CN109959796B - Human serum DKK1 enzyme-linked aptamer adsorption detection kit - Google Patents
Human serum DKK1 enzyme-linked aptamer adsorption detection kit Download PDFInfo
- Publication number
- CN109959796B CN109959796B CN201711436359.3A CN201711436359A CN109959796B CN 109959796 B CN109959796 B CN 109959796B CN 201711436359 A CN201711436359 A CN 201711436359A CN 109959796 B CN109959796 B CN 109959796B
- Authority
- CN
- China
- Prior art keywords
- dkk1
- enzyme
- kit
- human serum
- linked
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57438—Specifically defined cancers of liver, pancreas or kidney
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
- G01N33/57488—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds identifable in body fluids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of biological products, and relates to an enzyme-linked aptamer adsorption detection kit for human serum DKK1 content and a preparation method thereof. The kit is prepared from the following components: succinimidyl-modified 96-well plates; phosphate buffer; blocking the buffer solution; TMB color development liquid; detecting the diluent; washing the buffer solution; a 5' aminated aptamer recognizing DKK1 protein; a biotin-labeled goat anti-human DKK1 polyclonal antibody; and (3) standard substance: DKK1 protein; horse radish peroxidase is labeled with streptavidin; stop solution and sealing film. The kit disclosed by the invention is proved by experiments that the kit can detect the content of human serum DKK1, is used for early diagnosis and early warning of liver cancer, is simple and convenient in method, strong in specificity and high in sensitivity, and has the advantages of shorter detection time, higher accuracy, lower cost and better application prospect compared with the traditional enzyme-linked immunosorbent assay kit.
Description
Technical Field
The invention belongs to the technical field of biology, and relates to an enzyme-linked aptamer adsorption detection kit, in particular to an enzyme-linked aptamer adsorption detection kit for human serum DKK1 content and a preparation method thereof.
Background
The prior art discloses that the DKK1 protein is a member of dickkopf protein family, and the secretory protein comprises two cysteine-rich domains and can be specifically combined with LRP5/6 which is one of Wnt receptors, so that the combination of LRP5/6 and Wnt-Frizzled complex is interfered, and the conduction of downstream signals is inhibited. Another high affinity receptor for DKK1 is kremen (krm), and it was found that DKK1 forms a ternary complex with LRP6 and Krm2 in the presence of Krm2, and that the ternary complex can be rapidly endocytosed; studies have shown that LRP6 on the membrane surface can be cleared due to this endocytosis phenomenon, further inhibiting Wnt/β -catenin signaling. The DKK1 was also shown to inhibit the Wnt/β -catenin signaling pathway by reducing β -catenin, increasing OCT4 expression, a role that plays a key role in heart, head and forelimb development.
Studies have shown that DKK1 is rarely expressed in adults, and is only highly expressed in embryonic tissues and placenta; DKK1 has been shown to be overexpressed in hepatocellular carcinoma tissues and undetectable in normal liver tissues; the increase of the content of secretory DKK1 is detected in various cell culture solutions of liver cancer, lung cancer, breast cancer, glioma, cervical cancer and the like, and after relevant researches on the evaluation of the DKK1 levels of 831 clinical serum samples (424 liver cancer samples, 98 hepatitis B samples, 96 liver cirrhosis samples and 212 normal person controls), the detection sensitivity of DKK1 serving as a liver cancer marker reaches 69%, and the specificity reaches 90.6%; the detection sensitivity of the AFP negative liver cancer patient is 70.4 percent, and the specificity is 90.0 percent; therefore, the detection of DKK1 in serum can be used as an important means and index for early diagnosis and early warning of liver cancer, and has important value particularly for liver cancer negative by AFP.
The prior art also discloses that the aptamer is a single-chain oligonucleotide with the length less than 100 bases, can form a high-level structure through self-folding, realizes specific recognition with a target, and is also called as a chemical antibody. Research shows that the affinity and specificity of the aptamer and the target are not inferior to those of an antibody, and the aptamer has the advantages of more diverse identification targets, shorter development period, more stable performance, easier modification, lower cost and the like, and is widely applied to the fields of scientific research, diagnosis, treatment and the like. Compared with the traditional enzyme-linked immunosorbent assay kit, the enzyme-linked aptamer adsorption assay kit based on the aptamer has the advantages of shorter assay time, higher accuracy, lower cost and the like, the inventor of the application intends to provide the enzyme-linked aptamer adsorption assay kit, and particularly relates to the enzyme-linked aptamer adsorption assay kit for detecting the content of human serum DKK1 and a preparation method thereof.
Disclosure of Invention
The invention aims to provide an enzyme-linked aptamer adsorption detection kit, and particularly relates to an enzyme-linked aptamer adsorption detection kit for human serum DKK1 content and a preparation method thereof.
