated virus packaging adenovirus (Ad- RAAVpack) the step of.

In some embodiments, Ad-rAAVpack and nucleic acid enzyme system are provided or are co-administered simultaneously.

In some embodiments, which is CRISPR-Cas9.

In some embodiments, system is packaged into single adeno-associated virus (AAV) particle.

In some embodiments, adeno-associated virus packaging adenovirus includes at least one of adenoviral gene missing.

In some embodiments, adeno-associated virus packaging adenovirus is selected from adenoviral serotype 2, adenoviral serotype 5 Or adenoviral serotype 35.

In some embodiments, packaging virus is adenoviral serotype 5.

In some embodiments, adenoviral gene is selected from E1A, E1B, E2A, E2B, E3, E4, L1, L2, L3, L4 or L5.

In some embodiments, adenoviral gene is E3.

In some embodiments, which inactivate one or more gene products.

In some embodiments, nucleic acid enzyme system cuts off at least one gene mutation.

In some embodiments, promoter is H1 promoter.

In some embodiments, H1 promoter is two-way.H1 promoter is pol II and pol III promoter two Person.

In some embodiments, H1 promoter includes: a) at one of the nucleotide sequence of at least one coding gRNA The control element of transcription is provided on direction；And it b) is above mentioned in the opposite direction of the nucleotide sequence of encoding gene group targeted nuclease For the control element of transcription.

In some embodiments, the nuclease of genome targeting is Cas9 albumen.

In some embodiments, Cas9 albumen is through codon optimization to express in cell.

In some embodiments, promoter is operably connected at least one, and two, three, four, five, six It is a, seven, eight, nine or ten gRNA.

In some embodiments, target sequence is oncogene or tumor suppressor gene.

In some embodiments, target sequence is the oncogene comprising at least one mutation.

In some embodiments, target sequence is to be selected from Her2, PIK3CA, KRAS, HRAS, IDH1, NRAS, EGFR, MDM2, TGF-β, RhoC, AKT, c-myc, beta-catenin, PDGF, C-MET, PI3K-110 α, CDK4, cyclin B1, cyclin D1, female hormone receptor gene, Progesterone receptor gene, ErbB1 (v-erb-b2 into erythrocyte leukemia disease Malicious oncogene homologue 1), ErbB3 (v-erb-b2 into erythrocyte leukemia viral oncogene homolog 3), PLK3, KIRREL, ErbB4 (v-erb-b2 into erythrocyte leukemia viral oncogene homolog 4), TGFα, ras-GAP, Shc, Nck, Src, Yes, The oncogene of Fyn, Wnt, Bcl2, PyV MT antigen and SV40 T antigen.

In some embodiments, target sequence is the oncogene selected from KRAS, PIK3CA or IDH1.

In some embodiments, target sequence is oncogene, and the oncogene is KRAS.

In some embodiments, KRAS includes the mutation selected from G13D, G12C or G12D.

In some embodiments, target sequence is selected from SEQ ID NO:11-14, or combinations thereof.

In some embodiments, target sequence is oncogene, and the oncogene is PIK3CA.

In some embodiments, PIK3CA includes the mutation selected from E345K, D549N or H1047R.

In some embodiments, target sequence is selected from SEQ ID NO:15-18, or combinations thereof.

In some embodiments, target sequence is oncogene, and the oncogene is IDH1.

In some embodiments, IDH1 is mutated comprising R132H.

In some embodiments, gRNA sequence is selected from nucleotide sequence shown in SEQ ID NO:1-10, or combinations thereof.

In some embodiments, nucleic acid enzyme system is given by systemic administration.

In some embodiments, systemic administration is selected from oral, intravenously, intradermal, and in peritonaeum, subcutaneous and intramuscular is applied With.

In some embodiments, it is applied in nuclease system tumor or around tumour.

In some embodiments, at least one other anti-cancer agent therapy of the subject.

In some embodiments, anticancer agent be selected from taxol, cis-platinum, Hycamtin, gemcitabine, bleomycin, according to Support pool glycosides, carboplatin, docetaxel, Doxorubicin, Hycamtin, cyclophosphamide, tributidine, olaparib, tamoxifen are come Bent azoles and bevacizumab.

In some embodiments, the subject is treated at least one other anti-cancer therapies.

In some embodiments, anti-cancer therapies are radiation-therapy, chemotherapy or operation.

In some embodiments, cancer is solid tumor.

In some embodiments, cancer is selected from the cancer of the brain, human primary gastrointestinal cancers, carcinoma of mouth, breast cancer, oophoroma, prostate cancer, pancreas Gland cancer, lung cancer, liver cancer, throat cancer, gastric cancer and kidney.

In some embodiments, cancer is the cancer of the brain.

In some embodiments, subject is mammal.

In some embodiments, mammal is people.

In some embodiments, the cell Proliferation in subject is suppressed or reduces.

In some embodiments, the malignant tumour in subject is suppressed or reduces.

In some embodiments, neoplasm necrosis enhancing or increase in subject.

Another aspect of the present invention relates to the methods for changing one or more gene product expressions in cell, wherein described thin Born of the same parents include the DNA molecular for encoding one or more gene products, and the method includes introducing into cell: (i) includes one The non-naturally occurring nucleic acid enzyme system of kind or variety carrier, the carrier includes: a) being operably connected at least one volume The promoter of the nucleotide sequence of code nuclease systematic direction RNA (gRNA), wherein gRNA hybridizes with the target sequence of DNA molecular； With

B) it is operably connected to the operable adjusting member in cell of the nucleotide sequence of encoding gene group targeted nuclease Part,

Wherein component (a) and (b) are located on the identical or different carrier of system, and wherein gRNA is targeted and hybridized with target sequence, and Nuclease cutting DNA molecule is to change the expression of one or more gene products.

In some embodiments, this method further includes providing recombinant adeno-associated virus packaging adenovirus (Ad- rAAVpack)。

In some embodiments, which is CRISPR-Cas9.

In some embodiments, packaging virus includes at least one of adenoviral gene missing.

In some embodiments, adenovirus packaging virus is adenoviral serotype 5.

In some embodiments, adenoviral gene is E3.

In some embodiments, which inactivate one or more gene products.

In some embodiments, promoter is H1 promoter.

In some embodiments, H1 promoter is two-way.

In some embodiments, the nuclease of genome targeting is Cas9 albumen.

In some embodiments, target sequence is oncogene or tumor suppressor gene.

In some embodiments, target sequence is to be selected from EP300, FBXW7, GATA1, GATA2, NOTCH1, NOTCH2, EXT1, EXT2, PTCH1, SMO, SPOP, SUFU, APC, AXIN1, CDH1, CTNNB1, EP300, FAM123B, GNAS, HNF1A, NF2, PRKAR1A, RNF43, SOX9, ARID1A, ARID1B, ARID2, ASXL1, ATRX, CREBBP, DNMT1, DNMT3A, EP300, EZH2, H3F3A, HIST1H3B, IDH1, IDH2, KDM5C, KDM6A, MEN1, MLL2, MLL3, NCOA3, NCOR1, PAX5, PBRM1, SETD2, SETBP1, SKP2, SMARCA4, SMARCB1, SPOP, TET2, WT1, AR, BCOR, CREBBP, DAXX, DICER1, GATA3, IKZF1, KLF4, LMO1, PHOX2B, PHF6, PRDM1, RUNX1, SBDS, SF3B1, SRSF2, U2AF1, ABL1, BCL2, CARD11, CASP8, CCND1, CDC73, CDK4, CDKN2A, CDKN2C, CYLD, DAXX, FUBP1, MDM2, MDM4, MED12, MYC, MYCL1, MYCN, MYD88, NFE2L2, NPM1, PPM1D, PPP2R1A, RB1, TNFAIP3, TRAF7, TP53, ALK, B2M, BRAF, CBL, CEBPA, CSF1R, CIC, EGFR, ERBB2, FGFR2, FGFR3, FH, FLT3, GNA11, GNAQ, GNAS, HRAS, KIT, KRAS, MAP2K1, MAP3K1, MET, NRAS, NF1, PDGFRA, PTPN11, RET, SDH5, SDH8, SDHC, SDHD, VHL, AKT1, ALK, B2M, CBL, CEBPA, CSF1R, EGFR, ERBB2, FGFR2, FGFR3, FH, FLCN, FLT3, GNA11, GNAQ, GNAS, GPC3, KIT, MET, NKX21, PRKAR1A, PIK3CA, PIK3R1, PDGFRA, PTEN, RET, SDH5, SDH8, SDHC, SDHD, STK11, TSC1, TSC2, TSHR, VHL, WAS, CRLF2, FGFR2, FGFR3, FLT3, JAK1, JAK2, JAK3, KIT, MPL, SOCS1, VHL, B2M, CEBPA, ERK1, GNA11, GNAQ, MAP2K4, MAP3K1, NKX21, TNFAIP3, TSHR, WAS, ACVR1B, BMPR1A, FOXL2, GATA1, GATA2, GNAS, EP300, MED12, SMAD2, SMAD4, ATM, BAP1, BLM, BRCA1, BRCA2, BRIP1, BUB1B, CHEK2, ERCC2, ERCC3, ERCC4, ERCC5, FANCA, FANCC, FANCD2, FANCE, FANCF, FANCG, MLH1, MSH2, MSH6, MUTYH, NBS1, The cancer of PALB2, PMS1, PMS2, RECQL4, STAG2, TP53, WRN, XPA and XPC drive gene.

In some embodiments, target sequence is oncogene, and the oncogene is KRAS.

In some embodiments, target sequence is oncogene, and the oncogene is PIK3CA.

In some embodiments, target sequence is oncogene, and the oncogene is IDH1.

In some embodiments, IDH1 is mutated comprising R132H.

In some embodiments, the expression of one or more gene products is lowered.

In some embodiments, cell is eukaryon or non-eukaryocyte.

In some embodiments, eukaryocyte is mammal or people's cell.

In some embodiments, eukaryocyte is cancer cell.

In some embodiments, the cell Proliferation in cell is suppressed or reduces.

In some embodiments, the Apoptosis in cell is enhanced or increases.

The some aspects of presently disclosed theme have been stated herein above, entirely or partly by presently disclosed master The key to exercises is determined, and when combining the appended embodiment and attached drawing being such as most preferably described below to be described, other aspects be will be apparent.

Brief description

Presently disclosed theme is generally described, with reference to the drawings, the drawings are not necessarily drawn to scale, and its In:

Fig. 1 shows the relationship between Ad and AAV.Wild type AAV can only be proliferated in the cell that Ad infects.The cause of wild type AAV It is two genes (right side) that opposing end repeats (ITR) that close single stranded DNA genome, which contains flank,.AAV replicates remaining required Genetic elements are by the trans- offer of Ad.Wild type Ad causes self limiting lytic infection, and the virus modified is commonly used as transgenosis The carrier of delivering.

Fig. 2 shows Geminivirus genes delivery system.Other than other trans factors needed for AAV duplication, recombinant virus Ad- RAAVpack also expresses AAV rep and cap.Therefore, Ad-rAAVpack promotes the internal duplication of the rAAV of coinfection.These companions Companion rAAV can be equipped with CRISPR-Cas9 element or transgenosis, such as tumor suppressor.This two virus system can be used for It is proliferated any kind of rAAV in vivo.

Fig. 3 shows the dual viral methods of molten cancer therapy.Ad-rAAVpack is applied to tumour together with companion rAAV, should RAAV is programmed to the driving mutation of target tumor specificity.RAAV will not influence the tumour without mutation.Due to passing through E1B The host range limitation that mutation applies, Ad-rAAVpack will be selectively proliferated in tumour cell.It has been displayed several in E1B A mutation assigns host range limitation.In some embodiments, using the tetramino acid mutation (Chahal of referred to as sub19Et al.( 2013) 87:4432-44.It will be cracked with the cell of Ad-rAAVpack production infection, the Ad- that will newly replicate RAAVpack and rAAV introduces local environment.It, only will be by growth inhibition with the cell that rAAV infects due to driving the forfeiture of gene. These cells can increase the immunogenicity of tumour.

Fig. 4 includes three figures, A, B and C, and the nuclease of display RNA guidance is used for the purposes of the carcinogenic inactivation of KRAS.

Fig. 5 includes two figures, A and B, and the nuclease of display RNA guidance is used for the purposes of the carcinogenic inactivation of PIK3CA.

It is described in detail

It is described more fully hereinafter with presently disclosed theme with reference to the drawings, presently disclosed theme is described in detail in attached drawing Some but not all embodiments.Identical number refers to identical element always.Presently disclosed theme can be with many Different forms embodies and should not be construed as being limited to embodiments set forth herein；On the contrary, providing these embodiments makes Applicable legal requirement will be met by obtaining the disclosure.In fact, presently disclosed theme those skilled in the art will be appreciated that The many modifications and other embodiments of presently disclosed theme set forth herein, with being in foregoing description and relevant drawings The benefit of existing introduction.It will thus be appreciated that presently disclosed theme is not limited to disclosed specific embodiment, and modify It is intended to include within the scope of the appended claims with other embodiments.

Genome editing technique, such as Zinc finger nuclease (ZFN) (Porteus and Baltimore (2003)Science 300: 763；Miller et al. (2007)Nat. Biotechnol.25:778-785；Sander et al. (2011)Nature Methods8:67-69；Wood et al. (2011)Science333:307) and activating transcription factor sample effect nuclease (TALEN) (Wood et al. (2011)Science333:307；Boch et al. (2009)Science326:1509-1512； Moscou and Bogdanove (2009)Science326:1501；Christian et al. (2010)Genetics 186: 757-761；Miller et al. (2011)Nat. Biotechnol. 29:143-148；Zhang et al. (2011)Nat. Biotechnol.29:149-153；Reyon et al. (2012)Nat. Biotechnol.Production 30:460-465) is assigned The ability of raw targeted genomic modification simultaneously provides the potentiality of accurate correction disease mutation.Although effectively, these technologies are by reality The obstruction of limitation, because ZFN and TALEN is to requiring to synthesize big and unique identification albumen for given DNA target site.Most Nearly several groups, which report, carries out high efficiency gene group editor, the system gram by using engineering II type CRISPR/Cas9 system These critical limitations (Cong et al. (2013) is takenScience339:819-823；Jinek et al. (2013)eLife 2: e00471；Mali et al. (2013)Science339:823-826；Cho et al. (2013)Nat. Biotechnol. 31: 230-232；Hwang et al. (2013)Nat. Biotechnol.31:227-229).With it is relatively time-consuming and be difficult to prepare ZFN and TALEN is different, the CRISPR structure of the nuclease dependent on the Cas9 albumen with synthesis guide RNA (gRNA) coupling Body is built to synthesize simple and quick and can multiplex.However, CRISPR has can with it although their synthesis is relatively easy The relevant technical restriction of the acquisition in target gene group space, this is the function of the property of Cas9 itself He the synthesis of its gRNA.

It is needed by the cutting of CRISPR system by gRNA base adjacent with 20 nucleotide DNA sequences and required protospacer Sequence (PAM) carries out complementary base pairing, and PAM is the short nucleotide motif (Jinek et al. (2012) found at the 3' of target site Science 337:816-821).Theoretically, any unique N in CRISPR technology target gene group can be used in people₂₀- PAM sequence.The DNA binding specificity (changing depending on the playing source category of specific Cas9 used) of PAM sequence provides one about Beam.Currently, restricted minimum and most common Cas9 albumen comes from micrococcus scarlatinae, sequence NGG is identified, and therefore, it can With unique 21- nucleotide sequence any in target gene group, followed by two guanosine nucleotide (N₂₀NGG).By protein group The extension for the available target space forced is divided to be limited to find and using the novel C as9 albumen (Cong with the PAM changed requirement Et al. (2013)Science339: 819-823；Hou et al. (2013)Proc. Natl. Acad. Sci. U.S.A., 110 (39): 15644-9), or wait and generate novel C as9 variant via mutagenesis or directed evolution.Second of CRISPR system Technical restriction is derived from the gRNA expression originated at 5 ' guanosine nucleotides.The use of type III rna plymerase iii starting subcategory It is expressed particularly suitable for gRNA, because these short non-coding transcripts have specific end, and all required members transcribed Part excludes 1+ nucleotide, is included in upstream promoter region.However, since common U6 promoter needs guanosine nucleotide Starting transcription, further limits GN using U6 promoter₁₉Genome target site (Mali et al. (2013) of NGGScience 339:823-826；Ding et al. (2013)Cell Stem Cell12:393-394).Alternative, such as by T7, T3 or The in-vitro transcription of SP6 promoter, it is also desirable to start one or more guanosine nucleotides (Adhya et al. (1981)Proc. Natl. Acad. Sci. U.S.A.78:147-151；Melton et al. (1984)Nucleic Acids Res. 12: 7035-7056；Pleiss et al. (1998)RNA 4:1313-1317)。

Presently disclosed theme is related to the modification of CRISPR/Cas9 system to target Cancer-causing mutation or tumor suppressor gene, It expresses guide RNA (gRNA or sgRNA) (WO2015/19561 is incorporated herein by reference in their entirety) using H1 promoter. The combination of the CRISPR/Cas9 system of this modification and recombination gland related packaging virus can be accurately carcinogenic in target on cancer Mutation, or promote the reparation of defect tumor suppressor gene, have effects that higher, safety and precision.In addition, the modification provides Close CRISPR/Cas9 system, allows relative to existing CRISPR, TALEN or the cancer base of zinc finger technology higher resolution Because of targeting.

Therefore, one aspect of the present invention is related to the adenovirus (Ad) with replication capacity, recombinates gland phase containing companion All trans elements needed for closing the duplication and packaging of viral (rAAV).The Geminivirus system allows two kinds of viral inline copies, And to promote rAAV to apply the local multiplication in site in vivo.In some embodiments, which includes Ad E1B gene In mutation, for the part limitation to cancer cell, and therefore will promote equipped with driving gene specific CRISPR or design For preventing the tumour-specific proliferation of the rAAV of other genetic elements of cancer cell multiplication.

Not yet report double Ad-AAV systematic differences of any purposes.The novel place of the system is to make uniformly non- The therapeutic rAAV of duplication has replication capacity.

Another aspect of the present invention relates to can with target function be mutated obtain composition, known to facilitate many types The growth of cancer.The many Cancer-causing mutations found in common cancer are recurrent in nature, that is, in the cancer of given type Identical mutation occurs in disease in high proportion.The effort of targeting recurrent cancer gene mutation at present generallys use small molecule suppression Preparation or the tactful synthetic lethal to realize DNA damage.For example, most common oncogene KRAS is not yet successfully targeted, and still It is so " pharmaceutically unacceptable ".This composition includes gRNA, instructs the effective nuclease in several most common mutational sites (that is, Cas9) mediates cutting.It is worth noting that, these compositions comprising gRNA have high special to mutation allele Property, and therefore the cell with wild-type allele will be had little effect.

I. CRISPR guide RNA is expressed using H1 promoter

A. composition

In some embodiments, for preventing, inhibit or the presently disclosed method for the treatment of cancer is utilized comprising previously existing The composition of the modification of non-naturally occurring CRISPR-Cas system described in WO2015/195621 is (whole simultaneously by reference Enter herein).This modification uses targeting Cancer-causing mutation, such as, but not limited to KRAS, PIK3CA or IDH1 or tumor suppressor gene Certain gRNA.In some embodiments, composition includes the non-naturally occurring nucleic acid that (a) includes one or more carriers Enzyme system (for example, CRISPR-Cas9), the carrier includes: i) being operably connected at least one code nucleic acid enzyme system The promoter (for example, two-way H1 promoter) of the nucleotide sequence of guide RNA (gRNA), wherein in the cell of gRNA and subject DNA molecular target sequence hybridization, and wherein DNA molecular encodes one or more gene products for expressing in cell；Ii) may be used It is operatively coupled to the operable in cell of the nucleotide sequence of encoding gene group targeted nuclease (for example, Cas9 albumen) Regulating element, wherein component (i) and (ii) are located on the identical or different carrier of system, and wherein gRNA is targeted and miscellaneous with target sequence It hands over, and nuclease cutting DNA molecule is to change the expression of one or more gene products.In some embodiments, gland is related Virus packaging adenovirus (such as Ad-rAAVpack) and the adeno-associated virus for containing nucleic acid enzyme system (i.e. Geminivirus packaging system) Simultaneously or it is co-administered.In some embodiments, the single adeno-associated virus (AAV) for not having packaging adenovirus will be used Grain.In some embodiments, adeno-associated virus (AAV) may include 11 kinds of people's adeno-associated virus serotypes (such as serotype 1- Any one of 11).In some embodiments, adenovirus (AAV) may include any in 51 kinds of human Adenovirus serotypes It is a kind of.It in some embodiments, include gland for the adenovirus of packaging in vivo rAAV (i.e. adeno-associated virus packaging adenovirus) At least one of viral gene missing.In some embodiments, packaging adenovirus is selected from adenoviral serotype 2, adenovirus Serotype 5 or adenoviral serotype 35.In some embodiments, gland related packaging adenovirus is adenoviral serotype 5.One In a little embodiments, adenoviral gene is selected from E1A, E1B, E2A, E2B, E3, E4, L1, L2, L3, L4 or L5.In some embodiment party In case, adenoviral gene is E3.In some embodiments, which inactivate one or more gene products.In some realities It applies in scheme, nucleic acid enzyme system cuts off at least one gene mutation.In some embodiments, promoter includes: a) at least It is a kind of encode gRNA nucleotide sequence a direction on the control element of transcription is provided；And core b) is targeted in encoding gene group The control element of transcription is provided in the opposite direction of the nucleotide sequence of sour enzyme.In some embodiments, Cas9 albumen is through close Numeral optimizes to express in cell.In some embodiments, promoter is operably connected at least one, and two, three It is a, four, five, six, seven, eight, nine or ten gRNA.In some embodiments, target sequence be oncogene or Tumor suppressor gene.In some embodiments, target sequence is the oncogene comprising at least one mutation.In some embodiments In, target sequence is selected from Her2, PIK3CA, KRAS, HRAS, IDH1, NRAS, EGFR, MDM2, TGF-β, RhoC, AKT, c- Myc, beta-catenin, PDGF, C-MET, PI3K-110 α, CDK4, cell periodic protein B 1, cyclin D1, estrogen Acceptor gene, Progesterone receptor gene, ErbB1 (v-erb-b2 into erythrocyte leukemia viral oncogene homolog 1), ErbB3 (v- Erb-b2 into erythrocyte leukemia viral oncogene homolog 3), PLK3, KIRREL, ErbB4 (the white blood of v-erb-b2 erythroblast Sick viral oncogene homolog 4), TGFα, ras-GAP, Shc, Nck, Src, Yes, Fyn, Wnt, Bcl2, PyV MT antigen, and The oncogene of SV40 T antigen.In some embodiments, target sequence is to be selected from EP300, FBXW7, GATA1, GATA2, NOTCH1, NOTCH2, EXT1, EXT2, PTCH1, SMO, SPOP, SUFU, APC, AXIN1, CDH1, CTNNB1, EP300, FAM123B, GNAS, HNF1A, NF2, PRKAR1A, RNF43, SOX9, ARID1A, ARID1B, ARID2, ASXL1, ATRX, CREBBP, DNMT1, DNMT3A, EP300, EZH2, H3F3A, HIST1H3B, IDH1, IDH2, KDM5C, KDM6A, MEN1, MLL2, MLL3, NCOA3, NCOR1, PAX5, PBRM1, SETD2, SETBP1, SKP2, SMARCA4, SMARCB1, SPOP, TET2, WT1, AR, BCOR, CREBBP, DAXX, DICER1, GATA3, IKZF1, KLF4, LMO1, PHOX2B, PHF6, PRDM1, RUNX1, SBDS, SF3B1, SRSF2, U2AF1, ABL1, BCL2, CARD11, CASP8, CCND1, CDC73, CDK4, CDKN2A, CDKN2C, CYLD, DAXX, FUBP1, MDM2, MDM4, MED12, MYC, MYCL1, MYCN, MYD88, NFE2L2, NPM1, PPM1D, PPP2R1A, RB1, TNFAIP3, TRAF7, TP53, ALK, B2M, BRAF, CBL, CEBPA, CSF1R, CIC, EGFR, ERBB2, FGFR2, FGFR3, FH, FLT3, GNA11, GNAQ, GNAS, HRAS, KIT, KRAS, MAP2K1, MAP3K1, MET, NRAS, NF1, PDGFRA, PTPN11, RET, SDH5, SDH8, SDHC, SDHD, VHL, AKT1, ALK, B2M, CBL, CEBPA, CSF1R, EGFR, ERBB2, FGFR2, FGFR3, FH, FLCN, FLT3, GNA11, GNAQ, GNAS, GPC3, KIT, MET, NKX21, PRKAR1A, PIK3CA, PIK3R1, PDGFRA, PTEN, RET, SDH5, SDH8, SDHC, SDHD, STK11, TSC1, TSC2, TSHR, VHL, WAS, CRLF2, FGFR2, FGFR3, FLT3, JAK1, JAK2, JAK3, KIT, MPL, SOCS1, VHL, B2M, CEBPA, ERK1, GNA11, GNAQ, MAP2K4, MAP3K1, NKX21, TNFAIP3, TSHR, WAS, ACVR1B, BMPR1A, FOXL2, GATA1, GATA2, GNAS, EP300, MED12, SMAD2, SMAD4, ATM, BAP1, BLM, BRCA1, BRCA2, BRIP1, BUB1B, CHEK2, ERCC2, ERCC3, ERCC4, ERCC5, FANCA, FANCC, FANCD2, FANCE, FANCF, FANCG, MLH1, MSH2, The cancer of MSH6, MUTYH, NBS1, PALB2, PMS1, PMS2, RECQL4, STAG2, TP53, WRN, XPA and XPC drive base Cause.In some embodiments, target sequence is the oncogene selected from KRAS, PIK3CA or IDH1.In some embodiments, target Sequence is oncogene, and the oncogene is KRAS.In some embodiments, KRAS includes selected from G13D, G12C or G12D Mutation.In some embodiments, target sequence is selected from SEQ ID NO:11-14, or combinations thereof.In some embodiments, target Sequence is oncogene, and the oncogene is PIK3CA.In some embodiments, PIK3CA include be selected from E345K, D549N or The mutation of H1047R.In some embodiments, target sequence is selected from SEQ ID NO:15-18, or combinations thereof.In some embodiment party In case, target sequence is oncogene, the oncogene IDH1.In some embodiments, IDH1 is mutated comprising R132H.Some In embodiment, gRNA sequence is selected from nucleotide sequence shown in SEQ ID NO:1-10, or combinations thereof.