The detection kit is a human serum DKK1 enzyme-linked aptamer adsorption qualitative detection kit, can be used for qualitatively detecting DKK1 in human serum in a standardized and stylized manner, can avoid the influence of differentiation on the accuracy and reliability of detection, and is suitable for early diagnosis and early warning of liver cancer, particularly provides a highly sensitive and specific diagnosis kit for early diagnosis and early warning of liver cancer negative by AFP. Compared with the traditional enzyme-linked immunosorbent assay kit, the enzyme-linked aptamer adsorption assay kit based on the aptamer has the advantages of shorter detection time, higher accuracy and lower cost.
The purpose of the invention is realized by the following technical scheme:
an enzyme-linked aptamer adsorption kit for qualitative detection of human serum DKK1 is characterized by comprising the following components:
1) a succinimidyl-modified 96-well plate for coating aptamers;
2) phosphate buffered saline solution: 137mmol/l (8.0g/l) sodium chloride, 2.7mmol/l (0.2g/l) potassium chloride, 8.1mmol/l (1.15g/l) disodium hydrogen phosphate, 1.5mM (0.2g/l) potassium dihydrogen phosphate, pH 7.4;
3) blocking buffer: adding 1g of bovine serum albumin into 100ml of phosphate buffer solution;
4) TMB color development liquid: 24.3ml of 0.1mol/l (19.2g/l) citric acid solution, 25.7ml of 0.2mol/l (28.4g/l) disodium hydrogen phosphate solution and 50ml of distilled water are added, 40g o-phenylenediamine is dissolved in the solution, 0.10ml of 30% hydrogen peroxide is added, and the solution is prepared fresh when used and is protected from light;
5) detecting a diluent: 100ml phosphate buffer solution is added with 1g bovine serum albumin, 100 mug yeast transport ribonucleic acid;
6) washing buffer solution: adding 0.5ml of Tween-20 into 100ml of phosphate buffer;
7) a 5' aminated aptamer recognizing DKK1 protein;
8) a biotin-labeled goat anti-human DKK1 polyclonal antibody;
9) and (3) standard substance: DKK1 protein;
10) horse radish peroxidase is labeled with streptavidin;
11) stopping liquid: 1mol/l sulfuric acid;
12) and (5) sealing a plate film.
The human serum DKK1 enzyme-linked aptamer adsorption detection kit is prepared by the following method, and comprises the following steps:
1) 96-well plates modified with succinimidyl groups coated with aptamers (available from corning);
2) preparing a phosphate buffer salt solution: prepared by adding 8.0g of sodium chloride, 0.2g of potassium chloride, 2.8g of disodium hydrogen phosphate dodecahydrate and 0.2g of potassium dihydrogen phosphate dihydrate into 1l of deionized water, wherein the pH value is 7.4;
3) preparing a blocking buffer: prepared by adding 1g of bovine serum albumin into 100ml of phosphate buffer solution;
4) preparing a TMB color developing solution: 24.3ml of 0.1mol/l citric acid solution, 25.7ml of 0.2mol/l disodium hydrogen phosphate solution and 50ml of distilled water are added, 40g o-phenylenediamine is dissolved in the solution, and 0.10ml of 30 percent hydrogen peroxide is added to prepare the solution;
5) preparing a detection diluent: prepared by adding 1g of bovine serum albumin and 100 mu g of yeast transport ribonucleic acid into 100ml of phosphate buffer solution;
6) preparing a washing buffer solution: prepared by adding 0.5ml of Tween-20 into 100ml of phosphate buffer;
7) the sequence of the 5' aminated aptamer recognizing DKK1 protein is: NH 2-5'-catatgattaggctgtaacggggctaggcggggatcatt-3';
8) biotin-labeled goat anti-human DKK1 polyclonal antibodies were purchased from R & D Systems;
9) DKK1 protein was purchased from beijing yinqiao shenzhou technologies ltd;
10) horse radish peroxidase-labeled streptavidin was purchased from R & D Systems;
11) 1mol/l sulfuric acid is adopted as the stop solution;
12) and sealing the plate by using a sealing plate film.
The kit for qualitative detection of human serum DKK1 is characterized in that the kit is further required to be prepared from the following materials:
1) microplate reader (band 450 nm);
2) sample injector, 10. mu.l, 100. mu.l, 1000. mu.l disposable tip;
3) absorbent paper or absorbent towels.
In the invention, the citric acid, the potassium dihydrogen phosphate dihydrate, the disodium hydrogen phosphate dodecahydrate, the o-phenylenediamine and the sulfuric acid are all chemically pure; the bovine serum albumin, the yeast transport ribonucleic acid and the tween-20 are analytically pure.