In some embodiments, Geminivirus packaging system allows therapeutic rAAV iteration duplication in vivo.In some realities Apply in scheme, Geminivirus packaging system include referred to as Ad-rAAVpack adenovirus 5, wherein the rep from wild type AAV and Cap gene replaces Ad E3 gene.Ad E3 typically serves to the effect for responding viral escape host immune, but is not cracking infection With packaging AAV necessary to.Because rep-cap box only announcing completely by ~ lkb bigger than E3 gene, the total size of Ad-rAAVpack Ad bale capacity in.Ad-rAAVpack, which has, to be replicated and packaging companion rAAV (such as rAAV-TSG or rAAV-Onco- CRISPR all trans elements needed for).Allow rAAV in body with Ad-rAAVpack and therapeutic rAAV co-infection target tissue Interior proliferation potentially increases the efficiency of transgene delivery.

In some embodiments, presently disclosed prevention, inhibits or treating cancer utilizes and includes one or more carriers Non-naturally occurring CRISPR-Cas system, the carrier includes: a) being operably connected at least one coding CRISPR- The H1 promoter of the nucleotide sequence of Cas System guides RNA (gRNA), the wherein target sequence of the DNA molecular in gRNA and cell Hybridization, and wherein DNA molecular encodes the one or more gene products expressed in cell；And b) it is operably connected to coding Regulating element in the cell of the nucleotide sequence of Cas9 albumen, wherein component (a) and (b) are located at the identical or different load of system On body, wherein gRNA is targeted and is hybridized with target sequence and Cas9 Protein cleavage DNA molecular is to change one or more gene products Expression.In some embodiments, adeno-associated virus packs adenovirus (for example, Ad-rAAVpack) and contains CRISPR- The adeno-associated virus of Cas system while or co-administration.

In some embodiments, presently disclosed theme provides non-naturally occurring comprising one or more carriers CRISPR-Cas system, the carrier includes: a) being operably connected at least one coding CRISPR-Cas systematic direction RNA (gRNA) the H1 promoter of nucleotide sequence, wherein gRNA hybridizes with the target sequence of the DNA molecular in eukaryocyte, and wherein The one or more gene products expressed in DNA molecular coding eukaryocyte；And b) it is operably connected to coding II type Cas9 The operable regulating element in eukaryocyte of the nucleotide sequence of albumen, wherein component (a) and (b) are located at the identical of system Or on different carriers, thus gRNA is targeted and hybridize with target sequence and Cas9 Protein cleavage DNA molecular, and to change one kind or The expression of several genes product.In some embodiments, adeno-associated virus is packed adenovirus (such as Ad-rAAVpack) and is contained There is the adeno-associated virus of CRISPR-Cas system simultaneously or is co-administered.In one aspect, target sequence can be with any nucleosides Acid such as N₂₀The target sequence that NGG starts.In some embodiments, target sequence includes nucleotide sequence AN₁₉NGG.In some realities It applies in scheme, target sequence includes nucleotide sequence GN₁₉NGG.In some embodiments, target sequence includes nucleotide sequence CN₁₉NGG.In some embodiments, target sequence includes nucleotide sequence TN₁₉NGG.In some embodiments, target sequence packet AN containing nucleotide sequence₁₉NGG or GN₁₉NGG.On the other hand, Cas9 albumen is through codon optimization to express in cell.? On the other hand, Cas9 albumen is through codon optimization to express in eukaryocyte.On the other hand, eukaryocyte is mammal Or people's cell.On the other hand, the expression of one or more gene products is lowered.

Presently disclosed theme also provides the non-naturally occurring CRISPR- comprising the carrier containing two-way H1 promoter Cas system, wherein two-way H1 promoter includes: a) in the core of at least one coding CRISPR-Cas systematic direction RNA (gRNA) The control element of transcription is provided on one direction of nucleotide sequence, wherein the target sequence of gRNA and the DNA molecular in eukaryocyte Hybridization, and wherein DNA molecular encodes the one or more gene products expressed in eukaryocyte；And b) in coding II type Cas9 The control element of transcription is provided in the opposite direction of the nucleotide sequence of albumen, thus gRNA is targeted and is hybridized with target sequence, and Cas9 Protein cleavage DNA molecular, and thus the expression of one or more gene products is changed.In some embodiments, gland It is simultaneously or total that correlated virus packs adenovirus (for example, Ad-rAAVpack) and the adeno-associated virus containing CRISPR-Cas system With application.In one aspect, target sequence can be with any nucleotide, such as N₂₀The target sequence that NGG starts.In some embodiment party In case, target sequence includes nucleotide sequence AN₁₉NGG.In some embodiments, target sequence includes nucleotide sequence GN₁₉NGG。 In some embodiments, target sequence includes nucleotide sequence CN₁₉NGG.In some embodiments, target sequence includes nucleotide Sequence TN₁₉NGG.In some embodiments, target sequence includes nucleotide sequence AN₁₉NGG or GN₁₉NGG.On the other hand, Cas9 albumen is through codon optimization to express in cell.On the other hand, Cas9 albumen is through codon optimization with thin in eukaryon It is expressed in born of the same parents.On the other hand, eukaryocyte is mammal or people's cell.On the other hand, one or more gene products Expression be lowered.

In some embodiments, CRISPR compound includes one or more sufficient intensities in cell (such as eukaryon Cell) core in detectable amount driving CRISPR compound accumulation nuclear localization sequence.It is not wishing to be bound by theory, according to Letter nuclear localization sequence is not required the CRISPR complex activity in eucaryote, but including this sequence, enhancing system Nucleic acid molecules in the activity of system, especially targeting core.In some embodiments, CRISPR enzyme is II type CRISPR system Enzyme.In some embodiments, CRISPR enzyme is Cas9 enzyme.In some embodiments, Cas9 enzyme is streptococcus pneumonia, is suppurated Property streptococcus or streptococcus thermophilus Cas9, and may include the Cas9 of the mutation derived from these organisms.Enzyme can be Cas9 Homologue or ortholog.

As used herein, " adenovirus " is the DNA virus with 36kb genome.There are 51 kinds of human Adenovirus serotypes, The sero-fast neutralization resistance of other known adenoviral serotype is distinguished based on them.Although most of adenovirus vectors Derived from serotype 2 and 5, but other serotypes such as 35 types also can be used.Wild-type adenovirus genome is divided into early stage, and (E1 is extremely ) and advanced stage (L1 to L5) gene E4.Adenovirus vector can be prepared into reproducible or not replicated.Foreign gene can be inserted Enter behind three regions (E1, E3 or E4) and major late promoter of adenoviral gene group.The guidance of adenoviral gene group The ability of adenovirus production depends on the sequence in E1.

The example of the protein of participation tumor suppression can (ataxia telangiectasia be prominent for example including ATM Become), ATR (ataxia telangiectasia is related to Rad3), EGFR (EGF-R ELISA), ERBB2 (v- Erb-b2 into erythrocyte leukemia viral oncogene homolog 2), ERBB3 (v-erb-b2 into erythrocyte leukemia viral oncogene Homologue 3), ERBB4 (v-erb-b2 into erythrocyte leukemia viral oncogene homolog 4), Notch 1, Notch2, Notch 3 or Notch 4.

Can the example of tumor suppressor gene of useful editor be Rb, P53, INK4a, PTEN, LATS, Apaf1, Caspase 8, APC, DPC4, KLF6, GSTP1, ELAC2/HPC2, NKX3.1, ATM, CHK2, ATR, BRCA1, BRCA2, MSH2, MSH6, PMS2, Ku70, Ku80, DNA/PK, XRCC4, neurofibromatosis type 1,2 type of neurofibromatosis are adenomatous Polyposis coli, tWilms tumor suppressor protein, Patched, STAG2 and FHIT.

The example of recombination oncogene for use in the present invention includes Her2, KRAS, HRAS, NRAS, EGFR, MDM2, TGF- β, RhoC, AKT, c-myc, beta-catenin, PDGF, C-MET, PI3K-110 α, CDK4, cell periodic protein B 1, cell cycle Protein D 1, female hormone receptor gene, Progesterone receptor gene, ErbB1 (v-erb-b2 into erythrocyte leukemia viral oncogene homology Object 1), ErbB3 (v-erb-b2 into erythrocyte leukemia viral oncogene homolog 3), PLK3, KIRREL, ErbB4 (v-erb- B2 into erythrocyte leukemia viral oncogene homolog 4), TGFα, ras-GAP, Shc, Nck, Src, Yes, Fyn, Wnt, Bcl2, PyV MT antigen and SV40 T antigen.Preferred oncogene be Her2, C-MET, PI3K-CA and AKT and Her2 (also referred to as Neu or ErbB2 (v-erb-b2 into erythrocyte leukemia viral oncogene homolog 2)).

As used herein, " cancer driving gene " includes oncogene, including but not limited to EP300, FBXW7, GATA1, GATA2, NOTCH1, NOTCH2, EXT1, EXT2, PTCH1, SMO, SPOP, SUFU, APC, AXIN1, CDH1, CTNNB1, EP300, FAM123B, GNAS, HNF1A, NF2, PRKAR1A, RNF43, SOX9, ARID1A, ARID1B, ARID2, ASXL1, ATRX, CREBBP, DNMT1, DNMT3A, EP300, EZH2, H3F3A, HIST1H3B, IDH1, IDH2, KDM5C, KDM6A, MEN1, MLL2, MLL3, NCOA3, NCOR1, PAX5, PBRM1, SETD2, SETBP1, SKP2, SMARCA4, SMARCB1, SPOP, TET2, WT1, AR, BCOR, CREBBP, DAXX, DICER1, GATA3, IKZF1, KLF4, LMO1, PHOX2B, PHF6, PRDM1, RUNX1, SBDS, SF3B1, SRSF2, U2AF1, ABL1, BCL2, CARD11, CASP8, CCND1, CDC73, CDK4, CDKN2A, CDKN2C, CYLD, DAXX, FUBP1, MDM2, MDM4, MED12, MYC, MYCL1, MYCN, MYD88, NFE2L2, NPM1, PPM1D, PPP2R1A, RB1, TNFAIP3, TRAF7, TP53, ALK, B2M, BRAF, CBL, CEBPA, CSF1R, CIC, EGFR, ERBB2, FGFR2, FGFR3, FH, FLT3, GNA11, GNAQ, GNAS, HRAS, KIT, KRAS, MAP2K1, MAP3K1, MET, NRAS, NF1, PDGFRA, PTPN11, RET, SDH5, SDH8, SDHC, SDHD, VHL, AKT1, ALK, B2M, CBL, CEBPA, CSF1R, EGFR, ERBB2, FGFR2, FGFR3, FH, FLCN, FLT3, GNA11, GNAQ, GNAS, GPC3, KIT, MET, NKX21, PRKAR1A, PIK3CA, PIK3R1, PDGFRA, PTEN, RET, SDH5, SDH8, SDHC, SDHD, STK11, TSC1, TSC2, TSHR, VHL, WAS, CRLF2, FGFR2, FGFR3, FLT3, JAK1, JAK2, JAK3, KIT, MPL, SOCS1, VHL, B2M, CEBPA, ERK1, GNA11, GNAQ, MAP2K4, MAP3K1, NKX21, TNFAIP3, TSHR, WAS, ACVR1B, BMPR1A, FOXL2, GATA1, GATA2, GNAS, EP300, MED12, SMAD2, SMAD4, ATM, BAP1, BLM, BRCA1, BRCA2, BRIP1, BUB1B, CHEK2, ERCC2, ERCC3, ERCC4, ERCC5, FANCA, FANCC, FANCD2, FANCE, FANCF, FANCG, MLH1, MSH2, MSH6, MUTYH, NBS1, PALB2, PMS1, PMS2, RECQL4, STAG2, TP53, WRN, XPA, and XPC.See also Vogelstein et al..(2013) ScienceThe synthesis inventory of 339:1546.

In general, and throughout the specification, term " carrier " is the core for referring to transport another nucleic acid connected to it Acid molecule.Carrier is including but not limited to single-stranded, double-strand or partially double stranded nucleic acid molecules；Comprising one or more free-ends, There is no the nucleic acid molecules of free-end (such as cyclic annular)；Comprising DNA, the nucleic acid molecules of RNA or both and known in the art Other a variety of polynucleotides.A type of carrier is " plasmid ", refers to circular double stranded DNA ring, wherein there is other DNA piece Section can be inserted into, such as pass through standard molecule clone technology.Another type of carrier is viral vectors, wherein derived from carrier DNA or RNA sequence are present in carrier to be packaged into virus (such as retrovirus, replication defect type retrovirus, adenopathy Poison, replication-defective adenoviral and adeno-associated virus) in.Viral vectors further includes the polynucleotides carried by virus, for turning Contaminate host cell.

Certain carriers can in the host cell for being introduced into them autonomous duplication (such as the bacterium with bacterial origin of replication Carrier and episomal mammalian vectors).Other carriers (for example, non-add type mammalian vector) are after introducing host cell It is integrated into the genome of host cell, and to be replicated together with host genome.In addition, certain carriers can instruct and it The expression of gene that is operatively connected.This carrier is referred to herein as " expression vector ".It is useful in recombinant DNA technology Typical expression vectors are usually the form of plasmid.

Recombinant expression carrier may include the presently disclosed theme for being suitable for expressing the form of nucleic acid in host cell Nucleic acid, this indicates that recombinant expression carrier includes one or more regulating elements, can be based on being operably connected to table The host cell selection for expression of the nucleic acid sequence reached.

In recombinant expression carrier, " being operably connected " means interested nucleotide sequence to allow to express nucleotide The mode of sequence be connected to regulating element (such as when carrier is introduced into host cell, in vitro in transcription/translation system or In host cell).

Term " regulating element " is intended to include promoter, enhancer, internal ribosome entry site (IRES) and other tables Up to control element (such as transcription stop signals, such as polyadenylation signal and poly U sequence).This regulating element is described in Such as Goeddel (1990) Gene Expression Technology:Methods in Enzymology 185, In Academic Press, San Diego, Calif.Regulating element includes instructing nucleosides in the host cell of many types Constitutive expression those of and only instructed in certain host cells nucleotide sequence (for example, tissue specificity adjust Those of sequence) expression.Tissue-specific promoter can be mainly in desired destination organization, such as muscle, neuron, bone, Guidance expression in skin, blood, certain organs (such as liver, pancreas) or particular cell types (such as lymphocyte).It adjusts Element can also instruct to express in a manner of time dependence, such as in a manner of cell cycle dependant or stage of development dependence, It can be or can not be tissue or cell type-specific.

In some embodiments, carrier includes one or more pol III promoters, one or more pol II startings Son, one or more pol I promoters, or combinations thereof.The example of pol III promoter includes but is not limited to U6 and H1 starting Son.The example of pol II promoter include but is not limited to retrovirus Rous sarcoma virus (RSV) LTR promoter (optionally With RSV enhancer), cytomegalovirus (CMV) promoter (optionally having cmv enhancer) is (for example, Boshart et al. (1985) Cell41:521-530), SV40 promoter, dihyrofolate reductase promoter, beta-actin promoter, phosphoric acid Glycerokinase (PGK) promoter and EF1 α promoter.

Term " regulating element " also includes reinforcing element, such as WPRE；Cmv enhancer；R-U5 ' in the LTR of HTLV-I Section (Takebe et al. (1988)Mol. Cell. Biol.8:466-472)；SV40 enhancer；Outside rabbit beta-globin Intron sequences (O ' Hare et al. (1981) between aobvious son 2 and 3Proc. Natl. Acad. Sci. USA. 78(3): 1527-31).It will be appreciated by those skilled in the art that the design of expression vector may depend on host cell such as to be transformed Selection, the factors such as required expression.Carrier can be introduced into host cell, so that transcript is generated, protein or peptide, packet Fusion protein or peptide by nucleic acid encode as described herein are included (for example, the short palindrome of cluster aturegularaintervals repeats (CRISPR) transcription Object, protein, enzyme, mutant forms, fusion protein etc.).Advantageous carrier includes slow virus and adeno-associated virus, and is gone back The type of these carriers be can choose for targeting certain types of cell.

Term " polynucleotides ", " nucleotide ", " nucleotide sequence ", " nucleic acid " and " oligonucleotides " are used interchangeably.It Refer to any length polymerized form nucleotide, deoxyribonucleotide or ribonucleotide or its analog.Multicore glycosides Acid can have any three-dimensional structure, and can execute known or unknown any function.It is the unrestricted of polynucleotides below Property example: the coding or noncoding region of gene or genetic fragment, the loci defined by linkage analysis (locus), exon are interior Containing son, mRNA (mRNA), transfer RNA, rRNA, short interfering rna (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozyme, cDNA, recombination of polynucleotide, branched polynucleotides, plasmid, carrier, the separation DNA of any sequence are any The separation RNA of sequence, nucleic acid probe and primer.Polynucleotides may include the nucleotide of one or more modifications, such as methylate Nucleotide and nucleotide analog.If it does, can assign before or after polymer assembles to nucleotide structure Modification.Nucleotide sequence can be interrupted by non-nucleotide component.Can further modify polynucleotides after polymerisation, for example, by with Labeling component conjugation.

In terms of presently disclosed theme, term " chimeric RNA ", " chimeric guide RNA ", and " guide RNA ", " single guidance RNA " and " synthesis guide RNA " are used interchangeably, and refer to the polynucleotide sequence comprising guide sequence.Term " guide sequence " Refer to the about 20bp sequence in guide RNA, specify target site and can be used interchangeably with term " guidance " or " spacer region ".

As used herein, term " wild type " be those skilled in the art understand that term and refer to organism, bacterial strain, base The canonical form of cause is characterized in that it exists in nature, is different from mutant or variant form.

As used herein, term " variant " should be considered referring to the quality for deviateing mode present in nature It shows.

Term " non-natural presence " or " engineering " are used interchangeably and show the participation of manpower.When refer to nucleic acid molecules or When polypeptide, term refers to that nucleic acid molecules or polypeptide are at least substantially free of at least one naturally associate in nature and such as certainly The other components found in right boundary.

" complementarity " refers to that nucleic acid passes through the traditional non-traditional type of Watson-Crick or other and another nucleic acid sequence Column form the ability of one or more hydrogen bonds.Percentage complementarity indicates that hydrogen can be formed with second nucleotide sequence in nucleic acid molecules The residue of key (for example, Watson-Crick base pairing) percentage (for example, 5 in 10,6,7,8,9,10 be 50%, 60%, 70%, 80%, 90% and 100% is complementary)." complete complementary " refers to that all consecutive residues of nucleic acid sequence will be with the second nucleic acid sequence The consecutive residue Hydrogenbond of identical quantity in column.It " is substantially complementary " as used herein and refers to 8,9,10,11,12,13, In the region of 14,15,16,17,18,19,20,21,22,23,24,25,30,35,40,45,50 or more nucleotide at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% complementarity, or refer under strict conditions Two kinds of nucleic acid of hybridization.

As used herein, " stringent condition " of hybridization refers to has complementary nucleic acid mainly miscellaneous with target sequence with target sequence The condition handed over and do not hybridized with non-target sequences substantially.Stringent condition is usually sequence dependent, and depends on many factors And change.In general, sequence is longer, sequence and the temperature of its target sequence specific hybrid are higher.In Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part 1, chapter 2 " Overview of principles of In hybridization and the strategy of nucleic acid probe assay ", Elsevier, N.Y The non-limiting example of stringent condition is described in detail.

" hybridization " refers to that one or more of them polynucleotides react the reaction to form compound, and the compound is via core Hydrogen bond between the base of thuja acid residue is stablized.Hydrogen bond can by Watson Crick base pairing, Hoogstein combine or With the generation of any other sequence-specific fashion.Compound may include two chains to form duplex structure, form multi-stranded complex Three or more chains, it is single from hybridization chain or these any combination.Hybridization reaction may be constructed more extensively during Step, such as the cutting to polynucleotides of starting or enzyme of PCR.The sequence that can hybridize with given sequence is known as given sequence " complementary series ".

As used herein, " expression " refers to polynucleotides from DNA profiling (such as into mRNA or other RNA transcripts) The process of transcription and/or the mRNA of transcription are subsequently translated into peptide, the process of polypeptide or protein.The polypeptide of transcript and coding It can be collectively referred to as " gene product ".If polynucleotides are derived from genomic DNA, expression may include the montage in eukaryocyte mRNA。

The amino acid polymerization to refer to any length is used interchangeably herein in term " polypeptide ", " peptide " and " protein " Object.Polymer can be linear chain or branched chain, it may include the amino acid of modification, and can be interrupted by non-amino acid.The art Language further includes modified amino acid polymer；For example, disulfide bond formation, glycosylation, esterification, acetylation phosphorylation or appoints What it is operated, such as the conjugation with labeling component.

As used herein, term " amino acid " includes natural and/or non-natural or the amino acid of synthesis, including glycine and Both D or L optical isomers and amino acid analogue and peptide mimics.

Unless otherwise indicated, the practice of the presently disclosed theme of the present invention uses immunology, biochemistry, chemistry, molecule The routine techniques of biology, microbiology, cell biology, genomics and recombinant DNA, technology of these technologies in this field (Sambrook, Fritsch and Maniatis (1989) Molecular Cloning:A Laboratory in range Manual, second edition；Ausubel et al., eds. (1987) Current Protocols in Molecular Biology)；MacPherson et al., eds. (1995) Methods in Enzymology (Academic Press, Inc.): PCR 2:A Practical Approach)；Harlow and Lane, eds. (1988) Antibodies, A Laboratory Manual；Freshney, ed.(1987) Animal Cell Culture).

Several aspects of presently disclosed theme are related to carrier system or carrier itself comprising one or more carriers. Can be used to express in protokaryon or eukaryotic with design vector CRISPR transcript (such as transcribed nucleic acid object, protein or Enzyme).For example, CRISPR transcript (can be carried in bacterial cell, such as Escherichia coli, insect cell using baculovirus expression Body), it expresses in yeast cells or mammalian cell.Suitable host cell is in Goeddel (1990) Gene Expression Technology:Methods in Enzymology 185, Academic Press, San Diego, It is further discussed in Calif.Alternatively, recombinant expression carrier can transcription and translation in vitro, such as adjusted using T7 promoter Sequence and T7 polymerase.

Carrier can be introduced and bred in prokaryotes.In some embodiments, prokaryotes are for expanding wait draw Enter the aborning intermediate vector of the copy of the carrier of eukaryocyte or the carrier as eukaryocyte to be introduced (for example, amplification The plasmid of a part as viral vectors packaging system).In some embodiments, prokaryotes are used for the pair of amplification vector This simultaneously expresses one or more nucleic acid, such as provides the source of one or more protein to be delivered to host cell or host's life Object.Protein in prokaryotes expression usually in Escherichia coli with the carrier containing composing type or inducible promoter into Row, the promoter instruct the expression of fusion protein or non pregnant women.

The protein that fusion vector encodes thereto, such as many amino acid are added to the amino terminal of recombinant protein. This fusion vector can be used for one or more purposes, such as: the expression of (i) increase recombinant protein；(ii) increase recombination egg White solubility；(iii) helps purification of recombinant proteins by serving as ligand in affinity purification.In general, in amalgamation and expression In carrier, proteolytic cleavage sites are introduced in the junction of fusion part and recombinant protein, so that after fusion protein purification Recombinant protein is partially separated with merging.These enzymes and its cognate recognition sequence include factor Xa, fibrin ferment and enterokinase.Example is melted Closing expression vector includes pGEX (Pharmacia Biotech Inc；Smith and Johnson (1988) Gene 67:31-40), PMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.), glutathione S-transferase (GST) is merged respectively, maltose E binding protein or albumin A to target recombinant protein.

The example of suitable inducible non-fusion E. coli expression vector includes pTrc (Amrann et al. (1988)Gene 69:301-315) and pET 11d (Studier et al. (1990) Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif.)。

In some embodiments, carrier is Yeast expression carrier.For in yeastSaccharomyces cerivisae The example of the carrier of middle expression include pYepSec1 (Baldari, et al. (1987) EMBO J. 6:229-234), pMFa (Kuijan and Herskowitz (1982) Cell 30:933-943), pJRY88 (Schultz et al. (1987)Gene54: 113-123), pYES2 (Invitrogen Corporation, San Diego, Calif.) and picZ (InVitrogen Corp, San Diego, Calif.).

In some embodiments, carrier be able to use it is a kind of in mammalian expression vector driving mammalian cell or The expression of a variety of sequences.The example of mammalian expression vector includes pCDM8 (Seed (1987) Nature 329:840) and PMT2PC (Kaufman et al. (1987) EMBO J. 6:187-195).When in mammalian cells in use, expression vector Control function usually provided by one or more regulating elements.For example, common promoter is derived from polyomavirus, adenovirus 2, cytomegalovirus, simian virus 40 and disclosed herein and known in the art other.It is thin for prokaryotic cell and eukaryon Other suitable expression systems of both born of the same parents, see, for example, Sambrook et al. (1989) Molecular Cloning:A Laboratory Manual. second edition, Cold Spring Harbor Laboratory, Cold Spring Harbor The 16th chapter and the 17th chapter of Laboratory Press, Cold Spring Harbor, N.Y..

In some embodiments, recombinant mammalian expression vector preferentially can instruct nucleic acid in particular cell types Expression (for example, tissue specificity regulating element for express nucleic acid).Tissue specificity regulating element is known in the art. The non-limiting example of suitable tissue-specific promoter includes albumin promoter (liver specificity；Pinkert et al. (1987) Genes Dev. 1:268-277), lymphoid-specific promoters (Calame and Eaton (1988) Adv. Immunol. 43:235-275), promoter (Winoto and the Baltimore (1989) of especially T cell receptor EMBO J.8:729-733) and immunoglobulin (Baneiji et al. (1983) Cell 33:729-740；Queen and Baltimore (1983) Cell 33:741-748), neuron specific promoter is (for example, neurofilament promoter；Byrne and Ruddle (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477), pancreas-specific promoter (Edlund et al. (1985) Science 230:912-916) and mammary gland specific promoter is (for example, whey promoter；U.S. Patent number 4, 873,316 and European Application Publication number 264,166).It further include the promoter of growth adjustment, such as mouse hox promoter (Kessel With Gruss (1990) Science 249:374-379) and afp promoter (Campes and Tilghman (1989)Genes Dev. 3:537-546).

In some embodiments, regulating element is operably connected to one or more elements of CRISPR system to drive The expression of one or more elements of dynamic CRISPR system.In general, CRISPR (the short palindrome of cluster aturegularaintervals repeats), also referred to as SPIDR (SPacer Interspersed Direct Repeats) constitutes DNA gene usually species specific to specific bacteria object Seat family.CRISPR locus includes different types of distribution short tandem repeats (the SSR) (Ishino identified in Escherichia coli Et al. (1987)J. Bacteriol, 169:5429-5433；With Nakata et al. (1989) J. Bacteriol., 171:3553-3556) and related gene.?Haloferax mediterranei, Streptococcus pyogenes, Anabaena, andMycobacterium tuberculosis(Groenen et al. (1993)Mol. Microbiol, 10: 1057-1065；Hoe et al. (1999)Emerg. Infect. Dis, 5:254-263；Masepohl et al. (1996)Biochim. Biophys. Acta1307:26-30；With Mojica et al. (1995)Mol. Microbiol, 17:85- 93) the similar distribution SSR of identification in.CRISPR locus is typically due to the structure of repetitive sequence and is different from other SSR, quilt Referred to as short aturegularaintervals repetitive sequence (SRSR) (Janssen et al. (2002)OMICS J. Integ. Biol, 6:23- 33；With Mojica et al. (2000)Mol. Microbiol, 36:244-246).In general, repetitive sequence is gone out in the form of cluster Existing short element, these elements are regularly spaced apart (Mojica et al. by unique insetion sequence with substantially constant length (2000) Mol. Microbiol, 36:244-246).Although repetitive sequence is highly conserved, distribution between bacterial strain The quantity of repetitive sequence and the sequence of spacer region (van Embden et al. (2000) usually different because of bacterial strainJ. Bacteriol., 182:2393-2401).More than identifying CRISPR locus (such as Jansen in 40 kinds of prokaryotes Et al. (2002)Mol. Microbiol, 43:1565-1575；With Mojica et al. (2005)J. Mol. Evol.60: 174-82), including but not limited to gas fire Pseudomonas, hot pin Pseudomonas, solfataricus genus, Gu Shengqiu Pseudomonas, Halocarcula, methane Bacterium category, Methanococcus, Methanosarcina, methane fire Pseudomonas, Pyrococcus, acidophilus Pseudomonas, Thernioplasnia, corynebacterium, mycobacterium, streptomyces, Aquifrx, Porphvromonas, green sulphur bacteria Belong to, Thermus, bacillus, listeria, staphylococcus, fusobacterium, high temperature anaerobic Bacillus, branch opportunistic pathogen, clostridium Belong to, Azarcus, chromobacterium category, eisseria, Nitromonas, Desulfovibrio, the thin end of the scroll Pseudomonas, Myrococcus, campylobacter irrigate honest and clean Pseudomonas, acinetobacter, Erwinia, Escherichia, Legionella, Methyloccccus, Pasteurella, Photobacterium, Salmonella, Flavobacterium, Yersinia, Treponema With thermobacillus category.

In general, " CRISPR system " to be referred to as transcript (" Cas ") gene related to being related to expressing or instruct CRISPR living Property other elements, including encode Cas gene sequence, guide sequence (under the background of endogenous CRISPR system also referred to as " Parting "), or other sequences and transcript from CRISPR locus.In some embodiments, one kind of CRISPR system Or Various Components are derived from I type, II type or type III CRISPR system.In some embodiments, one kind of CRISPR system or Various Components are derived from the particular organisms comprising endogenous CRISPR system, such as micrococcus scarlatinae.In general, CRISPR system The element for being characterized in that promoting the CRISPR compound at target sequence site to be formed is (under the background of endogenous CRISPR system also referred to as For protospacer).

Under the background for forming CRISPR compound, " target sequence " refers to that boot sequence is configured to have complementary sequence Column, wherein the hybridization between target sequence and guide sequence promotes the formation of CRISPR compound.It is not necessarily required to complete complementary, only There are the enough complementary formation to cause to hybridize and promote CRISPR compound.Target sequence may include any multicore glycosides Acid, such as DNA or RNA polynucleotides.In some embodiments, target sequence is located in the nucleus or cytoplasm of cell.? In some embodiments, target sequence can be in the organelle of eukaryocyte, for example, in mitochondria or chloroplaset.It can be used for recombinating Sequence or template to the target gene seat comprising target sequence are known as " editing template " or " editor's polynucleotides " or " editor's sequence ". In terms of presently disclosed theme, external source template polynucleotide is properly termed as editing template.The one of presently disclosed theme A aspect, recombination are homologous recombinations.

In some embodiments, carrier includes one or more insertion points, such as restriction endonuclease identifications Sequence (also referred to as " cloning site ").In some embodiments, one or more insertion points are (for example, about or greater than about 1,2,3,4,5,6,7,8,9,10 or more insertion point) it is located at one or more sequential elements of one or more carriers Upstream and/or downstream.When using multiple and different guide sequences, single expression construct can be used for CRISPR active targeting Intracellular multiple and different corresponding target sequences.For example, single carrier may include about or greater than about 1,2,3,4,5,6,7,8, 9,10,15,20 or more guide sequences.In some embodiments, about or greater than about 1,2,3,4,5,6 can be provided, Containing the carrier of boot sequence as 7,8,9,10 or more, and optionally deliver it to cell.

In some embodiments, carrier includes to be operably connected to coding CRISPR enzyme, such as the enzyme of Cas albumen is compiled The regulating element of code sequence.The non-limiting example of Cas albumen includes Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also referred to as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homology Object or its modified forms.These enzymes are known；For example, the amino acid sequence of micrococcus scarlatinae Cas9 albumen can log in It is found in the SwissProt database of number Q99ZW2.In some embodiments, unmodified CRISPR enzyme is cut with DNA Activity, such as Cas9.In some embodiments, CRISPR enzyme is Cas9, and be can be from micrococcus scarlatinae or pneumonia Streptococcic Cas9.

In some embodiments, CRISPR enzyme instructs the cutting of one or two chain at target sequence location, such as target In sequence and/or in the complementary series of target sequence.In some embodiments, CRISPR enzyme instructs first from target sequence Or about the 1 of the last one nucleotide, 2,3,4,5,6,7,8,9,10,15,20,25,50,100,200,500 or more base-pairs The cutting of interior one or two chain.In some embodiments, vector encoded is mutated relative to corresponding wild-type enzyme CRISPR enzyme, so that the energy of one or two chain of target polynucleotide of the CRISPR azymia cutting containing target sequence of mutation Power.

In some embodiments, the enzyme coded sequence of coding CRISPR enzyme is through codon optimization in specific cells (example Such as eukaryocyte) in expression.Eukaryocyte can be those of specific organism or dynamic derived from particular organisms, such as lactation Object, including but not limited to people, mouse, rat, rabbit, dog or non-human primate.In general, codon optimization refers to by being used in In the gene of host cell more frequent or most frequently used codon replacement native sequences at least one codon (for example, About or greater than about 1,2,3,4,5,10,15,20,25,50 or more codons), while keeping natural acid sequence Modification of nucleic acids sequence is to enhance the process expressed in purpose host cell.Certain password sublists of the various species to specific amino acids Reveal special deviation.Codon deviation (difference that codon uses between organism) is usually turned over mRNA (mRNA) Efficiency correlation is translated, the translation efficiency of mRNA is then considered depending on the property for the codon being translated and specific transfer The availability of RNA (tRNA) molecule etc. is other.Advantage of the selected tRNA in cell is usually most frequent in peptide synthesis make The reflection of codon.Therefore, can be customized based on codon optimization gene in given organism best base because of table It reaches.Codon usage table is readily available, for example, in " codon uses database ", and these tables can be in many ways Adjustment.See Nakamura et al. (2000)Nucl. Acids Res28:292.For codon optimization particular sequence with The computerized algorithm expressed in particular host cell is also available, such as Gene Forge (Aptagen；Jacobus, Pa.) Also it is available.In some embodiments, encode in the sequence of CRISPR enzyme one or more codons (for example, 1,2, 3,4,5,10,15,20,25,50 or more or all codons) correspond to specific amino acids most frequently used password Son.

In general, guide sequence be have with target polynucleotide sequence it is complementary enough to hybridize with target sequence and by CRISPR Any polynucleotide sequence of compound and the specific binding of target sequence direct sequence.In some embodiments, when use is closed When suitable alignment algorithm optimal comparison, the complementarity between boot sequence and its corresponding target sequence is about or greater than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99% or more.It can be used for any suitable of alignment sequence Algorithm is optimally aligned to determine, non-limiting example includes Smith-Waterman algorithm, Needleman-Wunsch algorithm, Based on the algorithm (such as Burrows Wheeler Aligner) of Burrows-Wheeler transformation, ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (can be obtained in soap.genomics.org.cn) and Maq (can be obtained in maq.sourceforge.net).In some embodiment party In case, guide sequence is about or greater than about 5,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25, 26,27,28,29,30,35,40,45,50,75 or more length of nucleotides.In some embodiments, guide sequence is less than About 75,50,45,40,35,30,25,20,15,12 or less length of nucleotides.

Guide sequence can be assessed by any suitable measurement instructs the sequence of CRISPR compound and target sequence special The ability that the opposite sex combines.Such as, it is sufficient to the component for forming the CRISPR system of CRISPR compound instructs sequence including to be tested Column can be supplied to the host cell with corresponding target sequence, such as be turned by the carrier of the component with coding CRISPR sequence Dye.Then the preferential cutting in target sequence is assessed, such as is measured by Surveyor as described herein.By providing target sequence, The component of CRISPR compound, including guide sequence and the control guide sequence different from testing guide sequence to be tested, and Compare in the combination or rate of cutting for testing and compareing the target sequence between guide sequence reaction, it is more target can be assessed in test tube The cutting of nucleotide sequence.Other measurements are possible, and those skilled in the art will expect.

Boot sequence be can choose to target any target sequence.In some embodiments, target sequence is cellular genome Interior sequence.Exemplary target sequence includes unique target sequence in target gene group.Boot sequence be can choose to target any target Sequence.In some embodiments, target sequence is the sequence in cellular genome.Exemplary target sequence includes only in target gene group Special target sequence.For example, in some embodiments, target sequence is oncogene (for example, having Cancer-causing mutation) or tumor suppression Gene.In some embodiments, target sequence is the oncogene comprising at least one mutation.In some embodiments, target sequence Column are selected from Her2, PIK3CA, KRAS, HRAS, IDH1, NRAS, EGFR, MDM2, TGF-β, RhoC, AKT, c-myc, the β-chain of rings Albumen, PDGF, C-MET, PI3K-110 α, CDK4, cell periodic protein B 1, cyclin D1, female hormone receptor gene, Progesterone receptor gene, ErbB1 (v-erb-b2 into erythrocyte leukemia viral oncogene homolog 1), ErbB3 (v-erb-b2 at Rubricyte leukocythemia viral oncogene homolog 3), PLK3, KIRREL, ErbB4 (v-erb-b2 into erythrocyte leukemia virus cancer Gene homologues 4), TGFα, ras-GAP, Shc, Nck, Src, Yes, Fyn, Wnt, Bcl2, PyV MT antigen and SV40 T are anti- Former carcinogen.In some embodiments, target sequence is to be selected from EP300, FBXW7, GATA1, GATA2, NOTCH1, NOTCH2, EXT1, EXT2, PTCH1, SMO, SPOP, SUFU, APC, AXIN1, CDH1, CTNNB1, EP300, FAM123B, GNAS, HNF1A, NF2, PRKAR1A, RNF43, SOX9, ARID1A, ARID1B, ARID2, ASXL1, ATRX, CREBBP, DNMT1, DNMT3A, EP300, EZH2, H3F3A, HIST1H3B, IDH1, IDH2, KDM5C, KDM6A, MEN1, MLL2, MLL3, NCOA3, NCOR1, PAX5, PBRM1, SETD2, SETBP1, SKP2, SMARCA4, SMARCB1, SPOP, TET2, WT1, AR, BCOR, CREBBP, DAXX, DICER1, GATA3, IKZF1, KLF4, LMO1, PHOX2B, PHF6, PRDM1, RUNX1, SBDS, SF3B1, SRSF2, U2AF1, ABL1, BCL2, CARD11, CASP8, CCND1, CDC73, CDK4, CDKN2A, CDKN2C, CYLD, DAXX, FUBP1, MDM2, MDM4, MED12, MYC, MYCL1, MYCN, MYD88, NFE2L2, NPM1, PPM1D, PPP2R1A, RB1, TNFAIP3, TRAF7, TP53, ALK, B2M, BRAF, CBL, CEBPA, CSF1R, CIC, EGFR, ERBB2, FGFR2, FGFR3, FH, FLT3, GNA11, GNAQ, GNAS, HRAS, KIT, KRAS, MAP2K1, MAP3K1, MET, NRAS, NF1, PDGFRA, PTPN11, RET, SDH5, SDH8, SDHC, SDHD, VHL, AKT1, ALK, B2M, CBL, CEBPA, CSF1R, EGFR, ERBB2, FGFR2, FGFR3, FH, FLCN, FLT3, GNA11, GNAQ, GNAS, GPC3, KIT, MET, NKX21, PRKAR1A, PIK3CA, PIK3R1, PDGFRA, PTEN, RET, SDH5, SDH8, SDHC, SDHD, STK11, TSC1, TSC2, TSHR, VHL, WAS, CRLF2, FGFR2, FGFR3, FLT3, JAK1, JAK2, JAK3, KIT, MPL, SOCS1, VHL, B2M, CEBPA, ERK1, GNA11, GNAQ, MAP2K4, MAP3K1, NKX21, TNFAIP3, TSHR, WAS, ACVR1B, BMPR1A, FOXL2, GATA1, GATA2, GNAS, EP300, MED12, SMAD2, SMAD4, ATM, BAP1, BLM, BRCA1, BRCA2, BRIP1, BUB1B, CHEK2, ERCC2, ERCC3, ERCC4, ERCC5, FANCA, FANCC, FANCD2, FANCE, FANCF, FANCG, MLH1, MSH2, The cancer of MSH6, MUTYH, NBS1, PALB2, PMS1, PMS2, RECQL4, STAG2, TP53, WRN, XPA and XPC drive base Cause.In some embodiments, target sequence is the oncogene selected from KRAS, PIK3CA or IDH1.In some embodiments, target Sequence is oncogene, and the oncogene is KRAS.In some embodiments, KRAS includes selected from G13D, G12C or G12D Mutation.In some embodiments, target sequence is selected from SEQ ID NO:11-14, or combinations thereof.In some embodiments, target Sequence is oncogene, and the oncogene is PIK3CA.In some embodiments, PIK3CA include be selected from E345K, D549N or The mutation of H1047R.In some embodiments, target sequence is selected from SEQ ID NO:15-18, or combinations thereof.In some embodiment party In case, target sequence is oncogene, the oncogene IDH1.In some embodiments, IDH1 is mutated comprising R132H.Some In embodiment, gRNA sequence is selected from nucleotide sequence shown in SEQ ID NO:1-10, or combinations thereof.

In some embodiments, target sequence can with nucleotide sequence 60%, 65% shown in SEQ ID NO:11-18, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% is homologous.

Term " homologous " refers to " % homology " and can be used interchangeably herein with term " % identity ", and is related to make The level of nucleic acid sequence identity when being compared with alignment programs.

For example, as used herein, 80% homology means the phase of 80% sequence identity determined with the algorithm by definition Same things, and therefore the homologue of given sequence has the sequence identity greater than 80% in the length of given sequence.Sequence is same The exemplary horizontal of one property include but is not limited to nucleotide sequence about 80%, 81%, 82% shown in SEQ ID NO:1-18, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or higher sequence identity.

In some embodiments, CRISPR enzyme be comprising one or more heterologous protein structural domains (for example, in addition to Outside CRISPR enzyme, about or greater than about 1,2,3,4,5,6,7,8,9,10 or more structural domains) a part of fusion protein. CRISPR enzyme fusion proteins may include any other protein sequence, and the connector optionally between any two structural domain Sequence.The example for the protein domain that can be merged with CRISPR enzyme includes but is not limited to epitope tag, reporter sequences With with one or more following active protein domains: methyl enzymatic activity, demethyl enzymatic activity, transcriptional activation activity, Transcriptional repression activity, transcription releasing factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity.Epitope mark The non-limiting example of label includes histidine (His) label, V5 label, FLAG label, influenza hemagglutinin (HA) label, Myc mark Label, VSV-G label and thioredoxin (Trx) label.The example of reporter gene includes but is not limited to glutathione -5- transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta galactosidase, β-glucuronidase, Luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescence protein (YFP) and Autofluorescence albumen, including blue fluorescent protein (BFP).CRISPR enzyme can be with the gene of coding protein or protein fragments Sequence fusion, the protein or protein fragments combination DNA molecular combine other cellular elements, including but not limited to malt Carbohydrate-binding protein (MBP), S label, Lex A DNA binding structural domain (DBD) fusion, the fusion of GAL4A DNA binding structural domain Body and herpes simplex virus (HSV) BP16 fusion.It is likely to form a part of the fusion protein comprising CR ISPR enzyme Other structures domain is described in US20110059502, is incorporated herein by reference.In some embodiments, label The position of CRISPR enzyme target sequence for identification.

In the one aspect of presently disclosed theme, by including but not limited to glutathione -5- transferase (GST), horseradish Peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta galactosidase, β-glucuronidase, luciferase, Green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescence protein (YFP) and autofluorescence egg The reporter gene of white (including blue fluorescent protein (BFP)) is introduced into cell with encoding gene product (, is used as measuring base Because of the label of change or the modification of product expression.It, can be via carrier in another embodiment of presently disclosed theme The DNA molecular of encoding gene product (is introduced into cell.In the preferred embodiment of presently disclosed theme, gene product is Luciferase.In another embodiment of presently disclosed theme, the expression of gene product is reduced.

In general, the promoter embodiment of presently disclosed theme includes: 1) complete Pol III promoter comprising TATA box, proximal sequence element (PSE) and distal end sequential element (DSE)；With 2) include melting in the opposite direction with the 5 ' ends of DSE The basic Pol III promoter of second of the PSE and TATA box of conjunction.It is Pol III with the TATA box that its nucleotide sequence is named The main determining factor of specificity.It is usually located at relative to the position between transcription sequence nt. 23 and 30, and is transcription The main determining factor that sequence starts.PSE is usually located between nt. 45 and 66.DSE enhances basic Pol III promoter Activity.It is very close to each other between PSE and DSE in H1 promoter.

Bidirectional promoter is made up of: 1) completely, conventional, unidirectional Pol III promoter, it includes 3 outsides Control element: DSE, PSE and TATA box；With 2) comprising in the opposite direction with PSE the and TATA box of the 5 ' terminal fusions of DSE the Two basic Pol III promoters.It is for raising Pol III to promoter region by the TATA box that TATA binding protein identifies It is required.Stablize the combination of TATA binding protein and TATA box by the interaction of SNAPc and PSE.These elements are together just Position Pol III is determined, so that it can be with the sequence of transcriptional expression.DSE is also required for the fully active of Pol III promoter (Murphy et al. (1992)Mol. Cell Biol12:3247-3261；Mittal et al. (1996)Mol. Cell Biol16:1955-1965；Ford and Hernandez (1997)J.Biol.Chem, 272:16048-16055；Ford etc. People (1998)Genes, Dev, 12:3528-3540；Hovde et al. (2002)Genes Dev16:2772-2777). By the interaction of transcription factor Oct-1 and/or SBF/Staf and their motifs in DSE, up to 100 times of transcription enhancing (Kunkel and Hixon (1998)Nucl. Acid Res, 26:1536-1543).Due to the alkalinity starting of forward and reverse Transcription of the sub- guide sequence on the opposite chain of double-stranded DNA template, it is negative that the normal chain of the basic promoter of oriented opposite is attached to DSE 5 ' ends of chain.The transcript expressed under the control of H1 promoter is terminated by the complete sequence of 4 or 5 T.

In H1 promoter, DSE (Myslinski et al. (2001) adjacent with PSE and TATA boxNucl. Acid Res29:2502-2509).It is repeated to minimize sequence, makes the promoter Two-way by generating hybrid promoter, wherein Reverse transcription is controlled by the additional PSE and TATA box derived from U6 promoter.In order to promote the building of two-way H1 promoter, Closely-spaced sequence can also be inserted between the basic promoter and DSE of oriented opposite.

B. method

In some embodiments, presently disclosed theme, which also provides, changes one of eukaryocyte or several genes product table The method reached, wherein the cell includes the DNA molecular for encoding one or more gene products, the method includes will be first The non-naturally occurring CRISPR-Cas system of the preceding modification described in WO2015/195621, which is introduced into cell, (passes through reference It is integrally incorporated herein).This modification uses targeting Cancer-causing mutation, such as, but not limited to KRAS, PIK3CA or IDH1 or tumour suppression Certain gRNA of gene processed.In some embodiments, the method includes introducing composition into cell, the composition includes (a) comprising the non-naturally occurring nucleic acid enzyme system (for example, CRISPR-Cas9) of one or more carriers, the carrier includes: I) be operably connected to the nucleotide sequence of at least one code nucleic acid enzyme system guide RNA (gRNA) promoter (for example, Two-way H1 promoter), wherein gRNA hybridizes with the target sequence of the DNA molecular in the cell of subject, and wherein DNA molecular encodes The one or more gene products expressed in cell；And ii) be operably connected to encoding gene group targeted nuclease (such as Cas9 albumen) nucleotide sequence the operable regulating element in cell, wherein component (i) and (ii) are located at the phase of system On same or different carriers, wherein gRNA is targeted and is hybridized with target sequence, and nuclease cutting DNA molecule is one or more to change The expression of gene product.In some embodiments, adeno-associated virus packs adenovirus (such as Ad-rAAVpack) and contains core The adeno-associated virus of sour enzyme system (i.e. Geminivirus packaging system) while or co-administration.In some embodiments, it will use Single adeno-associated virus (AAV) particle without packaging adenovirus.In some embodiments, adeno-associated virus (AAV) can Include any one of 11 kinds of people's adeno-associated virus serotypes (such as serotype 1-11).In some embodiments, adenopathy Malicious (AAV) may include any one of 51 kinds of human Adenovirus serotypes.In some embodiments, adeno-associated virus encapsidated adenovirus Virus includes at least one of adenoviral gene missing.In some embodiments, packaging adenovirus is selected from adenovirus serum Type 2, adenoviral serotype 5 or adenoviral serotype 35.In some embodiments, adeno-associated virus packaging virus is adenovirus Serotype 5.In some embodiments, adenoviral gene is selected from E1A, E1B, E2A, E2B, E3, E4, L1, L2, L3, L4 or L5. In some embodiments, which inactivate one or more gene products.In some embodiments, nucleic acid enzyme system is cut Except at least one gene mutation.In some embodiments, promoter includes: a) in the nucleotides sequence of at least one coding gRNA The control element of transcription is provided on one direction of column；And b) in the opposite of the nucleotide sequence of encoding gene group targeted nuclease The control element of transcription is provided on direction.In some embodiments, Cas9 albumen is through codon optimization to express in cell. In some embodiments, promoter is operably connected at least one, and two, three, four, five, six, seven, Eight, nine or ten gRNA.In some embodiments, target sequence is oncogene or tumor suppressor gene.In some implementations In scheme, target sequence is the oncogene comprising at least one mutation.In some embodiments, target sequence is selected from Her2, PIK3CA, KRAS, HRAS, IDH1, NRAS, EGFR, MDM2, TGF-β, RhoC, AKT, c-myc, beta-catenin, PDGF, C- MET, PI3K-110 α, CDK4, cell periodic protein B 1, cyclin D1, female hormone receptor gene, Progesterone receptor gene, ErbB1 (v-erb-b2 into erythrocyte leukemia viral oncogene homolog 1), ErbB3 (v-erb-b2 into erythrocyte leukemia disease Malicious oncogene homologue 3), PLK3, KIRREL, ErbB4 (v-erb-b2 into erythrocyte leukemia viral oncogene homolog 4), TGFα, ras-GAP, Shc, Nck, Src, Yes, Fyn, Wnt, Bcl2, PyV MT antigen and SV40 T antigen.In some implementations In scheme, target sequence is to be selected from EP300, FBXW7, GATA1, GATA2, NOTCH1, NOTCH2, EXT1, EXT2, PTCH1, SMO, SPOP, SUFU, APC, AXIN1, CDH1, CTNNB1, EP300, FAM123B, GNAS, HNF1A, NF2, PRKAR1A, RNF43, SOX9, ARID1A, ARID1B, ARID2, ASXL1, ATRX, CREBBP, DNMT1, DNMT3A, EP300, EZH2, H3F3A, HIST1H3B, IDH1, IDH2, KDM5C, KDM6A, MEN1, MLL2, MLL3, NCOA3, NCOR1, PAX5, PBRM1, SETD2, SETBP1, SKP2, SMARCA4, SMARCB1, SPOP, TET2, WT1, AR, BCOR, CREBBP, DAXX, DICER1, GATA3, IKZF1, KLF4, LMO1, PHOX2B, PHF6, PRDM1, RUNX1, SBDS, SF3B1, SRSF2, U2AF1, ABL1, BCL2, CARD11, CASP8, CCND1, CDC73, CDK4, CDKN2A, CDKN2C, CYLD, DAXX, FUBP1, MDM2, MDM4, MED12, MYC, MYCL1, MYCN, MYD88, NFE2L2, NPM1, PPM1D, PPP2R1A, RB1, TNFAIP3, TRAF7, TP53, ALK, B2M, BRAF, CBL, CEBPA, CSF1R, CIC, EGFR, ERBB2, FGFR2, FGFR3, FH, FLT3, GNA11, GNAQ, GNAS, HRAS, KIT, KRAS, MAP2K1, MAP3K1, MET, NRAS, NF1, PDGFRA, PTPN11, RET, SDH5, SDH8, SDHC, SDHD, VHL, AKT1, ALK, B2M, CBL, CEBPA, CSF1R, EGFR, ERBB2, FGFR2, FGFR3, FH, FLCN, FLT3, GNA11, GNAQ, GNAS, GPC3, KIT, MET, NKX21, PRKAR1A, PIK3CA, PIK3R1, PDGFRA, PTEN, RET, SDH5, SDH8, SDHC, SDHD, STK11, TSC1, TSC2, TSHR, VHL, WAS, CRLF2, FGFR2, FGFR3, FLT3, JAK1, JAK2, JAK3, KIT, MPL, SOCS1, VHL, B2M, CEBPA, ERK1, GNA11, GNAQ, MAP2K4, MAP3K1, NKX21, TNFAIP3, TSHR, WAS, ACVR1B, BMPR1A, FOXL2, GATA1, GATA2, GNAS, EP300, MED12, SMAD2, SMAD4, ATM, BAP1, BLM, BRCA1, BRCA2, BRIP1, BUB1B, CHEK2, ERCC2, ERCC3, ERCC4, ERCC5, FANCA, FANCC, FANCD2, FANCE, FANCF, FANCG, MLH1, MSH2, MSH6, MUTYH, NBS1, PALB2, PMS1, The cancer of PMS2, RECQL4, STAG2, TP53, WRN, XPA and XPC drive gene.In some embodiments, target sequence is Oncogene selected from KRAS, PIK3CA or IDH1.In some embodiments, target sequence is oncogene, and the oncogene is KRAS.In some embodiments, KRAS includes the mutation selected from G13D, G12C or G12D.In some embodiments, target sequence Column selection from SEQ ID NO:11-14, or combinations thereof.In some embodiments, target sequence is oncogene, and the oncogene is PIK3CA.In some embodiments, PIK3CA includes the mutation selected from E345K, D549N or H1047R.In some embodiment party In case, target sequence is selected from SEQ ID NO:15-18, or combinations thereof.In some embodiments, target sequence is oncogene, described Oncogene IDH1.In some embodiments, IDH1 is mutated comprising R132H.In some embodiments, gRNA sequence is selected from Nucleotide sequence shown in SEQ ID NO:1-10, or combinations thereof.

In some embodiments, presently disclosed theme, which also provides, changes one or more gene product expressions in cell Method, wherein the cell includes the DNA molecular for encoding one or more gene products, the method includes will including The non-naturally occurring CRISPR-Cas system of one or more carriers is introduced into cell, and the carrier includes: a) operationally It is connected to the H1 promoter of the nucleotide sequence of at least one coding CRISPR-Cas systematic direction RNA (gRNA), wherein described GRNA hybridizes with the target sequence of DNA molecular；And b) be operably connected to coding Cas9 albumen nucleotide sequence in cell In operable regulating element, wherein component (a) and (b) are located on the identical or different carrier of system, and wherein gRNA is targeted simultaneously Hybridize with target sequence and Cas9 Protein cleavage DNA molecular is to change the expression of one or more gene products.

In some embodiments, presently disclosed theme, which also provides, changes one of eukaryocyte or several genes production The method of object expression, wherein the cell includes the DNA molecular for encoding one or more gene products, the method includes Non-naturally occurring CRISPR-Cas system comprising one or more carriers is introduced into cell, the carrier includes: a) may be used It is operatively coupled to the H1 promoter of the nucleotide sequence of at least one coding CRISPR-Cas systematic direction RNA (gRNA), Middle gRNA hybridizes with the target sequence of DNA molecular；And b) be operably connected to the nucleotide sequence of coding II type Cas9 albumen The operable regulating element in eukaryocyte, wherein component (a) and (b) are located on the identical or different carrier of system, thus GRNA is targeted and hybridize with target sequence and Cas9 Protein cleavage DNA molecular, and to change the table of one or more gene products It reaches.In one aspect, target sequence can be with any nucleotide, such as N₂₀The target sequence that NGG starts.In some embodiments In, target sequence includes nucleotide sequence AN₁₉NGG.In some embodiments, target sequence includes nucleotide sequence GN₁₉NGG.? In some embodiments, target sequence includes nucleotide sequence CN₁₉NGG.In some embodiments, target sequence includes nucleotides sequence Arrange TN₁₉NGG.In some embodiments, target sequence includes nucleotide sequence AN₁₉NGG or GN₁₉NGG.On the other hand, Cas9 Albumen is through codon optimization to express in cell.It yet still another aspect, Cas9 albumen is through codon optimization in eukaryocyte Expression.On the other hand, eukaryocyte is mammal or people's cell.On the other hand, the table of one or more gene products Up to being lowered.

Presently disclosed theme also provides the method for changing one of eukaryocyte or several genes product expression, wherein The cell includes the DNA molecular for encoding one or more gene products, and the method includes will including containing two-way H1 The non-naturally occurring CRISPR-Cas system of the carrier of promoter is introduced into cell, wherein two-way H1 promoter includes: a) existing The control of transcription is provided on one direction of the nucleotide sequence of at least one coding CRISPR-Cas systematic direction RNA (gRNA) Element, wherein gRNA hybridizes with the target sequence of DNA molecular；And b) in the phase negative side of the nucleotide sequence of coding II type Cas9 albumen The control element of transcription is provided upwards, thus gRNA is targeted and is hybridized with target sequence, and Cas9 Protein cleavage DNA molecular, and by This changes the expression of one or more gene products.In one aspect, target sequence can be with any nucleotide, such as N₂₀NGG The target sequence of beginning.In some embodiments, target sequence includes nucleotide sequence AN₁₉NGG.In some embodiments, target Sequence includes nucleotide sequence GN₁₉NGG.In some embodiments, target sequence includes nucleotide sequence CN₁₉NGG.Some In embodiment, target sequence includes nucleotide sequence TN₁₉NGG.On the other hand, target sequence includes nucleotide sequence AN₁₉NGG Or GN₁₉NGG.On the other hand, Cas9 albumen is through codon optimization to express in cell.It yet still another aspect, Cas9 albumen passes through Codon optimization in eukaryocyte to express.On the other hand, eukaryocyte is mammal or people's cell.In another party The expression in face, one or more gene products is lowered.

In some respects, the offer of presently disclosed theme include by one or more polynucleotides, such as it is one or more Carrier as described herein, one or more transcript, and/or it is thin to host by one or more protein deliveries that it is transcribed The method of born of the same parents.In some respects, presently disclosed theme also provides the cell generated by these methods, and includes these cells Or the organism (such as animal, plant or fungi) generated by these cells.It in some embodiments, will be with guide sequence group The CRISPR enzyme for closing (and optionally compound with it) is delivered to cell.Conventional can based on virus and non-viral gene transfer method For introducing nucleic acid in mammalian cell or target tissue.This method can be used for that the nucleic acid of CRISPR system components will be encoded It is administered to the cell in culture or in host organisms.Non-virus carrier delivery system includes DNA plasmid, RNA (such as this paper institute State the transcript of carrier), naked nucleic acid and the nucleic acid compound with delivery vehicle (such as liposome).Viral vector delivery system packet DNA and RNA virus are included, there is additional or integration genome after being delivered to cell.For the summary of gene therapy procedure, Referring to Anderson (1992)Science256:808-813；Nabel and Felgner (1993) TIBTECH 11:211- 217；Mitani and Caskey (1993) TIBTECH 11:162-166；Dillon (1993) TIBTECH 11:167-175； Miller(1992) Nature357:455-460；Van Brunt(1998)Biotechnology6 (10): 1149- 1154；Vigne(1995)Restorative Neurology and Neuroscience8:35-36；Kremer and Perricaudet(1995) British Medical Bulletin51 (1): 31-44；Haddada et al. (1995) Current Topics in Microbiology and Immunology. Doerfler and Bohm (eds)；With Yu et al. (1994) Gene Therapy1:13-26.

The method of non-viral delivery nucleic acid includes fat transfection, nuclear transfection, microinjection, Biolistic, virion, liposome, Immunoliposome, polycation or lipid: the reagent of nucleic acid conjugate, naked DNA, artificial viral particle and DNA enhance intake.Rouge Transfection is described in such as U.S. Patent number 5,049,386,4,946,787；With 4,897,355) and lipofectin reagent commercial distribution (such as Transfectam and Lipofectin).The cation of effective Receptor recognition fat transfection suitable for polynucleotides It include those of following with neutral lipid: Felgner, WO 91/17424；WO 91/16024.Can be delivered to cell (such as External or in vitro application) or target tissue (such as application in vivo).

Lipid: the preparation of nucleic acid complexes, including target liposomes such as immunolipid compound, are art technologies Known to personnel (such as Crystal (1995)Science270:404-410；Blaese et al. (1995)Cancer Gene Ther(1994) 2:291-297:Behr et al.Bioconjugate Chem5:382-389；Remy et al. (1994)Bioconjugate Chem5:647-654；Gao et al. (1995)Gene Therapy2:710-722；Ahmad et al. (1992) Cancer Res52:4817-4820；U.S. Patent number 4,186,183,4,217,344,4,235,871,4, 261,975,4,485,054,4,501,728,4,774,085,4,837,028 and 4,946,787).

It is using the method that height is evolved that virus targeting is internal using nucleic acid is delivered based on the system of RNA or DNA virus Specific cells and virus loads are transported to nucleus.Viral vectors can be applied directly to patient (internal) or they can be with For ex vivo treatment of cells, and the cell of modification optionally can be administered to patient (in vitro).Conventional is based on virus System may include the retrovirus for gene transfer, slow virus, adenovirus, gland correlation and herpes simplex virus vector.With Retrovirus, slow virus and adeno-associated virus gene transfer method can be integrated in host genome, typically result in insertion Transgenosis long-term expression.In addition, observing high transduction efficiency in many different cell types and target tissue.

The taxis of retrovirus can extend the potential target group of target cell by mixing external envelope protein to change Become.Slow virus carrier is retroviral vector, can transduce or infect non-dividing cell and generally produce high virus titer. Therefore, the selection of reverse transcription virus gene transfer system depends on target tissue.Retroviral vector is by having up to 6-10kb The cis acting long terminal repeats of the capacity packing of exogenous array forms.Minimum cis acting LTR is sufficient to carrier Then duplication and packaging are used for being integrated into therapeutic gene in target cell to provide permanent transgenic expression.Make extensively Retroviral vector includes being based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), and ape and monkey are immune Defective virus (SIV), those of human immunodeficiency virus (HIV) and combinations thereof (such as Buchscher et al. (1992)J. Virol66:2731-2739；Johann et al. (1992)J. Virol66:1635-1640；Sommnerfelt et al. (1990) J. Virol176:58-59；Wilson et al. (1989)J. Virol63:2374-2378；Miller et al. (1991) J. Virol65:2220-2224；PCT/US94/05700).It, can be in the application of wherein preferred transient expression Use the system based on adenovirus.There is very high transduction efficiency in many cell types based on the carrier of adenovirus, and Cell division is not needed.With such carrier, the high titre and level of expression have been obtained.The carrier can be relatively simple Mass production in system.Adeno-associated virus (" AAV ") carrier can also be used for using target nucleic acid transducer cell, for example, in nucleic acid and peptide Produced in vitro in, and in vivo and ex vivo gene therapy program (such as West et al. (1987)Virology160: 38-47；U.S. Patent number 4,797,368；WO 93/24641；Kotin(1994)Human Gene Therapy5:793- 801；Muzyczka(1994)J. Clin. Invest94:1351.The building of recombination AAV carrier is described in many publications In, including U.S. Patent number 5,173,414；Tratschin et al. (1985)Mol. Cell. Biol5:3251-3260； Tratschin et al. (1984)Mol. Cell. Biol4:2072-2081；Hermonat and Muzyczka (1984)Proc. Natl. Acad. Sci. U.S.A81:6466-6470；With Samulski et al. (1989)J. Virol.63: 03822-3828。

Incasing cells is typically formed the virion that can infect host cell.These cells include packaging adenovirus 293 cells and packaging retrovirus 2 cell of ψ or PA317 cell.Viral vectors for gene therapy usually passes through It generates and nucleic acid carrier is packaged into the cell line in virion to generate.Carrier usually contains packaging and is then integrated into host Needed for minimum virus sequence, other virus sequences are replaced by the expression cassette of polynucleotides to be expressed.The viral function of missing It can be usually by the trans- offer of package cell line.For example, the AAV carrier for gene therapy, which usually only has, comes from AAV genome ITR sequence, be packaging, transgene expression and necessary to being integrated into host genome.Viral DNA is packaged in cell line In, which contains the helper plasmid for encoding other AAV genes, i.e. rep and cap, but lacks ITR sequence.Cell line can be with Adenovirus is used to infect as adminicle；293 cells and its derivative contain adenovirus DNA, and therefore AAV packaging is not needed Adenovirus infection.Helper virus promotes the duplication of AAV carrier and the expression of the AAV gene from helper plasmid.Due to lacking ITR Sequence, helper plasmid are not packed with significant quantity.Heat treatment that can be more sensitive for example, by adenovirus ratio AAV with adenovirus virus contamination To reduce.Other methods of delivery of nucleic acids to cell are known to the skilled in the art.For example, see US20030087817, It is incorporated herein by reference.

In some embodiments, with one or more carriers as described herein are instantaneous or non-instantaneous transfection host cell. In some embodiments, cell is transfected when it is naturally present in subject.In some embodiments, transfection is thin Born of the same parents are derived from subject.In some embodiments, cell-derived from the cell for being derived from subject, such as cell line.For organizing The various kinds of cell system of culture is known in the art.The example of cell line includes but is not limited to C8161, CCRF-CEM, MOLT, MIMCD-3, NHDF, HeLa-S3, Huh1, Huh4, Huh7, HUVEC, HASMC, HEKn, HEKa, MiaPaCell, Panel, PC- 3, TF1, CTLL-2, C1R, Rat6, CV1, RPTE, A10, T24, J82, A375, ARH-77, Calu1, SW480, SW620, SKOV3, SK-UT, CaCo2, P388D1, SEM-K2, WEHI-231, HB56, TIB55, Jurkat, J45.01, LRMB, Bcl-1, BC-3, IC21, DLD2, Raw264.7, NRK, NRK-52E, MRC5, MEF, Hep G2, HeLa B, HeLa T4, COS, COS-1, COS-6, COS-M6A, BS-C-1 monkey kidney epithelial cell, BALB/3T3 mouse embryonic fibroblasts, 3T3 Swiss, 3T3-L1, 132-d5 human fetal fibroblast；10.1 l cells, 293-T, 3T3,721,9L, A2780, A2780ADR, A2780cis, A172, A20, A253, A431, A-549, ALC, B16, B35, BCP-1 cell, BEAS-2B, bEnd.3, BHK- 21, BR 293, BxPC3, C3H-10T1/2, C6/36, Cal-27, CHO, CHO-7, CHO-IR, CHO-K1, CHO-K2, CHO-T, CHO Dhfr/, COR-L23, COR-L23/CPR, COR-L23/5010, COR-L23/R23, COS-7, COV-434, CML T1, CMT, CT26, D17, DH82, DU145, DuCaP, EL4, EM2, EM3, EMT6/AR1, EMT6/AR10.0, FM3, H1299, H69, HB54, HB55, HCA2, HEK-293, HeLa, Hepa1c1c7, HL-60, HMEC, HT-29, Jurkat, JY cell, K562 Cell, Ku812, KCL22, KG1, KYO1, LNCap, Ma-MeI 1-48, MC-38, MCF-7, MCF-10A, MDA-MB-231, MDA-MB-468, MDA-MB-435, MDCK II, MDCK II, MOR/0.2R, MONO-MAC 6, MTD-1A, MyEnd, NCI- H69/CPR, NCI-H69/LX10, NCI-H69/LX20, NCI-H69/LX4, NIH-3T3, NALM-1, NW-145, OPCN/OPCT Cell line, Peer, PNT-1A/PNT 2, RenCa, RIN-5F, RMA/RMAS, Saos-2 cell, Sf-9, SkBr3, T2, T- 47D, T84, THP1 cell line, U373, U87, U937, VCaP, Vero cell, WM39, WT-49, X63, YAC-1, YAR and its turn Gene kind.Cell line can be obtained from a variety of sources well known by persons skilled in the art (see, e.g., American Type culture Collection (ATCC) (Manassus, VA)).In some embodiments, it is transfected with one or more carriers as described herein Cell for establishing the New cell line comprising one or more carrier derived sequences.In some embodiments, with such as herein The component of the CRISPR system transiently transfects (such as by transiently transfecting one or more carriers, or with RNA transfection), and It is used to establish comprising containing modification but lacking any other exogenous array by the cell of the activity modifying of CRISPR compound The New cell line of cell.In some embodiments, with one or more carriers as described herein are instantaneous or non-instantaneous transfection Cell, or the cell line derived from such cell is for assessing one or more test compounds.

In some embodiments, one or more carriers described herein are for generating non-human transgenic animal.One In a little embodiments, transgenic animals are mammal, such as mouse, rat or rabbit.In certain embodiments, organism or Subject is plant.The method for generating transgenic animals is known in the art, and is usually started in cell transfecting method, such as It is described herein.

In one aspect, presently disclosed theme provides the method for target polynucleotide in modifying eukaryotic cells, the method It can be in vivo, it is in vitro or external.In some embodiments, this method includes sampling cell or cell from people or non-human animal Group, and modify one or more cells.Culture can occur in vitro any stage.It even can will be one or more thin Born of the same parents are reintroduced back in non-human animal.

In one aspect, presently disclosed theme provides the method for target polynucleotide in modifying eukaryotic cells.In some realities It applies in scheme, this method includes that CRISPR compound is allowed to be integrated to target polynucleotide to realize the cutting of target polynucleotide, from And modify target polynucleotide, wherein CRISPR compound include the CRISPR enzyme compound with guide sequence, the guide sequence with Target sequence hybridization in target polynucleotide.

In one aspect, presently disclosed theme provides the method for polynucleotides expression in modifying eukaryotic cells.Some In embodiment, this method includes making CRISPR compound in conjunction with polynucleotides so that in conjunction with causing the expression of polynucleotides to increase It adds deduct few；Wherein CRISPR compound includes the CRISPR enzyme compound with guide sequence, the guide sequence and polynucleotides Interior target sequence hybridization.

In one aspect, presently disclosed theme provides the method for one or more elements using CRISPR system.When The CRISPR compound of preceding disclosed theme provides the effective means of modification target polynucleotide.The CRISPR of presently disclosed theme Compound serves many purposes, and is included in modification in various kinds of cell type (for example, missing, insertion, transposition inactivate, activation) target Polynucleotides.Therefore, the CRISPR compound of presently disclosed theme is in such as gene therapy, drug screening, medical diagnosis on disease and It is had a wide range of applications in prognosis.Illustrative CRISPR compound includes the CRISPR enzyme compound with guide sequence, the finger Sequence is led to hybridize with the target sequence in target polynucleotide.

The target polynucleotide of CRISPR compound can be that eukaryocyte is endogenous or any polynucleotides of external source.For example, Target polynucleotide can be resident in the polynucleotides in the nucleus of eukaryocyte.Target polynucleotide can be encoding gene production The sequence of object (such as protein) or non-coding sequence (such as adjusting polynucleotides or junk DNA).It is not wishing to be bound by theory, It is believed that target sequence should be with PAM (prototype interval adjacent motif) association；That is, the short sequence identified by CRISPR compound Column.The precise sequence and length requirement of PAM is different according to CRISPR enzyme used, but PAM is usually and protospacer phase Adjacent 2-5 base-pair sequence (i.e. target sequence).The example of PAM sequence provides in following embodiment part, and technology people Member will identify other PAM sequences for giving CRISPR enzyme.

The example of target polynucleotide includes sequence relevant to signal transduction biochemical route, such as signal transduction biochemical route Related gene or polynucleotides.The example of target polynucleotide includes disease related gene or polynucleotides." disease is related " gene Or polynucleotides refer to compared with the tissue or cell of non-disease control, with exception in the cell derived from sickness influence tissue Horizontal or anomaly pattern generates any gene or polynucleotides of transcription or translation product.It may be in unusual high levels following table The gene reached；It can be with the gene of abnormal low expression level, wherein the generation and/or progress phase of the expression changed and disease It closes.Disease related gene also refers to the gene with one or more mutation or hereditary variation, be directly responsible for the disease cause of disease or with The gene linkage for being responsible for the disease cause of disease is uneven.The product of transcription or translation may be known or unknown, thereby increases and it is possible to be in Normal or abnormal level.

The embodiment of presently disclosed theme further relates to repeat with knockout gene, amplification gene and reparation with DNA unstable Qualitative specific mutation relevant with neurological disorder related method and composition (Robert D. Wells, Tetsuo Ashizawa, Genetic Instabilities and Neurological Diseases, the second edition, Academic Press, on October 13rd, 2011-Medical).It has been found that the particular aspects of tandem repetitive sequence are responsible for being more than 20 kinds of mankind Disease (McIvor et al. (2010)RNA Biol.7 (5): 551-8).It can use CRISPR-Cas system and carry out suppressor These instable defects of group.

C. preparation

In one aspect, the present invention provides pharmaceutically acceptable composition, and it includes Geminivirus packaging systems (that is, rAAV (example Such as, rAAV-Onco-CRISPR or rAAV-TSG) and Ad-rAAVpack), with one or more pharmaceutically acceptable carriers (additive) and/or diluent are prepared together.On the other hand, composition can apply as former state or with pharmaceutically acceptable load Body mixing is applied and can also be administered in combination with other anti-cancer therapies, such as chemotherapeutant, scavenger compounds, and radiation is treated Method, biotherapy etc..Therefore, conjoint therapy includes the sequence of composition, while and separate or be co-administered, wherein after application When continuous compound, the therapeutic effect of application is not yet completely disappeared for the first time.

As described in detail later, pharmaceutical composition of the invention can especially be configured to apply in solid or liquid form With, including be suitable for those of following: (1) it is administered orally, for example, immersion liquid (aqueous solution or non-aqueous solution or suspension), tablet, Such as oral cavity, sublingual and systemic Absorption those of targeting, bolus, powder, granule is applied to the paste of tongue；(2) Parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection, such as sterile solution or suspension, or it is slow Release formulation；(3) part applies, for example, as the emulsifiable paste for being applied to skin, the patch or spraying of ointment or controlled release；(4) negative In road or in rectum, for example, pessary, emulsifiable paste or foam；(5) sublingual；(6) eyes；(7) transdermal；Or (8) nasal cavity.

As described above, comprising Geminivirus packaging system (i.e. rAAV (for example, rAAV-Onco-CRISPR or rAAV-TSG) and Ad-rAAVpack certain embodiments of composition)) can contain basic functionality, such as amino or alkyl amino, and therefore Pharmaceutically acceptable salt can be formed with pharmaceutically acceptable acid.These salt can be manufactured in application medium or dosage form It is prepared in situ in journey, or by separating the purifying compound of the invention of its free alkali form and suitable organic or inorganic acid Reaction, and the salt preparation being consequently formed is separated during subsequent purifying.Representative salt includes hydrobromate, hydrochloride, sulphur Hydrochlorate, disulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laruate, Benzoate, lactate, phosphate, toluene fulfonate, citrate, maleate, fumarate, succinate, tartaric acid Salt, naphthoate, mesylate, gluceptate, Lactobionate and dodecane sulfonate etc. are (see, e.g., Berge etc. People (1977) " Pharmaceutical Salts ",J. Pharm. Sci. 66:1-19)。

The pharmaceutically acceptable salt of the compound of the present invention includes the conventional non-toxic salts or quaternary ammonium salt of compound, for example, From nontoxic organic or inorganic acid.For example, this conventional nontoxic salts include derived from those of inorganic acid, such as hydrochloric acid Salt, hydrobromate, sulfate, sulfamate, phosphate, nitrate etc.；With the salt prepared by organic acid, such as acetate, third Hydrochlorate, succinate, glycollate, stearate, lactate, malate, tartrate, citrate, ascorbate, Palmitate, maleate, hydroxymaleic acid salt, phenylacetate, glutamate, benzoate, salicylate, sulfanilate, Aspirin salt, fumarate, toluene fulfonate, mesylate, ethane disulfonate, oxalates, ethoxy sulphur Hydrochlorate etc..

In other cases, comprising Geminivirus packaging system of the invention (that is, rAAV is (for example, rAAV-Onco-CRISPR Or rAAV-TSG) and composition Ad-rAAVpack) and therefore can be containing one or more acidic functionalities, can be with pharmacy Upper acceptable alkali forms pharmaceutically acceptable salt.These salt equally can be in application medium or dosage form manufacturing process Central Plains Position preparation, or by make its free acid form purifying compound and suitable alkali (such as pharmaceutically acceptable metal sun from The hydroxide of son, carbonate or bicarbonate), and ammonia, or separately reacted with pharmaceutically acceptable organic primary, secondary or tertiary amine To prepare.Representative alkali or alkaline earth metal salt includes lithium salts, sodium salt, sylvite, calcium salt, magnesium salts and aluminium salt etc..It can be used for The representative organic amine for forming base addition salts includes ethamine, diethylamine, ethylenediamine, ethanol amine, diethanol amine, piperazine etc. (referring to, For example, Berge etc., ibid).

Wetting agent, emulsifier and lubricant, such as lauryl sodium sulfate and magnesium stearate and colorant, release agent, Coating agent, sweetener, flavoring agent and aromatic, preservative and antioxidant can also exist in composition.

The example of pharmaceutically acceptable antioxidant includes: (1) water soluble antioxidant, such as ascorbic acid, half Guang Propylhomoserin hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite etc.；(2) oil-soluble inhibitor, such as ascorbic acid palm Acid esters, butylated hydroxyanisol (BHA), butylated hydroxytoluene (BHT), lecithin, propylgallate, alpha-tocopherol Deng；(3) metal-chelator, such as citric acid, ethylenediamine tetra-acetic acid (EDTA), D-sorbite, tartaric acid, phosphoric acid etc..

Include Geminivirus packaging system (i.e. rAAV (for example, rAAV-Onco-CRISPR or rAAV-TSG) and Ad- RAAVpack) composition of preparation includes being suitable in tumour, is taken orally, nasal cavity, part (including oral cavity and sublingual), rectum, yin The composition in road and/or parenteral administration.Preparation exists with unit dosage forms and can be by known to pharmaceutical field in which can be convenient Any method preparation.The amount that the active constituent of single formulation can be combined to produce with carrier material will be according to the place treated Specific method of application of advocating peace and change.The amount that the active constituent of single formulation can be combined to produce with carrier material usually will It is the amount for generating the compound of therapeutic effect.

In certain embodiments, comprising Geminivirus packaging system (i.e. rAAV (for example, rAAV-Onco-CRISPR or RAAV-TSG composite preparation) and Ad-rAAVpack) may include other carriers to allow higher stability, to allow more High stability, different releasing properties, target specific site, or will allow the target into subject or subject more in vivo Effectively deliver Geminivirus packaging system (i.e. rAAV (such as rAAV-Onco-CRISPR or rAAV-TSG) and Ad-rAAVpack) Any other required feature, such as, but not limited to liposome, microballoon, nanosphere, nano particle, bubble, micelle forming agent, Such as bile acid and polymer support, such as polyester and polyanhydride.In certain embodiments, previous formulations make the present invention Compound bioavailable by oral administration.

Geminivirus packaging system liquid dose formulations (i.e. rAAV (such as rAAV-Onco-CRISPR or rAAV-TSG) and It Ad-rAAVpack) include pharmaceutically acceptable lotion, microemulsion, solution, suspension, syrup and elixir.Except active constituent Outside, liquid dosage form contains inert diluent commonly used in the art, such as water or other solvents, solubilizer and emulsifier, such as second Alcohol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, Ergol, propylene glycol, 1,3-BDO, oily (especially cotton Seed, peanut, corn, plumule, olive, castor-oil plant and sesame oil), glycerol, tetrahydrofuran alcohol, polyethylene glycol and sorbitan Aliphatic ester and its mixture.

Besides inert diluents, Orally administered composition can also include adjuvant, such as wetting agent, emulsifier and suspending agent, sweet taste Agent, flavoring agent, colorant, aromatic and preservative.

In addition to the active compound, suspension can contain suspending agent, such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol Pure and mild sorbitan ester, microcrystalline cellulose, inclined aluminium hydroxide, bentonite, agar and bassora gum and its mixture.

The preparation for being suitable for being administered orally can be capsule, cachet, pill, tablet, and pastille (using seasoning basis, leads to It is often sucrose and Arabic gum or bassora gum), the form of powder, granule, or as molten in waterborne liquid or non-aqueous liquid Liquid or suspension, or as oil-in-water or water-in-oil liquid lotion, or as elixir or syrup, or as pastille (pastilles) (use inert base, such as gelatin and glycerol or sucrose and Arabic gum) and/or as mouthwass Deng each active constituent containing predetermined amount.Include Geminivirus packaging system of the invention (i.e. rAAV (such as rAAV- Onco-CRISPR or rAAV-TSG) and composition Ad-rAAVpack) can also be used as bolus, electuary or paste are applied With.

In solid dosage forms (for example, capsule, tablet, pill, dragee, powder, granule etc.), active constituent and it is a kind of or The mixing of a variety of pharmaceutically acceptable carriers, such as sodium citrate or Dicalcium Phosphate, and/or following any: (1) filler or Incremental agent, such as starch, lactose, sucrose, glucose, mannitol and/or silicic acid；(2) adhesive, such as carboxymethyl cellulose, algae Hydrochlorate, gelatin, polyvinylpyrrolidone, sucrose and/or Arabic gum；(3) moisturizer, such as glycerol；(4) disintegrating agent, such as agar, Calcium carbonate, potato or tapioca, alginic acid, certain silicates and sodium carbonate；(5) solution retardant, such as paraffin；(6) it inhales Receive promotor, such as quaternary ammonium compound；(7) wetting agent, such as cetanol, glycerin monostearate and nonionic surfactant； (8) absorbent, such as kaolin and POLARGEL NF；(9) lubricant, such as talcum, calcium stearate, magnesium stearate, the poly- second of solid Glycol, lauryl sodium sulfate and its mixture；(10) colorant.In the case where capsule tablet and pill, composition is also It may include buffer.The solid composite of similar type also is used as the filler in soft hard-shell gelatin capsule, using such as The excipient and high molecular weight polyethylene glycol etc. such as lactose (loctose) or lactose (milk sugar).

Tablet can be made by compressing or molding, optionally with one or more auxiliary elements.Adhesive can be used (for example, gelatin or hydroxypropyl methyl cellulose), lubricant, inert diluent, preservative, disintegrating agent is (for example, hydroxyacetic acid forms sediment Powder sodium or croscarmellose sodium), surfactant or dispersing agent prepare compressed tablets.Molded tablet can by It is prepared by the mixtures of the powder compounds that molding is soaked with inert liquid diluent in suitable machine.

Tablet and other solid dosage forms, such as dragee, capsule, pill and particle are optionally obtained with coating and shell It obtains or prepares, such as other coatings known to enteric coating and pharmaceutical-formulating art.They can also be configured to provide therein Active constituent slowly or controlled release, for example, bent to provide required release using the hydroxypropyl methyl cellulose of different proportion Line, other polymer substrates, liposome and/or microballoon.Composition can also be configured to quick release, such as be freeze-dried.It Can be for example, by being filtered by bacteria retaining filter, or the bactericidal agent by mixing aseptic solid composite form go out Bacterium, the bactericidal agent can be dissolved in sterile water or some other sterile injectable mediums immediately using preceding.These combinations Object can also optionally containing opacifier and can be only or preferably in certain a part of gastrointestinal tract, optionally with the side of delay Formula discharges the composition of one or more active constituents.The example for the insertion composition that can be used includes polymeric material and wax. If appropriate, active constituent is also possible to the microencapsulation form of one or more above-mentioned excipient.

Preparation for rectum or vaginal application can be used as suppository offer, can be by by one or more present invention Compound mixed with one or more suitable nonirritant excipients or carrier to prepare, the excipient or carrier include Such as cocoa butter, polyethylene glycol, suppository wax or salicylate, and be at room temperature solid, but be under body temperature liquid, and therefore Simultaneously release of active compounds will be melted in rectum or vaginal canal.

Preparation suitable for vaginal application further includes the pessary containing suitable carrier known in the art, tampon, emulsifiable paste, Gel, paste, foam or spray formulation.

It include Geminivirus packaging system of the invention (that is, rAAV is (for example, rAAV-Onco- for part or transdermal administration CRISPR or rAAV-TSG) and the dosage form of composition Ad-rAAVpack) include powder, spraying, ointment, paste, emulsifiable paste washes Agent, gel, solution, patch and inhalant.Reactive compound can aseptically with pharmaceutically acceptable carrier, and with Any preservative that may be needed, buffer or propellants.

Other than reactive compound of the invention, ointment, paste, emulsifiable paste and gel can contain excipient, such as move Object and plant fat, oil, wax, paraffin, starch, bassora gum, cellulose derivative, polyethylene glycol, siloxanes, bentonite, silicic acid, Or mixtures thereof talcum and zinc oxide,.

Powder and excipient, such as lactose, talcum, silicic acid, aluminium hydroxide, calcium silicates and Silon can be contained by spraying The mixture of end or these substances.Conventional propellant, such as chlorofluorocarbons and the unsubstituted hydrocarbon of volatility can in addition be contained by spraying, Such as butane and propane.

Transdermal patch, which has to body, provides the attendant advantages of controlled delivery.These dosage forms can be by dissolving compound Or it is dispersed in medium appropriate and prepares.Sorbefacient can also be used for increasing the flux of compound on the skin.It can lead to Offer rate controlling membranes are provided or compound is dispersed in polymer substrate or gel to the rate for controlling this flux.

Ophthalmic preparation, ophthalmic ointment, powder, solution etc. are intended to be included within the scope of the present invention.

Pharmaceutical composition suitable for applying in parenteral or tumor may include sterile isotonic aqueous solution or non-aqueous solution, dispersion Liquid, suspension or lotion or aseptic powdery can be reconstructed into sterile injectable solution or dispersion liquid before use, can contain Sugar, alcohol, antioxidant, buffer, bacteriostatic agent make blood or suspending agent or isotonic molten of thickener of preparation and expected recipient Matter.

The suitable aqueous and non-aqueous carrier example of pharmaceutical composition for use in the present invention includes water, and ethyl alcohol is more First alcohol (such as glycerol, propylene glycol, polyethylene glycol etc.) and its suitable mixture, vegetable oil are organic such as olive oil and injectable Ester, such as ethyl oleate.For example, by using coating material such as lecithin, by keeping required grain in the case of a dispersion Degree, and by using surfactant, mobility appropriate can be kept.

In certain embodiments, according to method and composition provided herein, aforementioned pharmaceutical compositions can be with ability Other pharmaceutically active compounds (" the second activating agent ") combinations known to domain.Second activating agent can be macromolecular (such as albumen Matter) or small molecule (such as synthesis is inorganic, organic metal or organic molecule).In one embodiment, the second activating agent is only On the spot or synergistically help treating cancer.

For example, chemotherapeutant is anticancer agent.Term chemotherapeutant includes but is not limited to the reagent based on platinum, such as is blocked Platinum and cis-platinum；Mustargen alkylating agent；Nitroso ureas alkylating agent, such as Carmustine (BCNU) and other alkylating agents；Antimetabolite, such as Methotrexate (MTX)；Purine analogue antimetabolite；Pyrimidine analogue antimetabolite, such as fluorouracil (5-FU) and gemcitabine；Swash Plain antineoplastic, such as Goserelin, Leuprorelin and tamoxifen；Natural antitumor medicine, such as taxane (such as docetaxel and purple China fir alcohol), Aldesleukin, interleukin 2, Etoposide (VP-16), interferon-' alpha ' and vitamin A acid (ATRA)；Antibiotic day Right antineoplastic, such as bleomycin, D actinomycin D, daunorubicin, Doxorubicin and mitomycin；It is natural with vinca alkaloids Antineoplastic, such as vincaleukoblastinum and vincristine.

In addition, agents can also be applied in combination with antitumor agent: actinomyces even if not considering antitumor agent itself Element；Daunorubicin HC1；Docetaxel；Doxorubicin HC1；Epoetin alfa (epoetin alfa)；Etoposide (VP-16)； Cymevan (Syntex)；Gentamicin sulphate；Interferon-' alpha '；Leuprorelin acetate；Pethidine HCl；Methadone HC1；Ranitidine HCl； Vinblastine sulfate；With Zidovudine (AZT).For example, fluorouracil is prepared together with adrenaline and bovine collagen with shape recently At particularly effective combination.

Further, it is also possible to using following amino acid, peptide, polypeptide, protein, polysaccharide and other macromoleculars: interleukin-11 is extremely 18, including mutant and analog；Interferon or cell factor, such as interferon-' alpha ', β and γ；Hormone, as metakentrin discharges Hormone (LHRH) and analog and gonadotropin-releasing hormone (GRH) (GnRH)；Growth factor, such as transforming growth factor-β (TGF- β), fibroblast growth factor (FGF), nerve growth factor (NGF), somatotropin releasing factor (GHRF), epidermal growth The factor (EGF), fibroblastic growth factor autofactor 1 (FGFHF), hepatocyte growth factor (HGF) and insulin growth because Sub (IGF)；Tumor necrosis factor-alpha & β (TNF-α & β)；It invades inhibiting factor -2 (IIF-2)；Bone morphogenetic protein 1-7 (BMP 1-7)；Growth hormone release inhibiting hormone；Thymosin extrasin-α -1；Gamma globulin；Superoxide dismutase (SOD)；Recruitment factor；It is anti-angiogenic Generate the factor；Antigen-like material；And prodrug.

The chemotherapeutant being used together with composition as described herein with treatment method includes but is not limited to alkylating agent, example Such as thiotepa and cyclophosphamide；Alkyl sulfonic ester, such as busulfan, Improsulfan and piposulfan；Aziridine, such as Benzodopa, carboquone, meturedopa and uredopa；Aziridine and methyl melamine, including hemel, it is bent he Amine, trivinyl phosphamide, trivinyl thio-phosphamide and trimethylol melamine；Acetogenin is (especially Bullatacin and bullatacinone)；Camptothecine (including synthetic analogues Hycamtin)；Bryostatin； callystatin；CC-1065 (including its Adozelesin, Carzelesin and bizelesin synthetic analogues)； Cryptophycin (especially cryptophycin1 and cryptophycin8)；Dolastatin；Duocarmycin (including Synthetic analogues, KW-2189 and CB1-TM1)；eleutherobin；pancratistatin；sarcodictyin； spongistatin；Mustargen, such as Chlorambucil, Chlornaphazine, chlorine phosphamide, Estramustine, ifosfamide, double chloroethyl first Amine, Mechlorethaminoxide Hydrochloride, melphalan, novembichin, phenesterin, prednimustine, Trofosfamide, uracil mastard；Nitrous Base ureas, such as Carmustine, chlorozotocin, Fotemustine, lomustine, Nimustine and thunder Nimustine；Antibiotic such as alkene Two acetylenic antibiotic (such as calicheamicin, especially calicheamicin γ l and calicheamicin ω l；Dynemicin, including dynemicin A；Diphosphonate, such as clodronate；esperamicin；And neocarzinostatin chromophore and related chromoprotein Enediyne antibiosis looks for group, aclacinomysins, D actinomycin D, authrarnycin, azaserine, and bleomycin is put Line rhzomorph C, carabicin, caminomycin, carzinophillin, chromomycinis, actinomycin D, daunomycin, ground support Than star, 6- diazonium -5- oxn-l-norieucin, adriamycin (including morpholino-adriamycin, cyanomorpholino-doxorubicin, 2- pyrrole Cough up quinoline generation-adriamycin and deoxy doxorubicin (deoxydoxoricicin)), epirubicin, esorubicin, idarubicin, fiber crops west Sieve mycin, mitomycin such as mitomycin C, mycophenolic acid, nogalamycin, olivomycin class, Peplomycin, potfiromycin, Puromycin, triferricdoxorubicin, rodorubicin, streptonigrin, streptozotocin, tubercidin, ubenimex, Zinostatin, Zorubicin；Antimetabolite such as methotrexate (MTX) and 5 FU 5 fluorouracil (5-FU)；Folacin such as denopterin, first ammonia butterfly Purine, pteropterin, Trimetrexate；Purine analogue such as fludarabine, Ismipur, thiapurine, thioguanine；Pyrimidine is similar Object such as ancitabine, azacitidine, 6- aza uridine, Carmofur, cytarabine, dideoxyuridine, how western floxuridine, Yi Naxi Class, floxuridine；Male sex hormone such as Calusterone, Masterone, epithioandrostanol, Mepitiostane, Testolactone；Antiadrenergic drug Such as aminoglutethimide, mitotane, trilostane；Folic acid supplement such as frolinic acid；Aceglatone；Aldophosphamide sugar Glycosides；Amino-laevulic acid；Eniluracil；Amsacrine；bestrabucil；Bisantrene；edatraxate；defofamine；Ground beauty It can be pungent；Diaziquone；elformithine；Elliptinium Acetate；epothilone；Ethoglucid；Gallium nitrate；Hydroxycarbamide；Lentinan； lonidainine；CHROMATOGRAPHIC FRACTIONATION AND MASS such as maytansine and ansamitocin；Mitoguazone；Mitoxantrone；mopidanmol； nitraerine；Pentostatin；Phenamet；Pirarubicin；Losoxantrone；Podophyllic acid；2- ethylhydrazide；Procarbazine；PSK Polysaccharide compound)；Razoxane；Rhizomycin；sizofuran；Spiro germanium；Tenuazonic acid；Triethyleneiminobenzoquinone；2,2',2''- Ethylaluminum amine；Trichothecene (especially T-2 toxin, verracurin A, Roridine A and anguidine)；Urine Alkane；Eldisine；Dacarbazine；Mannomustin；Dibromannitol；Dulcitol；Pipobroman；gacytosine；It is Arabic Glucosides (" Ara-C ")；Cyclophosphamide；Phosphinothioylidynetrisaziridine；Taxanes, for example, taxol and docetaxel；Chlorambucil；Ji Xi His shore；6- thioguanine；Purinethol；Methotrexate (MTX)；Platinum coordinate complex, such as cis-platinum, oxaliplatin and carboplatin；Catharanthus roseus Alkali；Platinum；Etoposide (VP-16)；Ifosfamide；Mitoxantrone；Vincristine；Vinorelbine；Novantrone；Teniposide； Edatrexate；Daunorubicin；Aminopterin；Xeloda；Ibandronate；Irinotecan (for example, CPT-11)；Topoisomerase suppression Preparation RFS 2000；Difluoromethylornithine (DMFO)；Biostearin, such as vitamin A acid；Capecitabine；With any of above medicine Acceptable salt on, acid or derivative.

In another embodiment, composition of the invention may include other bioactive substances, including therapeutic agent Or prodrug, for example, other chemotherapeutants, scavenger compounds, antibiotic, antivirotic, antifungal agent, anti-inflammatory agent, blood vessel Contracting agent and anticoagulant, for cancer vaccine application or the antigen of corresponding prodrug.

Exemplary scavenger compounds include but is not limited to the compound containing mercaptan, such as glutathione, thiocarbamide and half Guang Propylhomoserin；Alcohol such as mannitol, substituted phenol；Quinone, substituted phenol, arylamine and nitro compound.

Various forms of chemotherapeutants and/or other bioactivators can be used.These include but is not limited to have The neutral molecule of bioactivity, molecular complex, salt, ether, ester, the forms such as amide.

II. the method for the treatment of cancer

Presently disclosed theme provides prevention, inhibit or treat subject in need (such as people) cancer method.The party Method is the following steps are included: (a) provides the non-naturally occurring nucleic acid enzyme system comprising one or more carriers (for example, CRISPR- Cas9), the carrier includes: i) being operably connected to the nucleosides of at least one code nucleic acid enzyme system guide RNA (gRNA) The promoter (for example, two-way H1 promoter) of acid sequence, the wherein DNA in the cell (for example, cancer cell) of gRNA and subject The target sequence of molecule hybridizes, and wherein DNA molecular encodes one or more gene products expressed in cell；Ii it) can operate Ground is connected to the operable regulating element in cell of the nucleotide sequence of encoding gene group targeted nuclease (such as Cas9), Wherein component (i) and (ii) are located on the identical or different carrier of system, and wherein gRNA is targeted and hybridized with target sequence, and nucleic acid Digestion cuts DNA molecular to change the expression of one or more gene products or inactivation；(b) a effective amount of system is applied to subject System.In some embodiments, adeno-associated virus packaging adenovirus (such as Ad-rAAVpack) and the gland containing nucleic acid enzyme system Correlated virus (i.e. Geminivirus packaging system) while or co-administration.In some embodiments, system is packaged into and is not had In single adeno-associated virus (AAV) particle for packing adenovirus.In some embodiments, adeno-associated virus (AAV) may include Any one of 11 kinds of human Adenovirus serotypes (for example, serotype 1-11).In some embodiments, gland related packaging adenopathy Poison includes at least one of adenoviral gene missing.In some embodiments, packaging adenovirus is selected from adenoviral serotype 2, adenoviral serotype 5 or adenoviral serotype 35.In some embodiments, packaging virus is adenoviral serotype 5.One In a little embodiments, adenoviral gene is selected from E1A, E1B, E2A, E2B, E3, E4, L1, L2, L3, L4 or L5.In some embodiment party In case, adenoviral gene is E3.In some embodiments, which inactivate one or more gene products.In some realities It applies in scheme, nucleic acid enzyme system cuts off at least one gene mutation.In some embodiments, promoter includes: a) at least It is a kind of encode gRNA nucleotide sequence a direction on the control element of transcription is provided；And core b) is targeted in encoding gene group The control element of transcription is provided in the opposite direction of the nucleotide sequence of sour enzyme.In some embodiments, Cas9 albumen is through close Numeral optimizes to express in cell.In some embodiments, promoter is operably connected at least one, and two, three It is a, four, five, six, seven, eight, nine or ten gRNA.In some embodiments, target sequence be oncogene or Tumor suppressor gene.In some embodiments, target sequence is the oncogene comprising at least one mutation.In some embodiments In, target sequence is selected from Her2, PIK3CA, KRAS, HRAS, IDH1, NRAS, EGFR, MDM2, TGF-β, RhoC, AKT, c- Myc, beta-catenin, PDGF, C-MET, PI3K-110 α, CDK4, cell periodic protein B 1, cyclin D1, estrogen Acceptor gene, Progesterone receptor gene, ErbB1 (v-erb-b2 into erythrocyte leukemia viral oncogene homolog 1), ErbB3 (v- Erb-b2 into erythrocyte leukemia viral oncogene homolog 3), PLK3, KIRREL, ErbB4 (the white blood of v-erb-b2 erythroblast Sick viral oncogene homolog 4), TGFα, ras-GAP, Shc, Nck, Src, Yes, Fyn, Wnt, Bcl2, PyV MT antigen, and The oncogene of SV40 T antigen.In some embodiments, target sequence is to be selected from EP300, FBXW7, GATA1, GATA2, NOTCH1, NOTCH2, EXT1, EXT2, PTCH1, SMO, SPOP, SUFU, APC, AXIN1, CDH1, CTNNB1, EP300, FAM123B, GNAS, HNF1A, NF2, PRKAR1A, RNF43, SOX9, ARID1A, ARID1B, ARID2, ASXL1, ATRX, CREBBP, DNMT1, DNMT3A, EP300, EZH2, H3F3A, HIST1H3B, IDH1, IDH2, KDM5C, KDM6A, MEN1, MLL2, MLL3, NCOA3, NCOR1, PAX5, PBRM1, SETD2, SETBP1, SKP2, SMARCA4, SMARCB1, SPOP, TET2, WT1, AR, BCOR, CREBBP, DAXX, DICER1, GATA3, IKZF1, KLF4, LMO1, PHOX2B, PHF6, PRDM1, RUNX1, SBDS, SF3B1, SRSF2, U2AF1, ABL1, BCL2, CARD11, CASP8, CCND1, CDC73, CDK4, CDKN2A, CDKN2C, CYLD, DAXX, FUBP1, MDM2, MDM4, MED12, MYC, MYCL1, MYCN, MYD88, NFE2L2, NPM1, PPM1D, PPP2R1A, RB1, TNFAIP3, TRAF7, TP53, ALK, B2M, BRAF, CBL, CEBPA, CSF1R, CIC, EGFR, ERBB2, FGFR2, FGFR3, FH, FLT3, GNA11, GNAQ, GNAS, HRAS, KIT, KRAS, MAP2K1, MAP3K1, MET, NRAS, NF1, PDGFRA, PTPN11, RET, SDH5, SDH8, SDHC, SDHD, VHL, AKT1, ALK, B2M, CBL, CEBPA, CSF1R, EGFR, ERBB2, FGFR2, FGFR3, FH, FLCN, FLT3, GNA11, GNAQ, GNAS, GPC3, KIT, MET, NKX21, PRKAR1A, PIK3CA, PIK3R1, PDGFRA, PTEN, RET, SDH5, SDH8, SDHC, SDHD, STK11, TSC1, TSC2, TSHR, VHL, WAS, CRLF2, FGFR2, FGFR3, FLT3, JAK1, JAK2, JAK3, KIT, MPL, SOCS1, VHL, B2M, CEBPA, ERK1, GNA11, GNAQ, MAP2K4, MAP3K1, NKX21, TNFAIP3, TSHR, WAS, ACVR1B, BMPR1A, FOXL2, GATA1, GATA2, GNAS, EP300, MED12, SMAD2, SMAD4, ATM, BAP1, BLM, BRCA1, BRCA2, BRIP1, BUB1B, CHEK2, ERCC2, ERCC3, ERCC4, ERCC5, FANCA, FANCC, FANCD2, FANCE, FANCF, FANCG, MLH1, MSH2, The cancer of MSH6, MUTYH, NBS1, PALB2, PMS1, PMS2, RECQL4, STAG2, TP53, WRN, XPA and XPC drive base Cause.In some embodiments, target sequence is the oncogene selected from KRAS, PIK3CA or IDH1.In some embodiments, target Sequence is oncogene, and the oncogene is KRAS.In some embodiments, KRAS includes selected from G13D, G12C or G12D Mutation.In some embodiments, target sequence is selected from SEQ ID NO:11-14, or combinations thereof.In some embodiments, target Sequence is oncogene, and the oncogene is PIK3CA.In some embodiments, PIK3CA include be selected from E345K, D549N or The mutation of H1047R.In some embodiments, target sequence is selected from SEQ ID NO:15-18, or combinations thereof.In some embodiment party In case, target sequence is oncogene, the oncogene IDH1.In some embodiments, IDH1 is mutated comprising R132H.Some In embodiment, gRNA sequence is selected from nucleotide sequence shown in SEQ ID NO:1-10, or combinations thereof.In some embodiments In, nucleic acid enzyme system is applied via systemic administration.In some embodiments, systemic administration is selected from oral, intravenously, skin It is interior, in peritonaeum, the application of subcutaneous and intramuscular.In some embodiments, it is applied in nuclease system tumor or around tumour.? In some embodiments, the method for claim 1 wherein at least one other anti-cancer agent therapies of the subject.One In a little embodiments, anticancer agent is selected from taxol, cis-platinum, Hycamtin, gemcitabine, bleomycin, Etoposide, carboplatin, Docetaxel, Doxorubicin, Hycamtin, cyclophosphamide, tributidine, olaparib, tamoxifen, Letrozole and shellfish cut down list It is anti-.In some embodiments, the subject is treated at least one other anti-cancer therapies.In some embodiments, Anti-cancer therapies are radiation-therapy, chemotherapy or operation.In some embodiments, cancer is solid tumor.In some embodiment party In case, cancer is selected from the cancer of the brain, human primary gastrointestinal cancers, carcinoma of mouth, breast cancer, oophoroma, prostate cancer, cancer of pancreas, lung cancer, liver cancer, throat Cancer, gastric cancer and kidney.In some embodiments, cancer is the cancer of the brain.In some embodiments, subject is mammal. In some embodiments, mammal is people.In some embodiments, the cell Proliferation in subject is suppressed or subtracts It is few.In some embodiments, the malignant tumour in subject is suppressed or reduces.In some embodiments, in subject Neoplasm necrosis enhancing increases.

The ability that E1B defective adenoviral effectively infects and crack tumour cell is disclosed.Although verified this cancer The mechanism on the basis of cytotaxis molten cancer adenovirus (referred to as Onyx- more more complicated than what is initially imagined, but being developed by Onyx 015) it shows well in some clinical tests, and is sold at present in China with Oncorine.Compared with ONYX-015, Ad- There is delicate E1B to be mutated for rAAVpack design, can prevent HIV suppression from responding to the congenital immunity of infection, but retaining will be viral RNA is exported to cytoplasmic ability.It is usually lost in many cancer cells by this response that interferon mediates.

Application of the Ad-rAAVpack in cancer proposes several policy selections.Companion rAAV can contain close tumour Inhibiting factor or immunostimulant such as interferon.Alternatively, companion rAAV can be equipped with CRISPR-Cas9 system (for example, AAV- H1-CRISPR system).It include that gRNA in this rAAV can be programmed to specifically target Cancer-causing mutation, or promote The reparation of defect tumor suppressor gene.

Dual virus system is that targeted gene delivery/targeting heredity changes for the prediction advantage of the treatment of cancer of independent rAAV The degree of change and duration.The therapeutic rAAV application of dose may target many cells in accessible tumour.Such as The cell proportion that fruit is modified in this way is not enough to significantly affect the process of disease, and Ad-rAAVpack can be combined with rAAV.Pass through matching The duplication potentiality of tumour itself, the cancer that Geminivirus packaging system can provide targeting greater proportion in longer time scale are thin The unique opportunity of born of the same parents.It is not wishing to be bound by theory, shows what how this molten cancer therapy of dual virus can work in Fig. 3 Example.

In order to target Cancer-causing mutation, can designing companion rAAV, that recurrent is inactivated in a manner of high degree of specificity is carcinogenic prominent Become.Provided herein is one group of gRNA, optionally destroy KRAS, PIK3CA and the IDH1 of cancer Related oncogene form.Always For, these specific mutations in KRAS and PIK3CA are found in most of cancers in lung and the entire road GI.Big IDH1 R132 mutation is found in about 30% glioma.These brain tumors are all particularly difficult to control to all conventional therapy forms More.Each of these gRNA are predominantly targeting mutation allele without causing to take off in remaining wild-type allele Targeted effect.

Term administering " is directed to subject and provides medicament or composition, and includes but is not limited to be applied by medical professional It is applied with self.

As used herein, term " obstacle " typically refers to will benefit from the chemical combination with target or approach for a kind of identification Any illness of object treatment, including can be directed to a kind of identification target or approach by a effective amount of compound or its pharmaceutically Any disease, the obstruction and illness of acceptable salts for treating.

Term " cancer " as used herein refers to the misgrowth of cell, tends to increase in an uncontrolled fashion It grows, and in some cases, shifts (diffusion).The type of cancer includes but is not limited to have or not in any stage of disease Solid tumor in the case where with transfer (such as bladder, intestines, brain, breast, endometrium, heart, kidney, lung, uterus, lymphoid tissue The tumour of (lymthoma), ovary, pancreas or other endocrine organs (thyroid gland)), prostate, (melanoma or substrate are thin for skin Born of the same parents' cancer) or neoplastic hematologic disorder (such as leukaemia and lymthoma).

Other non-limiting examples of cancer include hepatocellular carcinoma (HCC), and acute lymphoblastic leukemia is acute myelogenous white Blood disease, adrenocortical carcinoma, cancer of anus, appendix cancer, astrocytoma, atypia teratoma/rhabdoid tumor, basal cell Cancer, cholangiocarcinoma, bladder cancer, osteocarcinoma (osteosarcoma and malignant fibrous histiocytoma), brain stem glioma, brain tumor, brain and spinal cord Tumour, breast cancer, tumor of bronchus, Burkitt lymphoma, cervical carcinoma, chronic lymphocytic leukemia, the white blood of chronic granulocyte Disease, colon cancer, colorectal cancer, craniopharyngioma, skin T cell lymphoma, embryo tumor, carcinoma of endometrium, endyma mother cell Tumor, ependymoma, the cancer of the esophagus, Ewing sarcoma tumour family, cancer eye, retinoblastoma, gallbladder cancer, stomach (gastric) (stomach (stomach)) cancer, gastrointestinal associated cancers, gastrointestinal stromal tumor (GIST), patients with gastrointestinal stromal tumors, germinoma, colloid Tumor, hairy cell leukemia, head and neck cancer, hepatocellular carcinoma (liver cancer), Hodgkin lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cells Tumor (endocrine pancreas), Kaposi sarcoma, kidney, langerhans cell histiocytosis, laryngocarcinoma, leukaemia, acute leaching Bar chronic myeloid leukemia, acute myeloid leukaemia, chronic lymphocytic leukemia, chronic myelocytic leukemia, hairy cell leukemia, Liver cancer, lung cancer, non-small cell lung cancer, Small Cell Lung Cancer, Burkitt lymphoma, skin T cell lymphoma, Hodgkin lymphoma, Non-Hodgkin lymphoma, lymthoma, macroglobulinemia Waldenstron, medulloblastoma, medullo-epithelioma, melanocyte Tumor, celiothelioma, carcinoma of mouth, chronic myelocytic leukemia, myelomatosis, Huppert's disease, nasopharyngeal carcinoma, neuroblast Tumor, non-Hodgkin lymphoma, non-small cell lung cancer, mouth cancer, oropharyngeal cancer, osteosarcoma, malignant fibrous histiocytoma of bone, ovary Cancer, epithelial ovarian cancer, ovarian germ cell tumors, the low malignant potential tumour of ovary, cancer of pancreas, papillomatosis, parathyroid gland Cancer, carcinoma of penis, pharynx cancer, the pineal body parenchymal tumor of intermediate differentiation, pinealocytoma and Supratentorial primitive neuroectodermal tumour, Hypophysoma, plasma cell tumor/Huppert's disease, pleuropulinonary blastoma, primary central nervous system lymphoma, prostate Cancer, the carcinoma of the rectum, nephrocyte (kidney) cancer, retinoblastoma, rhabdomyosarcoma, salivary-gland carcinoma, sarcoma, Ewing sarcoma tumour man Race, sarcoma, Ka Boxi, Sezary syndrome, cutaneum carcinoma, Small Cell Lung Cancer, carcinoma of small intestine, soft tissue sarcoma, squamous cell carcinoma, stomach (gastric) (stomach (stomach)) cancer, Supratentorial primitive neuroectodermal tumour, t cell lymphoma, carcinoma of testis, throat cancer, chest Adenoma and thymic carcinoma, thyroid cancer, carcinoma of urethra, uterine cancer, sarcoma of uterus, carcinoma of vagina, carcinoma of vulva, the huge ball egg of Walden Si Telun White mass formed by blood stasis, wilms' tumor.

As used herein, term " treatment " may include reversing, and mitigate, the disease that inhibits the term to be applicable in, obstacle or The progress of illness or this disease, one or more symptoms of obstruction and illness (for example, cancer) or performance, prevention or reduction Its probability.In some embodiments, which reduces cancer cell.For example, thin with the cancer before being treated in subject Born of the same parents or the cancer cell in the subject not treated are compared, and treatment can make cancer cell reduce at least 5%, 10%, 15%, 20%, 25%, 30%, 33%, 35%, 40%, 45%, 50%, 55%, 60%, 66%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher.In some embodiments, the cancer cell in treatment complete inhibition subject.

In some embodiments, before being administered to subject, system is packaged into single adeno-associated virus (AAV) In grain.Treatment, application or therapy can be continuous or interval.Continuous treatment, application or therapy refer to based at least daily Treatment treats one day or multiple days without interrupting.Intermittent treatment or application, or treat or apply with intermittent mode, refer to it is not to connect Continuous, but circulative treatment.According to the treatment of presently disclosed method can cause disease, obstruction and illness it is completely slow One or more symptoms of solution or healing or disease, disease or illness are partly improved, and can be temporary or permanent. Term " treatment " is also aimed to including prevention, therapy and healing.

Term " effective quantity " or " therapeutically effective amount " refer to the amount for being enough to generate the reagent of beneficial or required result.Treatment has Effect amount can change according to following one or more: subject and disease condition to be treated, the weight of subject and age, The seriousness of disease condition, method of application etc. can be determined easily by those of ordinary skill in the art.The term is also applicable in In the dosage that will be provided for the image by any imaging method detection as described herein.Specific dosage can according to Under it is one or more and change: selected particular agent, the dosing scheme to be followed, if applied with other compound combinations With, administration time, the physical delivery system organized and wherein carry to be imaged.As understood by those of ordinary skill in the art , the effective quantity of reagent can be according to all biologic endpoints as required, reagent to be delivered, the composition of pharmaceutical composition, target Tissue or the factors such as cell and change.More specifically, term " effective quantity " refers to the amount for being enough to generate required effect, such as reduce Or disease is improved, the seriousness of obstruction and illness or one or more symptom, the duration is in progress or breaks out；Disease is prevented, The development of obstruction and illness causes disease, the recession of obstruction and illness；It prevents and disease, the relevant symptom of obstruction and illness Recurrence, development, breaking-out or progress, or enhancing or the prevention or therapeutic effect that improve another therapy.

Term " inhibit (inhibit) " or " inhibiting (inhibits) " mean before treat subject in subject and Untreated control subject, cell, biological approach or bioactivity or with target (such as growth of solid malignant) phase Than, reduce, inhibit, weaken, reduce, prevent or stable disease, the development or progress of obstruction and illness, the activity of biological approach or Bioactivity, such as the growth of solid malignant, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100%.Term " reduction " refers to inhibition, suppresses, and weakens, and reduces, and prevents or stablize Cancerous disease, The symptom of obstruction and illness.It will be appreciated that though be not excluded for, disease is treated, obstruction and illness is not required for completely eliminating and it Relevant disease, obstacle, illness or symptom.

Term " pharmaceutically acceptable " is suitable within a reasonable range of medical judgment for finger herein and people The tissue of class and animal contacts without overdosage toxicity, stimulation, allergy response or other problems or complication, with reasonable benefit Benefit/Hazard ratio those of matches compound, material, composition and/or dosage form.

Phrase " pharmaceutically acceptable carrier " as used herein refers to pharmaceutically acceptable material, composition or matchmaker Jie's object, such as liquid or solid filler, dilution, excipient or solvent encapsulating material, be related to by the compound of the present invention from The part of one organ or body carries or transports the part of another organ or body.Compatible with other ingredients of preparation And to patient it is harmless in the sense that, every kind of carrier must be " acceptable ".It can be used as the material of pharmaceutically acceptable carrier Some examples include: (1) sugar, such as lactose, dextrose and saccharose；(2) starch, such as cornstarch and potato starch；(3) Cellulose and its derivates, such as carboxymethyl cellulose, ethyl cellulose and cellulose acetate sodium；(4) powdered tragacanth；(5) wheat Bud；(6) gelatin；(7) talcum；(8) excipient, such as cocoa butter and suppository wax；(9) oily, such as peanut oil, cottonseed oil, safflower oil, sesame Sesame oil, olive oil, corn oil and soya-bean oil；(10) glycol, such as propylene glycol；(11) polyalcohol, such as glycerol, D-sorbite, mannitol And polyethylene glycol；(12) esters, such as ethyl oleate and ethyl laurate；(13) agar；(14) buffer, such as magnesium hydroxide and hydrogen Aluminium oxide；(15) alginic acid；(16) apirogen water；(17) isotonic saline solution；(18) Ringer's solution；(19) ethyl alcohol；(20) pH is buffered Solution；(21) polyester, polycarbonate and/or polyanhydride；(22) other non-toxic compatible substances used in pharmaceutical preparation.

" pharmaceutically acceptable salt " refers to the inorganic and organic acid addition salt of the relative nontoxic of compound.

Term " prevention (prevent) ", " prevention (preventing) ", " prevention (prevention) " is " preventative to control Treat " etc. refer to that reduction in no disease, obstruction and illness, but has generation disease, the risk of obstruction and illness or be prone to disease Disease, the probability of obstruction and illness occur in the subject of obstruction and illness for disease.

Term " subject " and " patient " are used interchangeably herein.By current public in their many embodiments The subject's desirably people experimenter for the method treatment opened, it is to be understood that method described herein is for all vertebrates Species are all effectively that invertebrate species are intended to be included in term " subject ".Therefore, " subject " may include being used for Goals of medicine, such as the preventative-therapeutic people for the treatment of existing conditions or diseases or for preventing conditions or diseases breaking-out Subject, or it is used for medicine, animal doctor's purpose or the animal subjects for developing purpose.Suitable animal subjects include that lactation is dynamic Object, including but not limited to primate, such as people, monkey, ape etc.；Bovid, such as ox (cattle), ox (oxen) etc.； Continuous caprid, such as sheep (sheep) etc.；Mountain caprid, such as goat (goat) etc.；Porcine animals, such as pig (pigs), pig (hogs) etc.；Equid, such as horse, donkey, zebra etc.；Felid, including wildcat and domestic cat；Canid, Including dog；Lagomorph, including rabbit, hare etc.；And rodent, including mouse, rat etc..It is dynamic that animal can be transgenosis Object.In some embodiments, subject is people, including but not limited to fetus, newborn, baby, and teenager and adult are tested Person.In addition, " subject " may include suffering from or suspecting the patient with conditions or diseases.

Term " subject in need " refers to the subject for being identified as needing therapy or treatment.

Term " systemic administration (systemic administration) ", " systemic administration (administered Systemically) ", " apply (peripheral administration) in periphery " and " apply (administered in periphery Peripherally) " refer to and compound, drug or other materials are administered to central nervous system in a manner of other than directly System makes it into the system of patient and therefore, carries out metabolism and other similar procedures, such as subcutaneous administration.

Term " therapeutic agent " or " medicament " are the reagents for referring to have required biological action to host.Chemotherapeutant It is with biology on the contrary, being commonly known that chemical or causing to control by specific mechanism of action respectively with genotoxicity agent The example of the therapeutic agent of therapeutic effect.The example of the therapeutic agent of biological source includes growth factor, hormone and cell factor.It is a variety of to control It is known in the art for treating agent, and can be identified by their effect.Certain therapeutic agents can adjust cell Proliferation and divide Change.Example includes chemotherapy nucleotide, drug, hormone, non-specific (such as non-antibody) albumen, oligonucleotides (such as tie Close the antisense oligonucleotides of target nucleic acid sequence (such as mRNA sequence)), peptide and peptide mimics.

Term " therapeutic effect " refers to the animal as caused by pharmacological active substance, especially mammal, and particularly It is the locally or systemically effect of the mankind.

As used herein term " therapeutically effective amount " and " effective quantity " refer to compound, material or include change of the invention The amount for closing the composition of object, in the reasonable benefit for being suitable for any therapeutic treatment at least one cell subsets in animal Some required therapeutic effects are effectively generated under benefit/Hazard ratio.

Term " tumour ", the growth shape that " solid malignant " or " neoplasm " refers to the exception by cell or do not adjusted At damage.Preferably, tumour is pernicious, such as the tumour formed by cancer.

Above-mentioned composition, kit and detection, diagnosis and method of prognosis can be used for helping to select suitable therapeutic scheme simultaneously Identification will benefit from the individual of more active treatment.

As described above, the method for the treatment of cancer include operation, immunotherapy, chemotherapy, radiation-therapy, chemotherapy and The combination or biotherapy of radiation-therapy.Have been used to treating cancer chemotherapeutant include but is not limited to Doxorubicin (Ah Mycin), cis-platinum, ifosfamide and corticosteroid (prednisone).In general, these reagents are applied in combination to improve it effectively Property.Combination for treating cancer includes cis-platinum, Doxorubicin, the combination of Etoposide and cyclophosphamide and cis-platinum, how soft Than star, the combination of cyclophosphamide and vincristine.

Thus, it is found that the above method is used in particular for selecting suitable treatment for earlier stage cancer patients.It is early diagnosed in disease Most of individuals with cancer are enjoyed long-term surviving after operation and/or radiation-therapy and are treated without further assisting out Method.However, a big chunk in these individuals will suffer from palindromia or death, lead to some or all earlier stage cancer patients It should receive the clinical of complementary therapy (such as chemotherapy) to recommend.Method of the invention can identify the individual with early-stage cancer This high risk, poor prognosis group, and so as to for determine which will benefit from continue and/or more positive therapy with And the close monitoring after treatment.For example, can choose with early-stage cancer and be evaluated as having not by method disclosed herein The individual of good prognosis is used for more positive complementary therapy, such as chemotherapy, after operation and/or radiation therapy.Specific In embodiment, method of the invention can be used in combination with standardization program and treatment to allow doctor to make wiser cancer Treatment determines.

Term " response to cancer therapy " or " result of cancer therapy " are related to hyperproliferative disorder (such as cancer) To cancer therapy, preferably start any response of the variation of rear tumor quality and/or volume to new auxiliary or adjuvant chemotherapy. Hyperproliferative disorder response can be assessed, such as effect or in new auxiliary or aided case, wherein can be by whole body After intervention the size of tumour with as by CT, PET, mammogram, the initial size and size of ultrasonic wave or palpation measurement into Row compares.After the biopsy or operation excision of solid carcinoma, sound can also be assessed by the pathologic finding of calliper to measure or tumour It answers.Can change in a quantitative manner such as gross tumor volume percentage or with qualitative fashion such as " pathology complete response " (pCR), it is " clinical Complete incidence graph " (cCR), " clinical part alleviation " (cPR), " clinical stability disease " (cSD), " clinical progress disease " (cPD) Or other qualitative criteria's recording responses.The assessment of hyperproliferative disorder response can be early after new auxiliary or complementary therapy start Phase carries out, such as in a few houres, several days, carries out after several weeks or preferably after some months.The classical endpoint of response assessment is new auxiliary When chemotherapy being helped to terminate or when operation removes remaining tumour cell and/or tumor bed.This is usually to open in neoadjuvant Three months after beginning.In some embodiments, the clinical efficacy of therapeutic treatment described herein can be terminated by measuring from therapy The clinical benefit rate (CBR) at certain time point of at least six moon determines.Clinical benefit rate passes through the trouble for determining complete incidence graph (CR) The summation of the quantity of the patient of (PR) and the quantity of the patient with stable disease (SD) is alleviated to survey in the percentage of person, part Amount.Writing a Chinese character in simplified form for the formula is CBR=CR+PR+SD (6 middle of the month).In some embodiments, certain cancer treatment side The CBR of case is at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% or more.

Other standards for assessing the response to cancer therapy are related with " survival " comprising following all: survival is straight To death, also referred to as always survival (wherein the death can be unrelated or related with tumour to the cause of disease)；" no recurrence survival " (wherein Term recurrence should include part and both recurrences at a distance)；It survives without transfer；(wherein term disease should include cancer for no disease survival Disease and associated disease).The length of the survival can be by reference to the starting point of restriction (for example, Diagnostic Time or controlling Treat the time started) and terminal (for example, dead, recurrence or shift) calculate.In addition, the standard of therapeutic efficiency can be extended to wrap Include the probability to chemotherapeutic response, survival probability, the interior probability shifted of given time period and tumor recurrence.For example, being It determines threshold value appropriate, specific modality of cancer treatment can be administered to subject group and result can appoint in application The number of copies of what predetermined one or more SNP or indels as described herein of cancer therapy, expression, activity level Deng association.Outcome measurement can be the pathology response to the therapy given in new auxiliary setting.Alternatively, for known measurements Subject after cancer therapy monitoring result can measure whithin a period of time, such as always survive and survive without disease.Certain In embodiment, the cancer therapeutic agent of same dose is applied to each subject.In relevant embodiment, applied dose It is the standard dose of cancer therapeutic agent known in the art.The period of monitoring subject can change.For example, can monitor by Examination person at least 2,4,6,8,10,12,14,16,18,20,25,30,35,40,45,50,55 or 60 months.As a result can also lead to Cross " Hazard ratio " (the ratio between death rate of a patient group and another；Probability of death at some time point is provided), it " always deposits It is living " (OS) and/or " progresson free survival " measure.In certain embodiments, prognosis includes 1 year, 2 years, 3 years, 4 years or any The probability of total survival rate of other suitable time points.It is measured by techniques known in the art bad with all aspects of the invention As a result the relevant conspicuousness of prognosis.For example, conspicuousness can be measured by calculating odds ratio.In another embodiment In, conspicuousness is measured by percentage.In one embodiment, when odds ratio be 0.8 or smaller or at least about 1.2, packet It includes but is not limited to: 0.1,0.2,0.3,0.4,0.5,0.6,0.7,0.8,1.2,1.3,1.4,1.5,1.6,1.7,1.8,1.9, When 2.0,2.5,3.0,4.0,5.0,10.0,15.0,20.0,25.0,30.0 and 40.0, the significant risk of bad result is measured. In another embodiment, relative to correlated results (such as accuracy, sensitivity, specificity are survived for 5 years, are survived within 10 years, It survives without transfer, stage forecast etc.), risk dramatically increases or is reduced at least about 20%, and including but not limited to about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and bigger, or any range therebetween.In another embodiment party In case, dramatically increasing for risk is at least about 50%.Therefore, the present invention further provides make what treatment determined to cancer patient Method, including prediction cancer patient is carried out with embodiment according to various aspects of the invention, and then face according to other known The method that bed and pathology risk factor weigh result, to determine the therapeutic process of cancer patient.For example, through the invention Method show by combinatorial chemistry therapy treatment have increased bad result risk cancer patient can use it is more positive Therapy treatment, including but not limited to radiation-therapy, autologous peripheral blood stemcell transplant, novel in bone-marrow transplantation or clinical research or Experimental therapies.In addition, it will be appreciated that side described herein can be passed through according to the sensitivity and/or specific criteria of enhancing Method predicts cancer therapy response.For example, sensitivity and/or specificity can be at least 0.80,0.81,0.2,0.83,0.84, 0.85,0.86,0.87,0.88,0.89,0.90,0.91,0.92,0.93,0.94,0.95,0.96,0.97,0.98,0.99 or It is higher, any range or sensitivity and the respective any combination of specificity therebetween.

Term " sensitization " refers to allow more effectively to treat phase with cancer therapy (for example, chemotherapy or radiation-therapy) The mode for closing cancer changes cancer cell or tumour cell.In some embodiments, the impregnable degree of normal cell causes Normal cell is by cancer therapy (for example, chemotherapy or radiation-therapy) excessive damage.It specific is controlled according to for described below It treats and the means known in the art of method measures the increase sensitivity to therapeutic treatment or reduce sensitivity, including but not limited to Cell proliferating determining (Tanigawa N, Kern D H, Kikasa Y, Morton D L, Cancer Res 1982；42: 2159-2164), cell death measurement (Weisenthal L M, Shoemaker R H, Marsden J A, Dill P L, Baker J A, Moran E M, Cancer Res 1984；94: 161-173；Weisenthal L M, Lippman M E, Cancer Treat Rep 1985；69: 615-632；Weisenthal L M, In: Kaspers G J L, Pieters R, Twentyman P R, Weisenthal L M, Veerman A J P, eds. Drug Resistance in Leukemia and Lymphoma. Langhorne, P A: Harwood Academic Publishers, 1993: 415-432；Weisenthal L M, Contrib Gynecol Obstet 1994；19: 82-90).Measurement can also be passed through The tumor size reduction in (such as artificial 6 months and for mouse be 4-6 week) measures the spirit in animal for a period of time Quick property or resistance.With there is no compared with the treatment sensitivity or resistance of this composition or method, increase if treating sensitivity Or resistance is reduced to 25% or more, such as 30%, and 40%, 50%, 60%, 70%, 80% or higher, composition or method make to treatment Property treatment 2 times of response sensitization, 3 times, 4 times, 5 times, 10 times, 15 times, 20 times or more.Sensitivity or anti-to therapeutic treatment The determination of property in this field is conventional and within the scope of the technical ability of the clinician of ordinary skill.It should be appreciated that being described herein Any method for enhancing cancer therapy effect can be equally applicable to make hyper-proliferative or other cancer cells (for example, Resisting cell) method sensitive to cancer therapy.

Term " survival " includes following all: survival is until dead, and (wherein the death can be with the cause of disease for also referred to as total survival It is unrelated or related to tumour)；" no recurrence survival " (wherein term recurrence should include part and recur at a distance)；It survives without transfer； No disease survival (wherein term disease should include cancer and relative disease).The length of the survival can be by reference to The starting point (such as Diagnostic Time or treatment time started) and terminal (such as dead, recurrence or shift) of restriction calculates.This Outside, the standard of therapeutic efficiency can be extended to include to chemotherapeutic response, survival probability, and that shifts in given time period is general The probability of rate and tumor recurrence.

The present invention further provides preventions, postpone, the novel therapeutic side of reduction and/or treating cancer (including cancerous tumour) Method.In one embodiment, treatment method include be administered alone to subject (for example, subject in need) it is a effective amount of Geminivirus packaging system (i.e. rAAV (for example, rAAV-Onco-CRISPR or rAAV-TSG) and Ad-rAAVpack) or rAAV- Onco-CRISPR or rAAV-TSG.Subject in need may include, and (including swell before cancer for example, being diagnosed with tumour Tumor, cancer) subject, or the subject treated, including the subject difficult to treat to prior treatment.

Method of the invention can be used for treating any carcinous or cancer pre-neoplastic.In certain embodiments, cancerous tumour can Positioned at be selected from brain, colon, apparatus urogenitalis, lung, kidney, prostate, pancreas, liver, esophagus, stomach, hematopoiesis (hematopoietic), Mammary gland, thymus gland, testis, ovary, skin, marrow and/or uterine tissue.In some embodiments, method and group of the invention Closing object can be used for treating any cancer.The cancer that can be treated by means of the present invention with composition includes but is not limited to come from wing Guang, blood, bone, marrow, brain, mammary gland, colon, esophagus, stomach and intestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, forefront The cancer cell in gland, skin, stomach, testis, tongue or uterus.In addition, cancer can specifically have following histological type, but unlimited In these: malignant growth；Cancer；Undifferentiated carcinoma；Huge and carcinoma sarcomatodes；Small cell carcinoma；Papillary carcinoma；Squamous cell carcinoma； Lymphepithelioma；Basal-cell carcinoma；Pilomatrix carcinoma；Transitional cell carcinoma；Papillary transitional cell carcinoma；Gland cancer；Pernicious gastrinoma； Cholangiocarcinoma；Hepatocellular carcinoma；Merge hepatocellular carcinoma and cholangiocarcinoma；Girder gland cancer；Adenoid cystic carcinoma；Gland cancer in adenomatous polyp； Familial colon polyp gland cancer；Solid carcinoma；Carcinoid malignant；Bronchoalveolar adenocarcinomas；Papillary adenocarcinoma；Chromophobe cell tumor；Acidophilus Property cell cancer；Oncocytic adenoma；Basicyte cancer；Clear cell adenocarcinoma；Granular cell carcinoma；Follicular adenocarcinoma；Mamillary and Follicular adenocarcinoma；Non-packet film property hardens cancer；Adrenocortical carcinoma；Endometrioid carcinoma；The attached cancer of skin；Apocrine carcinoma；Sebum Gland cancer；Earwax gland cancer；Mucoepidermoid carcinoma；Cystadenocarcinoma；Papillary cystic adenocarcinoma；Papillary serous cystadenocarcinoma；Mucus capsule gland Cancer；Myxoadenocarcinoma；Signet ring cell cancer；Invasive ductal carcinoma；Cephaloma；Lobular carcinoma；Inflammatory carcinoma；Mammary gland Paget disease；Acinus is thin Born of the same parents' cancer；Adenosquamous carcinoma；Adenocarcinoma with squamous metaplasia；Malignant thymoma；Malignant ovary mesenchymoma；Pernicious thecoma；Pernicious particle Cytoma；With pernicious blastoma (roblastoma)；Sertoli cell cancer；Pernicious Leydig cell tumor；Pernicious lipid cell Tumor；Pernicious Chromaffionoma；The outer Chromaffionoma of malignant galactophore；Pheochromocytoma；Glomangiosarcoma；Chromoma；Without black Pigmented melanoma；Superficial spreading melanoma；Melanoma in giant pigmented nevus；Epithelioid cell melanoma；Pernicious blue Mole；Sarcoma；Fibrosarcoma；Malignant fibrous histiocytoma；Myxosarcoma；Embryonal-cell lipoma；Leiomyosarcoma；Rhabdomyosarcoma； Embryonal rhabdomyosarcoma；Alveolar rhabdomyosarcoma；Stromal sarcoma；Malignant mixed tumour；Miao Le mixed tumour；The nephroblastoma；Liver Blastoma；Sarcoma；Malignant stromal tumors；Malignant Brenner tumor；Pernicious phyllodes tumor；Synovial sarcoma；Malignant mesothelioma；It is asexual thin Born of the same parents' tumor；Embryonal carcinoma；Malignant teratoma；Malignant ovary thyroid adenoma；Choriocarcinoma；Pernicious carcinoma mesonephric；Angiosarcoma；Malignant angiogenic Endothelioma；Kaposi sarcoma；Malignant angiogenic pericytoma；Lymphangioendothelial sarcoma；Osteosarcoma；Cortex osteosarcoma；Chondrosarcoma；It dislikes Property chondrosarcoma；Mesenchyma chondrosarcoma；Giant cell tumor of bone；Ewing's sarcoma；Pernicious odontogenic tumor；Ameloblast tooth meat Tumor；Malignant ameloblastoma；Ameloblastic fibrosarcoma；Pernicious pinealoma；Chordoma；Glioblastoma；Ependymoma；Star Shape cytoma；Protoplasmic astrocyte tumor；Fibrillary astrocyte tumor；Astroblastoma；Glioblastoma；Oligodendroglia Cell；Oligodendroblastoma；Primitive neuroectodermal；Cerebellar sarcoma；Gangliocytoma；Neuroblastoma； Retinoblastoma；Olfactory neurogenic tumor；Malignant meningioma；Neurofibrosarcoma；Malignant schwannoma；Pernicious particle is thin Born of the same parents' tumor；Malignant lymphoma；Hodgkin's disease；Hodgkin lymphoma；Paragranuloma；Small lymphocyte malignant lymphoma；Maxicell Diffusivity malignant lymphoma；Follicularis malignant lymphoma；Mycosis fungoides；Other specified non-Hodgkin lymphoma；Pernicious group Knit cytopathy；Huppert's disease；Mast cell sarcoma；Immunoproliferation disease of intestine；Leukaemia；Leukemic lymphoblastoid；Slurry is thin Born of the same parents' leukaemia；Erythroleukemia；Lymphosarcoma cell leukemia；Myeloid leukemia；Basophilic leukemia；The white blood of eosinophils Disease；Monocytic leukemia；Mast cell leukemia；Megakaryoblastic leukemia；Myelosarcoma；And hairy cell leukemia.

Composition as described herein can be delivered by any suitable administration method, including oral, and intranasal is transmucosal, eye, Rectum, intravaginal, parenteral, including intramuscular, subcutaneously, intramedullary injection and intrathecal, direct ventricle be interior, intravenously, joint Interior, in breastbone, intrasynovial, in liver, intralesional, encephalic, in peritonaeum, intranasal or intraocular injection, in brain pond, part such as passes through powder End, ointment or drops (including eyedrops), including oral cavity and sublingual, it is transdermal, it is spraying or known in the art other by sucking Modes of delivery.

Term " systemic administration (systemic administration) " as used herein, " systemic administration (administered systemically) ", " applying (peripheral administration) in periphery " and " periphery application (administered peripherally) " refers to that individually (i.e. rAAV is (for example, rAAV-Onco- comprising Geminivirus packaging system CRISPR or rAAV-TSG) and Ad-rAAVpack)) or rAAV-Onco-CRISPR or rAAV-TSG composition application, make The system that it enters patient is obtained, and therefore carries out metabolism and other similar procedures.

Term " parenteral administration (parenteral administration) " as used herein and " parenteral administration (administered parenterally) " refers to the method for application in addition to enteral and local application, usually by injection, and Including but not limited to intravenous, intramuscular, intra-arterial is intrathecal, intracapsular, intraocularly, intracardiac in socket of the eye, intradermal, in peritonaeum, transtracheal, Subcutaneously, intra-articular under epidermis, under coating, under arachnoid, intraspinal tube and breastbone inner injection, intra-tumoral injection and infusion.

In certain embodiments, usually (for example, via oral or extra-parenteral administration) delivers pharmaceutical composition.Certain In other embodiments, pharmaceutical composition by be injected directly into tumour or be injected directly into tumour blood supply (for example, Artery or venous blood supply) in local delivery.In some embodiments, pharmaceutical composition passes through general and local application two Person's delivering.For example, can be by the way that the composition for containing composition as described herein to be injected directly into the blood of tumour or tumour The subject for suffering from tumour is treated in combination in supply with oral administration pharmaceutical composition of the invention.If using part and generally Both applications, then can be before general application, while and/or carrying out local application later.

In certain embodiments, treatment method of the invention, including carcinous or cancer pre-neoplastic is treated, including by this paper institute The composition and the second reagent and/or therapy stated are administered in combination to subject." with ... combine " refer to individual Geminivirus Packaging system (i.e. rAAV (for example, rAAV-Onco-CRISPR or rAAV-TSG) and Ad-rAAVpack)) or rAAV-Onco- Simultaneously, sequence or combinations thereof is administered for CRISPR or rAAV-TSG and one or more therapeutic agents.Therefore, it applies and individually includes Geminivirus packaging system (i.e. rAAV (for example, rAAV-Onco-CRISPR or rAAV-TSG) and Ad-rAAVpack)) or rAAV- The composition of Onco-CRISPR or rAAV-TSG and/or the combined subject of therapeutic agent can be at same time (that is, simultaneously) Or receiving in different time (i.e. on the same day or not on the same day, with any order, sequentially) includes Geminivirus as described herein The composition of packaging system and one or more therapeutic agents, as long as realizing the effect of two kinds of reagents combination in subject.When suitable It, can be in mutual 1,5,10,30,60,120,180,240min or longer interior application reagent when sequence is applied.In other embodiment party In case, the reagent of sequence application can the application in mutual 1,5,10,15,20 day or more.

When being administered in combination, the effective concentration for every kind of reagent for causing particular organisms to respond can be less than every when being administered alone The effective concentration of kind reagent, if to allow to apply as single agents by the dosage of needs, one kind or more relative to reagent The dosage of kind reagent reduces.The effect of plurality of reagents can with but need not be adduction or collaboration.It can be with multiple applications reagent.This In combination treatment, the therapeutic effect of the first application reagent will not simultaneously or separately be applied and be reduced because of the sequence of subsequent reagent.

In certain embodiments, this method includes the pharmaceutical composition and one kind that will include composition as described herein Or a variety of chemotherapeutants and/or scavenger compounds (including chemotherapeutant as described herein) and it is known in the art its Its reagent is administered in combination.Conjoint therapy include with when applying subsequent compound, application comprising Geminivirus packaging system (i.e. RAAV (for example, rAAV-Onco-CRISPR or rAAV-TSG) and Ad-rAAVpack)) composition therapeutic effect it is not complete It totally disappeared the mode sequence of mistake, while and separated or co-administration composition.In one embodiment, the second reagent is Chemo-Therapy Treat agent.In another embodiment, the second reagent is scavenger compounds.In another embodiment, the second reagent is Radiation-therapy.In another embodiment, radiation-therapy can also be applied in addition to composition.In certain embodiments, Two reagents can in individual pharmaceutical composition co-formulation.

In some embodiments, subject of the present invention pharmaceutical composition will be to be enough to deliver therapeutically effective amount to patient The therapeutic agent of incorporation or the amount of other materials as preventative or therapeutic treatment a part mix one kind to be delivered or Many kinds of substance.The required concentration of reactive compound will depend on the absorption of drug, inactivation and discharge rate and chemical combination in particle The delivery rate of object.It should be noted that dose value can also change with the seriousness of illness to be alleviated.It is to be further understood that right In any particular subject, should be adjusted at any time according to the professional judgement of the people of individual need and application or supervision composition application Particular dosage regimen.In general, dosage will use technology well known by persons skilled in the art to determine.

Dosage can based on individually comprising Geminivirus packaging system (i.e. rAAV (for example, rAAV-Onco-CRISPR or RAAV-TSG) and Ad-rAAVpack)) or the amount of the composition of rAAV-Onco-CRISPR or rAAV-TSG, every kg weight are suffered from Person.For example, it is contemplated that a series of composition of amounts or it is encapsulated in compound therein, including about 0.001,0.01,0.1,0.5,1, The every kg patient's weight of 10,15,20,25,50,75,100,150,200 or, 250 mg or more this composition.Other amounts are Well known by persons skilled in the art and easy determination.

In certain embodiments, individually comprising Geminivirus packaging system, (i.e. rAAV is (for example, rAAV-Onco-CRISPR Or rAAV-TSG) and Ad-rAAVpack)) or rAAV-Onco-CRISPR or rAAV-TSG composition dosage will be usually About 0.001mg is to about 250mg/kg weight range, particularly from about 50mg to about 200mg/kg range, and more specifically about 100mg To about 200mg/kg range.In one embodiment, dosage is about 150mg to about 250mg/kg range.In another implementation In scheme, dosage is about 200mg/kg.

In some embodiments, individually comprising Geminivirus packaging system, (i.e. rAAV is (for example, rAAV-Onco-CRISPR Or rAAV-TSG) and Ad-rAAVpack)) or rAAV-Onco-CRISPR or rAAV-TSG composition in pharmaceutical composition Molar concentration will less than or equal to about 2.5 M, 2.4 M, 2.3 M, 2.2 M, 2.1 M, 2 M, 1.9 M, 1.8 M, 1.7 M, 1.6 M, 1.5 M, 1.4 M, 1.3 M, 1.2 M, 1.1 M, 1 M, 0.9 M, 0.8 M, 0.7 M, 0.6 M, 0.5 M, 0.4 M, 0.3 M or 0.2 M.In some embodiments, individually comprising Geminivirus packaging system (that is, rAAV is (for example, rAAV-Onco- CRISPR or rAAV-TSG) and Ad-rAAVpack)) or rAAV-Onco-CRISPR or rAAV-TSG composition concentration will Less than or equal to about 0.10 mg/ml, 0.09 mg/ml, 0.08 mg/ml, 0.07 mg/ml, 0.06 mg/ml, 0.05 mg/ Ml, 0.04 mg/ml, 0.03 mg/ml or 0.02 mg/ml.

The actual dose that can change active constituent in composition of the invention is horizontal, so as to the not no malicious feelings of patient The amount for effectively obtaining the active constituent of required treatment response of particular patient, composition and method of application is obtained under condition.

Selected dosage level will depend on many factors, including preparation used in particular therapeutic agent or its ester, salt or The rate of the activity of amide, administration method, administration time, excretion or metabolism.The excretion or metabolism speed of the particular therapeutic agent used Rate, the duration for the treatment of, the other medicines being applied in combination with specific compound used, compound and/or material, treat trouble Well-known factor in the age of person, gender, weight, illness, general health and medical history and medical domain.

Doctor or animal doctor with this field common skill can readily determine that and output having for required pharmaceutical composition Effect amount.For example, doctor or animal doctor can be to output and/or apply drug lower than for level needed for realizing desired therapeutic effect The dosage of the compound of the present invention used in composition, and dosage is gradually increased until reaching desired effect.

In general, the suitable unit dose of the compound of the present invention is the amount of compound, it is effectively to generate therapeutic effect most Low dosage.This effective dose will generally depend on above-mentioned factor.

If desired, the daily dose of reactive compound can be used as in one day with application spaced apart appropriate Two, three, four, five, six or more sub-doses are optionally applied with unit dosage forms.

The exact time of application and the amount for generating any specific compound of most effective treatment will be taken in given patient Certainly in the activity of specific compound, pharmacokinetics and bioavilability, the physiological status of patient (including the age, gender, disease Type and stage, general physical condition, to the responsiveness of given dose and drug type), administration method etc..Finger provided herein South can be used for optimizing treatment, for example, determining Best Times and/or amount of application, this would only need to routine experiment, including monitor tested Person and adjustment dosage and/or time.

When treating subject, one or more correlations can be measured by the predetermined time during 24 hour time and are referred to It counts to monitor the health of patient.All aspects for the treatment of, supplement, amount, number including applying and preparing can be according to this prisons The result optimizing of survey.Patient can periodically be reappraised to determine improvement degree by measurement identical parameters, for the first time in this way Reappraise usually occur at the end of surrounding after therapy starts, and it is subsequent reappraise during therapy it is every four to eight week And then every three months carries out.The possible periods of months of therapy or even several years, when the minimum of one moon is the typical case of the therapy of the mankind It is long.For example, can be reappraised based on these to adjust the amount of applied reagent and administration time.

It can start to treat with the smaller dose for the optimal dose for being less than compound.Hereafter, dosage can pass through little increment Increase, until reaching optimum therapeuticing effect.

As described above, individually comprising Geminivirus packaging system, (i.e. rAAV is (for example, rAAV-Onco-CRISPR or rAAV- TSG) and Ad-rAAVpack)) or the composition of rAAV-Onco-CRISPR or rAAV-TSG can be combined with radiation-therapy and be applied With.It can be used as daily dosage and give subject's radiation-therapy for optimizing dosage.The daily dosage of the optimization of radiation-therapy can be with It is, for example, about 0.25 to 0.5Gy, about 0.5 to 1.0Gy, about 1.0 to 1.5Gy, about 1.5 to 2.0Gy, about 2.0 to 2.5Gy, and About 2.5 to 3.0Gy.Exemplary daily dosage can be for example, about 2.0 to 3.0Gy.For example, if tumour is to the spoke of relatively low-dose It penetrates resistant, then can apply the radiation of higher doses.The radiation of high dose can achieve such as 4Gy.In addition, treating The total radiation dosage applied in journey can be for example, about 50 to 200Gy range.In an exemplary embodiment, it was treating The total radiation dosage applied in journey is for example, about 50 to 80Gy range.In certain embodiments, can such as 1,2,3,4 or Dose of radiation is given in the time interval of 5min, wherein time quantum depends on the dosage rate of radiation source.

In certain embodiments, the optimization radiation that daily dosage can be applied, for example, 4 or 5 days weekly, for about 4 to 8 weeks.In alternative embodiment, the optimization of daily dosage radiates daily administration 7 days (one week), for about 4 to 8 weeks.Certain In embodiment, the radiation of daily dosage can give single dose.Alternatively, the radiation of daily dosage can be used as multiple dosage to Out.In another embodiment, the dose of radiation of optimization can be the radiation of tolerable higher doses more daily than patient.Cause This, can be to the radiation of patient's administered with high dose, but in the dosing scheme of lower frequency.

The emission types that can be used for treatment of cancer are well known in the present art and including electron beams, come from linear accelerator Or come from radiation source such as cobalt or caesium, the high-energy photon of proton and neutron.Exemplary ionising radiation is radiation, x-ray.

The method of application radiation is well known in the art.Illustrative methods include but is not limited to external beam radiation, inner-bundle Radiation and radiativity drug.In external beam radiation, high energy x-ray for being delivered to the body being affected by cancer by linear accelerator Body region.Since radiation source is outside body, external beam radiation can be used for treating the big region of body with homogeneous radiation dosage. Internal radiation therapy, also referred to as short distance radiation-therapy, are related to the privileged site by the radiation delivery of high dose into body.Two The major type of internal radiation therapy of kind includes gap radiation, and wherein radiation source is placed in impacted tissue and intracavitary Radiation, wherein radiation source is placed on away from the impacted short-range intracoelomic cavity in region.Radioactive material can also be by being attached to Tumor specific antibody and be delivered to tumour cell.Radioactive material used in internal radiation therapy is generally comprised within small glue Capsule, pill, line, pipe or implantation material in.On the contrary, radiativity drug is can to take orally, give intravenously or directly in body cavity not The radiation source of sealing.

Radiation-therapy can also include stereotactic surgery or stereotaxis radiation-therapy, wherein linear acceleration can be used Device or gamma knife and three-dimensional conformal radiation-therapy (3DCRT) are by the radiation delivery of precise volume to little tumour region, three-dimensional conformal spoke Penetrating therapy is area of computer aided therapy to draw the position of tumour before radiation therapy.

The toxicity and therapeutic efficiency of motif compound can by cell culture or experimental animal for example for measuring LD₅₀And ED₅₀Standard pharmaceutical procedures measurement.It is preferred for showing the composition of big therapeutic index.In some embodiments In, LD₅₀(lethal dose) can measure and for (i.e. rAAV is (for example, rAAV- comprising Geminivirus packaging system described herein Onco-CRISPR or rAAV-TSG) and Ad-rAAVpack)) composition, relative to individual rAAV-Onco-CRISPR or RAAV-TSG can be for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more is reduced.Similarly, ED can be measured₅₀(that is, realizing symptom Half maximum suppression concentration) and for comprising Geminivirus packaging system described herein, (i.e. rAAV is (for example, rAAV- Onco-CRISPR or rAAV-TSG) and Ad-rAAVpack)) composition, relative to individual rAAV-Onco-CRISPR or RAAV-TSG can be for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more increases.Moreover, similarly, IC can be measured₅₀(that is, realizing To the half-maximal cell toxicity of cancer cell or the concentration of cyto-inhibition) and for being packed comprising Geminivirus described herein The composition of system (i.e. rAAV (for example, rAAV-Onco-CRISPR or rAAV-TSG) and Ad-rAAVpack)), relative to list Only rAAV-Onco-CRISPR or rAAV-TSG can be for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more increases.Although can be used The compound of toxic side effect is shown, it should be noted that designing by the delivery system at position needed for targeting compounds, to reduce pair Effect.

In some embodiments, presently disclosed method generates at least about 10%, 15%, 20%, 25%, 30% in the assay, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or even 100% growth of cancer cells Inhibit.

In any above method, comprising Geminivirus packaging system, (i.e. rAAV is (for example, rAAV-Onco-CRISPR for application Or rAAV-TSG) and Ad-rAAVpack)) composition can lead to application comprising Geminivirus packaging system (i.e. rAAV (for example, RAAV-Onco-CRISPR or rAAV-TSG) compared with the solid malignant before the composition of Ad-rAAVpack)), by At least about 10% in solid malignant in examination person, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or even 100% reduction.

In some embodiments, preventative application therapeutically effective amount includes Geminivirus packaging system (i.e. rAAV (example Such as, rAAV-Onco-CRISPR or rAAV-TSG) and Ad-rAAVpack)) composition to prevent from forming entity in subject Malignant tumour.

In some embodiments, subject is people.In other embodiments, subject is inhuman, such as lactation Animal.

The data obtained from cell culture measurement and zooscopy can be used for being formulated for a series of dosage of the mankind.It is any Replenishers or the alternatively dosage of any of them component are preferably in the very little or none toxicity of toxicity including ED₅₀Circulation composition In range.Dosage can change within the scope of this for depending on dosage form and administration method used used.For examination of the invention Agent can initially measure estimation treatment effective dose from cell culture.Dosage can be prepared in animal model to reach circulation Blood plasma concentration range comprising the IC measured in cell culture₅₀.These information can be used for more accurately determining useful in people Dosage.For example, the level in blood plasma can be measured by high performance liquid chromatography.

IV. general definition

Although specific terms be employed herein, but they are only used with generic and descriptive sense, rather than for the mesh of limitation 's.Unless otherwise defined, otherwise all technical and scientific terms used herein has and presently described theme fields The identical meaning of the normally understood meaning of those of ordinary skill.

According to long-standing Patent Law convention, term " one ", "one" and "the" are in the application (including claim) " one or more " is referred to when middle use.Thus, for example, referring to including multiple subjects to " subject ", unless up and down Civilization aobvious opposite (for example, multiple subjects), etc..

In entire disclosure and claims, term " include (comprise) ", " including (comprises) " and " including (comprising) " is used with the meaning of nonexcludability, unless the context otherwise requires.Similarly, term " includes " and Its grammatical variants is intended to be non-limiting, so that the narration of the project in list is not excluded for replace or being added to institute's list The other similar items of purpose.

For the purpose of this specification and appended claims, unless otherwise stated, indicating that specification and right are wanted Quantity used in asking, size, size, ratio, shape, preparation, parameter, percentage, parameter, quantity, feature and other numerical value All numbers, it is thus understood that all modified in all cases with term " about ", though term " about " may not clearly with Value, quantity or range occur.Therefore, unless the contrary indication, otherwise illustrate in the following description and appended dependent claims Numerical parameter not instead of and need not be accurate, can according to need approximate and/or greater or lesser, reflect tolerance, turn The factor is changed, is rounded up, measurement error etc. and other factors well known by persons skilled in the art, depending on attempting by working as The required property that preceding disclosed theme obtains.For example, term " about " may mean that including the change from specified amount when referring to value Change, in some embodiments ± 100%, in some embodiments ± 50%, in some embodiments ± 20%, some ± 10% in embodiment, in some embodiments ± 5%, in some embodiments ± 1%, in some embodiments ± 0.5%, and in some embodiments ± 0.1%, because such variation is adapted for carrying out disclosed method or public using institute The composition opened.

In addition, term " about " is interpreted as referring to all when being used in combination with one or more numbers or numberical range Such number including all numbers in range and modifies the model by the boundary above and below the numerical value of extension elaboration It encloses.Include all numbers, such as integer by the numberical range that endpoint is stated, including comprising in the range its score (for example, 1 to 5 narration include 1,2,3,4 and 5 and its score, for example, 1.5,2.25,3.75,4.1 etc.) and this within the scope of Any range.

Illustration

The representative embodiment for implementing presently disclosed theme including following embodiment for those of ordinary skill in the art provides Guidance.In view of the general technology of the disclosure and this field level, it will be understood by those skilled in the art that following embodiment is only intended to Be exemplary, and can using it is many variation, modifications and changes without departing from presently disclosed theme range.It synthesizes below Description and specific embodiment are only intended for the purpose of explanation, and should not be construed in any way as limiting through other method systems The compound of the standby disclosure.

Embodiment 1

For replicating the Geminivirus packaging system of therapeutic adeno-associated virus in vivo

Background: recombinant adeno-associated virus (rAAV) is the preferred vector of gene therapy in tissue specificity body.These fine and close viruses It is non-pathogenic and can efficiently both infection development and inactive cell mass.Wild type AAV belongs toDependoparvovirusBelong to, and is initially found in the cell of adenovirus (Ad) infection.These simple viruses only include two A gene, rep and cap (Fig. 1).Remaining gene needed for AAV infectious cycle is by the trans- offer of Ad.In the design of therapeutic rAAV In, wild-type virus gene is replaced by transgenosis.Therefore, rAAV must be packed in vitro.In standard rAAV packaging system, lead to It crosses package cell line 293 and several required trans factors is provided, the cell line is initially by converting human embryo kidney with adenovirus DNA Cell generates.Remaining trans factors (including AAV rep and cap gene) delivers on plasmid, and the plasmid and virus turn base Because of construct together cotransfection.The unique viral genetic elements being retained in " gutless " rAAV are that two opposing ends repeat (ITR).It therefore, is replication defective by the infectious viral particle that in vitro package generates.

Transgenosis can effectively be delivered to tissue by rAAV, but this is " disposable " process；Near injection site New virus is not generated.For much applying, single administration rAAV, which can be modified, is enough to realize that the target of significant clinical response is thin Born of the same parents' ratio.For other application, can may be not enough to realize desired sound by the cell proportion that single rAAV handles modification It answers.The limitation and rAAV are especially relevant to the therapeutical uses of anti-tumor disease, and tissue is unordered in tumor disease and target is thin The quantity of born of the same parents tends to increase.

Provided herein is a kind of virus systems, wherein therapeutic rAAV iteration can be replicated in vivo.The core of the system is The new derivative of adenovirus 5, referred to as Ad-rAAVpack, wherein rep the and cap gene from wild type AAV replaces Ad E3 base Because of (Fig. 2).Ad E3 typically serves to the effect for responding viral escape host immune, but is not that cracking infection and AAV packaging must It needs.Because of rep-cap box only ~ lkb bigger than E3 gene, the total size of Ad-rAAVpack is completely in the Ad bale capacity of announcement It is interior.

All trans elements needed for Ad-rAAVpack has duplication and packaging companion rAAV.Therefore, Ad- is used RAAVpack and therapeutic rAAV co-infection target tissue will allow rAAV to be proliferated in vivo, potentially improve transgene delivery Efficiency.Finally, the degree of double infection may be responded by host immune and be limited.

Embodiment 2

Method

Plasmid construction: in order to generate the two-way construct of H1, by the Cas9 gene of people's codon optimization and SV40 terminator and 230bp H1 promoter fusion, wherein endogenously finding pol II transcript (minus strand).Between H1 promoter and gRNA bracket, The site AvrII is engineered to allow to be inserted into target sequence.Then by SV40 [rev]:: hcas9 [rev]:: H1::gRNA bracket:: Pol III terminator sequence is cloned into the pUC19 carrier of NdeI/XbaI digestion.It is various used in this research in order to generate GRNA, overlapping oligomer expand Phusion Flash archaeal dna polymerase (Thermo Fisher by using two steps Scientific, Rockford, IL) PCR annealing and amplification, and then using and 2 times of volumes 25%PEG and 1.5M NaCl Sera-Mag magnetic bead (the Thermo Fisher Scientific) purifying of mixed carboxylate modification.Then by the PCR of purifying Product is resuspended in H₂In O, and it is quantitative using NanoDrop 1000 (Thermo Fisher Scientific).GRNA expression Construct uses Gibson Assembly (New England Biolabs, Ipswich, the MA) (Gibson slightly modified Et al. (2009)Nature Methods 6:343-345) generate.Total reaction volume is reduced to 2 μ l from 20 μ l.

Human embryo kidney (HEK) (HEK) cell line 293T (Life Technologies, Grand Island, NY) is with 10% tire ox Serum (Gibco, Life Technologies, Grand Island, NY) and 2mM GlutaMAX (Invitrogen) are mended With 5% CO in Dulbecco improvement Eagle culture medium (DMEM) (Invitrogen) filled₂/20% O₂It is maintained at 37 DEG C.

For genomic modification Surveyor measurement and sequencing analysis: for Surveyor analyze, by Cell extraction genomic DNA is resuspended in QuickExtract solution (Epicentre, Madison, WI), is incubated at 65 DEG C 15min, and 10 min are then incubated at 98 DEG C.Using DNA Clean and Concentrator (Zymo Research, Irvine, CA) solution is extracted in cleaning, and it is quantitative to pass through NanoDrop (Thermo Fisher Scientific).It uses Phusion archaeal dna polymerase (New England Biolabs) is around 100ng genomic DNA amplification CRISPR target site Genome area.Merge multiple independent PCR to react and follow manufacturer's scheme using Qiagen MinElute Spin column (Qiagen, Valencia, CA) purifying.In 12.5mM Tris-HCl (pH 8.8), 62.5mM KCl and 1.875mM MgCl₂In the 8 μ l containing 400 ng PCR products it is volume of denatured and slow re-annealing is to allow to be formed heteroduplex: 95 DEG C are held Continuous 10min, 95 DEG C to 85 °C are cooled down with -1.0 °C/seconds, and 85 °C are for 1 seconds, and 85 °C to 75 °C are cooled down with -1.0 °C/seconds, and 75 °C For 1 seconds, 75 °C to 65 °C are cooled down with -1.0 °C/seconds, and 65 °C are for 1 seconds, and 65 °C to 55 °C are cooled down with -1.0 °C/seconds, and 55 °C For 1 seconds, 55 °C to 45 °C are cooled down with -1.0 °C/seconds, and 45 °C are for 1 seconds, and 45 °C to 35 °C are cooled down with -1.0 °C/seconds, and 35 °C For 1 seconds, 35 °C to 25 °C are cooled down with -1.0 °C/seconds, and are then maintained at 4 °C.By 1 μ l Surveyor Enhancer and 1 μ L Surveyor nuclease (Transgenomic, Omaha, NE) is added in each reaction, incubates 60min at 42 DEG C, Later, 1 μ l stop bath is added in reaction.Using 1000 chip of DNA (Agilent, Santa Clara, CA) 2100 Quantitative 1 μ l reaction on biological analyser.For gel analysis, by the 6X sample-loading buffer (New England Biolabs) of 2 μ l It is added in remaining reaction and loads on 3% Ago-Gel containing ethidium bromide.Gel Gel Logic 200 at As being visualized on system (Kodak, Rochester, NY), and it is quantitative using ImageJ v. 1.46.NHEJ frequency usage binomial Equation derived from formula calculates:

% gene modification=；

Wherein the value of " a " and " b " are not cut after being equal to background deduction equal to the integral area for cutting segment after background deduction, and " c " Integral area (Guschin et al. the (2010) for the PCR product cutMethods in Molecular Biology 649: 247-256)。

Inside develops a kind of software (http://crispr.technology) and is annealed with designing with recurrent Cancer-causing mutation Unique gRNA.The destruction that these gRNA can instruct the CRISPR/Cas9 of these mutation alleles to mediate.These gRNA with The intra-tumor delivery of Cas9 albumen can inhibit the growth of the tumour with these mutation.The particular cancer base targeted in this way Because being:

Generally speaking, it is sent out in most of cancers of these specific mutations in KRAS and PIK3CA in lung and entire GI It is existing.IDH1 R132 mutation is found in about 30% glioma.These brain tumors are all special to all routine treatment forms It is not difficult to cure.Each of these gRNA are predominantly targeting mutation allele.

People H1:: target: gRNA bracket

Target: WT KRAS

GGAATTCGAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACCC AGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTA TGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTT TTTCCCGTAGTTGGAGCTGGTGGCGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC TTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:11)

People H1:: target: gRNA bracket

Target: KRAS G12C

GGAATTCGAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACCC AGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTA TGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTT TTTCCCGTAGTTGGAGCTTGTGGCGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC TTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:12)

People H1:: target: gRNA bracket

Target: KRAS G12D

GGAATTCGAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACCC AGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTA TGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTT TTTCCCGTAGTTGGAGCTGATGGCGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC TTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:13)

People H1:: target: gRNA bracket

Target: KRAS G13D

GGAATTCGAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACCC AGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTA TGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTT TTTCCCGTAGTTGGAGCTGGTGACGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC TTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:14)

People H1:: target: gRNA bracket

Target: WT PIK3CA

GGAATTCGAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACCC AGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTA TGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTT TTTCCCTCTCTCTGAAATCACTGAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC TTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:15)

People H1:: target: gRNA bracket

Target: PIK3CA E545K

GGAATTCGAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACCC AGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTA TGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTT TTTCCCTCTCTCTGAAATCACTAAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC TTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:16)

People H1:: target: gRNA bracket

Target: PIK3CA E549N

GGAATTCGAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACCC AGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTA TGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTT TTTCCCAAGATTTTCTATGGAGTCACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC TTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:17)

People H1:: target: gRNA bracket

Target: PIK3CA H1047R

GGAATTCGAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACCC AGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTA TGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTT TTTCCCCAAATGAATGATGCACGTCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC TTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:18)

Bibliography

All publications referred in this specification, patent application, patent and other bibliography indicate presently disclosed master Inscribe the level of those skilled in the art.All publications, patent application, patent and other bibliography pass through reference simultaneously Enter herein, degree specifically and is individually referred to such as each individual publication, patent application, patent and other bibliography It is incorporated by reference into out.It will be appreciated that though many patent applications have been mentioned above, patent and other bibliography, but these Bibliography does not constitute an admission that any of these documents constitute a part of general knowledge known in this field.

Although in order to which clearly understood purpose has passed through explanation and aforementioned theme is described in detail in embodiment, this Field the skilled person will understand that, certain changes and modification can be implemented within the scope of the appended claims.

Claims

1. a kind of prevention, the method for inhibiting or treating the cancer in subject in need, which comprises

(a) the non-naturally occurring nucleic acid enzyme system comprising one or more carriers is provided, the carrier includes:

I) it is operably connected to the promoter of the nucleotide sequence of at least one code nucleic acid enzyme system guide RNA (gRNA), Wherein the gRNA hybridizes with the target sequence of the DNA molecular in the cell of the subject, and wherein the DNA molecular coding exists The one or more oncoproteins expressed in the cell；

Ii) it is operably connected to the operable adjusting member in cell of the nucleotide sequence of encoding gene group targeted nuclease Part,

Wherein component (i) and (ii) are located on the identical or different carrier of system, wherein the gRNA is targeted and miscellaneous with target sequence It hands over and the nuclease cuts the DNA molecular to change the expression of one or more gene products；

(b) system of therapeutically effective amount is applied to subject.

2. method of claim 1 further includes the steps that providing recombinant adeno-associated virus packaging adenovirus (Ad-rAAVpack).

3. method for claim 2, wherein the Ad-rAAVpack and the nucleic acid enzyme system are provided or are co-administered simultaneously.

4. the method for claim 1 wherein the system is CRISPR-Cas9.

5. the method for claim 1 wherein the systems to be wrapped into single adeno-associated virus (AAV) particle.

6. the method for claim 1 wherein adeno-associated virus packaging adenovirus includes at least one of adenoviral gene Missing.

7. method for claim 6, wherein adeno-associated virus packaging adenovirus is selected from adenoviral serotype 2, adenovirus blood Clear type 5 or adenoviral serotype 35.

8. method for claim 7, wherein the packaging virus is adenoviral serotype 5.

9. the method for any one of claim 6-8, wherein the adenoviral gene be selected from E1A, E1B, E2A, E2B, E3, E4, L1, L2, L3, L4 or L5.

10. method for claim 9, wherein the adenoviral gene is E3.

11. the method for claim 1 wherein the systems to inactivate one or more gene products.

12. the method for claim 1 wherein the nucleic acid enzyme systems to cut off at least one gene mutation.

13. the method for claim 1 wherein the promoter is H1 promoter.

14. the method for claim 13, wherein the H1 promoter is two-way.

15. the method for claim 14, wherein the H1 promoter includes:

A) control element of transcription is provided on a direction of the nucleotide sequence of at least one coding gRNA；With

B) control element of transcription is provided in the opposite direction of the nucleotide sequence of encoding gene group targeted nuclease.

16. the method for claim 1 wherein the genome targeted nuclease is Cas9 albumen.

17. the method for claim 16, wherein the Cas9 albumen is through codon optimization to express in cell.

18. the method for any one of claim 13-15, wherein the promoter be operably connected at least one, two, Three, four, five, six, seven, eight, nine or ten gRNA.

19. the method for claim 1 wherein the target sequence is oncogene or tumor suppressor gene.

20. the method for claim 1 wherein the target sequence is the oncogene comprising at least one mutation.

21. the method for any one of claim 18-20, wherein the target sequence be selected from Her2, PIK3CA, KRAS, HRAS, IDH1, NRAS, EGFR, MDM2, TGF-β, RhoC, AKT, c-myc, beta-catenin, PDGF, C-MET, PI3K-110 α, CDK4, cell periodic protein B 1, cyclin D1, female hormone receptor gene, Progesterone receptor gene, ErbB1 (v-erb- B2 into erythrocyte leukemia viral oncogene homolog 1), ErbB3 (v-erb-b2 into erythrocyte leukemia viral oncogene homology Object 3), PLK3, KIRREL, ErbB4 (v-erb-b2 into erythrocyte leukemia viral oncogene homolog 4), TGFα, ras-GAP, The oncogene of Shc, Nck, Src, Yes, Fyn, Wnt, Bcl2, PyV MT antigen and SV40 T antigen.

22. the method for claim 20, wherein the target sequence is the oncogene selected from KRAS, PIK3CA or IDH1.

23. the method for claim 22, wherein the target sequence is oncogene, the oncogene is KRAS.

24. the method for claim 23, wherein the KRAS includes the mutation selected from G13D, G12C or G12D.

25. the method for any one of claim 23-24, wherein the target sequence is selected from SEQ ID NO:11-14 or its group It closes.

26. the method for claim 22, wherein the target sequence is oncogene, the oncogene is PIK3CA.

27. the method for claim 26, wherein the PIK3CA includes the mutation selected from E345K, D549N or H1047R.

28. the method for any one of claim 26-27, wherein the target sequence is selected from SEQ ID NO:15-18 or its group It closes.

29. the method for claim 22, wherein the target sequence is oncogene, the oncogene is IDH1.

30. the method for claim 29, wherein the IDH1 is mutated comprising R132H.

31. the method for claim 1 wherein the gRNA sequences to be selected from nucleotide sequence shown in SEQ ID NO:1-10, or A combination thereof.

32. the method for claim 1 wherein the nucleic acid enzyme systems to give via systemic administration.

33. the method for claim 32, wherein the systemic administration is selected from oral, intravenous, intradermal, peritonaeum, subcutaneous and flesh Application in meat.

34. the method for claim 1 wherein the nucleic acid enzyme systems through applying in tumour or around tumour.

35. the method for claim 1 wherein at least one other anti-cancer agent therapies of the subject.

36. the method for claim 35, wherein the anticancer agent is selected from taxol, cis-platinum, Hycamtin, gemcitabine, wins and Mycin, Etoposide, carboplatin, docetaxel, Doxorubicin, Hycamtin, cyclophosphamide, tributidine, olaparib, he not Former times sweet smell, Letrozole and bevacizumab.

37. the method for claim 1 wherein at least one other anti-cancer therapies treatments of the subject.

38. the method for claim 37, wherein the anti-cancer therapies are radiotherapy, chemotherapy or operation.

39. the method for claim 1 wherein the cancer is solid tumor.

40. the method for claim 1 wherein the cancers to be selected from the cancer of the brain, human primary gastrointestinal cancers, carcinoma of mouth, breast cancer, oophoroma, forefront Gland cancer, cancer of pancreas, lung cancer, liver cancer, throat cancer, gastric cancer and kidney.

41. the method for claim 40, wherein the cancer is the cancer of the brain.

42. the method for claim 1 wherein the subject is mammal.

43. the method for claim 33, wherein the mammal is people.

44. the method for claim 1 wherein the cell Proliferation in the subject is suppressed or is reduced.

45. the method for claim 1 wherein the malignant tumour in the subject is suppressed or is reduced.

46. the method for claim 1 wherein the neoplasm necrosis in the subject is enhanced or increases.

47. a kind of method for the expression for changing one of cell or several genes product, wherein the cell includes coding institute The DNA molecular for stating one or more gene products, the method includes introducing into the cell:

(i) comprising the non-naturally occurring nucleic acid enzyme system of one or more carriers, the carrier includes:

A) it is operably connected to the promoter of the nucleotide sequence of at least one code nucleic acid enzyme system guide RNA (gRNA), Wherein the gRNA hybridizes with the target sequence of the DNA molecular；With

Wherein component (a) and (b) are located on the identical or different carrier of system, wherein the gRNA target and with the target sequence Hybridize and the nuclease cuts the DNA molecular to change the expression of one or more gene products.

48. the method for claim 47 further includes providing recombinant adeno-associated virus packaging adenovirus (Ad-rAAVpack).

49. the method for claim 48, wherein the Ad-rAAVpack is provided simultaneously with the nucleic acid enzyme system or applied jointly With.

50. the method for claim 47, wherein the system is CRISPR-Cas9.

51. the method for claim 47, wherein the system is wrapped into single adeno-associated virus (AAV) particle.

52. the method for claim 47, wherein the packaging virus includes at least one of adenoviral gene missing.

53. the method for claim 52, wherein adeno-associated virus packaging adenovirus is selected from adenoviral serotype 2, adenovirus Serotype 5 or adenoviral serotype 35.

54. the method for claim 53, wherein the adenovirus packaging virus is adenoviral serotype 5.

55. the method for any one of claim 52-54, wherein the adenoviral gene be selected from E1A, E1B, E2A, E2B, E3, E4, L1, L2, L3, L4 or L5.

56. the method for claim 55, wherein the adenoviral gene is E3.

57. the method for claim 47, wherein the system inactivates one or more gene products.

58. the method for claim 47, wherein the nuclease system cuts off at least one gene mutation.

59. the method for claim 47, wherein the promoter is H1 promoter.

60. the method for claim 59, wherein the H1 promoter is two-way.

61. the method for claim 60, wherein the H1 promoter includes:

62. the method for claim 47, wherein the genome targeted nuclease is Cas9 albumen.

63. the method for claim 62, wherein the Cas9 albumen is through codon optimization to express in cell.

64. the method for any one of claim 59-61, wherein the promoter be operably connected at least one, two, Three, four, five, six, seven, eight, nine or ten gRNA.

65. the method for claim 47, wherein the target sequence is oncogene or tumor suppressor gene.

66. the method for claim 47, wherein the target sequence be selected from EP300, FBXW7, GATA1, GATA2, NOTCH1, NOTCH2、EXT1、EXT2、PTCH1、SMO、SPOP、SUFU、APC、AXIN1、CDH1、CTNNB1、EP300、FAM123B、 GNAS、HNF1A、NF2、PRKAR1A、RNF43、SOX9、ARID1A、ARID1B、ARID2、ASXL1、ATRX、CREBBP、 DNMT1、DNMT3A、EP300、EZH2、H3F3A、HIST1H3B、IDH1、IDH2、KDM5C、KDM6A、MEN1、MLL2、MLL3、 NCOA3、NCOR1、PAX5、PBRM1、SETD2、SETBP1、SKP2、SMARCA4、SMARCB1、SPOP、TET2、WT1、AR、 BCOR、CREBBP、DAXX、DICER1、GATA3、IKZF1、KLF4、LMO1、PHOX2B、PHF6、PRDM1、RUNX1、SBDS、 SF3B1、SRSF2、U2AF1、ABL1、BCL2、CARD11、CASP8、CCND1、CDC73、CDK4、CDKN2A、CDKN2C、CYLD、 DAXX、FUBP1、MDM2、MDM4、MED12、MYC、MYCL1、MYCN、MYD88、NFE2L2、NPM1、PPM1D、PPP2R1A、 RB1、TNFAIP3、TRAF7、TP53、ALK、B2M、BRAF、CBL、CEBPA、CSF1R、CIC、EGFR、ERBB2、FGFR2、 FGFR3、FH、FLT3、GNA11、GNAQ、GNAS、HRAS、KIT、KRAS、MAP2K1、MAP3K1、MET、NRAS、NF1、 PDGFRA、PTPN11、RET、SDH5、SDH8、SDHC、SDHD、VHL、AKT1、ALK、B2M、CBL、CEBPA、CSF1R、EGFR、 ERBB2、FGFR2、FGFR3、FH、FLCN、FLT3、GNA11、GNAQ、GNAS、GPC3、KIT、MET、NKX21、PRKAR1A、 PIK3CA、PIK3R1、PDGFRA、PTEN、RET、SDH5、SDH8、SDHC、SDHD、STK11、TSC1、TSC2、TSHR、VHL、 WAS、CRLF2、FGFR2、FGFR3、FLT3、JAK1、JAK2、JAK3、KIT、MPL、SOCS1、VHL、B2M、CEBPA、ERK1、 GNA11、GNAQ、MAP2K4、MAP3K1、NKX21、TNFAIP3、TSHR、WAS、ACVR1B、BMPR1A、FOXL2、GATA1、 GATA2、GNAS、EP300、MED12、SMAD2、SMAD4、ATM、BAP1、BLM、BRCA1、BRCA2、BRIP1、BUB1B、 CHEK2、ERCC2、ERCC3、ERCC4、ERCC5、FANCA、FANCC、FANCD2、FANCE、FANCF、FANCG、MLH1、MSH2、 The cancer of MSH6, MUTYH, NBS1, PALB2, PMS1, PMS2, RECQL4, STAG2, TP53, WRN, XPA and XPC drive gene.

67. the method for any one of claim 64-65, wherein the target sequence be selected from Her2, PIK3CA, KRAS, HRAS, IDH1, NRAS, EGFR, MDM2, TGF-β, RhoC, AKT, c-myc, beta-catenin, PDGF, C-MET, PI3K-110 α, CDK4, cell periodic protein B 1, cyclin D1, female hormone receptor gene, Progesterone receptor gene, ErbB1 (v-erb- B2 into erythrocyte leukemia viral oncogene homolog 1), ErbB3 (v-erb-b2 into erythrocyte leukemia viral oncogene homology Object 3), PLK3, KIRREL, ErbB4 (v-erb-b2 into erythrocyte leukemia viral oncogene homolog 4), TGFα, ras-GAP, The oncogene of Shc, Nck, Src, Yes, Fyn, Wnt, Bcl2, PyV MT antigen and SV40 T antigen.

68. the method for claim 18, wherein the target sequence is the oncogene selected from KRAS, PIK3CA or IDH1.

69. the method for claim 68, wherein the target sequence is oncogene, the oncogene is KRAS.

70. the method for claim 69, wherein the KRAS includes the mutation selected from G13D, G12C or G12D.

71. the method for any one of claim 69-70, wherein the target sequence is selected from SEQ ID NO:11-14 or its group It closes.

72. the method for claim 66, wherein the target sequence is oncogene, the oncogene is PIK3CA.

73. the method for claim 70, wherein the PIK3CA includes the mutation selected from E345K, D549N or H1047R.

74. the method for any one of claim 70-71, wherein the target sequence is selected from SEQ ID NO:15-18 or its group It closes.

75. the method for claim 66, wherein the target sequence is oncogene, the oncogene is IDH1.

76. the method for claim 73, wherein the IDH1 is mutated comprising R132H.

77. the method for claim 47, wherein the gRNA sequence is selected from nucleotide sequence shown in SEQ ID NO:1-10, Or combinations thereof.

78. the method for claim 47, wherein the expression of one or more gene products is lowered.

79. the method for claim 47, wherein the cell is eukaryon or non-eukaryocyte.

80. the method for claim 79, wherein the eukaryocyte is mammal or people's cell.

81. the method for claim 80, wherein the eukaryocyte is cancer cell.

82. the method for claim 47, wherein the cell Proliferation in the cell is suppressed or reduces.

83. the method for claim 47, wherein the Apoptosis in the cell is enhanced or increases.