The above agents of the present invention are all available directly from commercial sources.
The chemical component of the Tween-20 is polyoxyethylene sorbitan monolaurate.
The invention carries out test detection, wherein a detection standard curve (shown in figure 1) is drawn by using the kit to determine the detection limit; the detection result shows that the detection limit of the kit can be as low as 62.5pg/ml, and the detection requirement of an actual sample can be met; then, the kit is used for detecting the DKK1 content of the serum of 30 normal persons and the serum of 30 liver cancer patients, and the result shows that the DKK1 positive rate in liver cancer is obviously higher than that of a normal group, the detected p value is 0.0003, and the kit has statistical significance (as shown in figure 2).
The invention has the following beneficial effects: the prepared human serum DKK1 enzyme-linked aptamer adsorption detection kit is high in accuracy and reliability, and is suitable for detecting diseases related to DKK1 protein, such as lung cancer, liver cancer, esophageal cancer, pancreatic cancer, myeloma, endometrial cancer, cervical cancer or rheumatoid arthritis; the invention particularly provides a highly sensitive and specific diagnostic kit for early diagnosis and early warning of liver cancer and AFP negative early diagnosis and early warning of liver cancer; compared with the traditional enzyme-linked immunosorbent assay kit, the enzyme-linked aptamer adsorption assay kit based on the aptamer has the advantages of shorter assay time, higher accuracy and lower cost.
Drawings
FIG. 1 is a standard curve for detection prepared by using the kit of the present invention.
Fig. 2 shows that the kit of the present invention detects the amount of DKK1 protein in normal human serum (n-30) and in serum (n-30) of patients with liver cancer, and p is 0.0003.
Detailed Description
Example 1 preparation of human serum DKK1 enzyme-linked aptamer adsorption assay kit
1, the detection kit comprises the following components:
1) a succinimidyl-modified 96-well plate for coating aptamers;
2) phosphate buffered saline solution: 137mmol/l (8.0g/l) sodium chloride, 2.7mmol/l (0.2g/l) potassium chloride, 8.1mmol/l (1.15g/l) disodium hydrogenphosphate, 1.5mM (0.2g/l) potassium dihydrogenphosphate, pH 7.4;
3) blocking buffer: adding 1g of bovine serum albumin into 100ml of phosphate buffer solution;
4) TMB color development liquid: 24.3ml of 0.1mol/l (19.2g/l) citric acid solution, 25.7ml of 0.2mol/l (28.4g/l) disodium hydrogen phosphate solution and 50ml of distilled water are added, 40g o-phenylenediamine is dissolved in the solution, 0.10ml of 30% hydrogen peroxide is added, and the solution is prepared fresh when used and is protected from light;
5) detecting a diluent: adding 1g bovine serum albumin and 100 μ g yeast transport ribonucleic acid into 100ml phosphate buffer solution;
6) washing buffer solution: adding 0.5ml of Tween-20 into 100ml of phosphate buffer;
7) a 5' aminated aptamer recognizing DKK1 protein;
8) a biotin-labeled goat anti-human DKK1 polyclonal antibody;
9) and (3) standard substance: DKK1 protein;
10) horse radish peroxidase is labeled with streptavidin;
11) stopping liquid: 1mol/l sulfuric acid;
12) and (5) sealing a plate film.
The preparation method comprises the following steps:
1) 96-well plates modified with succinimidyl groups coated with aptamers (available from corning);
2) preparing a phosphate buffer salt solution: prepared by adding 8.0g of sodium chloride, 0.2g of potassium chloride, 2.8g of disodium hydrogen phosphate dodecahydrate and 0.2g of potassium dihydrogen phosphate dihydrate into 1l of deionized water, wherein the pH value is 7.4;
3) preparing a blocking buffer: prepared by adding 1g of bovine serum albumin into 100ml of phosphate buffer solution;
4) preparing a TMB color developing solution: 24.3ml of 0.1mol/l citric acid solution, 25.7ml of 0.2mol/l disodium hydrogen phosphate solution and 50ml of distilled water are added, 40g o-phenylenediamine is dissolved in the solution, and 0.10ml of 30 percent hydrogen peroxide is added to prepare the solution;
5) preparing a detection diluent: prepared by adding 1g of bovine serum albumin and 100 mu g of yeast transport ribonucleic acid into 100ml of phosphate buffer solution;
6) preparing a washing buffer solution: prepared by adding 0.5ml of Tween-20 into 100ml of phosphate buffer;
7) the sequence of the 5' aminated aptamer recognizing DKK1 protein is: NH 2-5'-catatgattaggctgtaacggggctaggcggggatcatt-3';
8) biotin-labeled goat anti-human DKK1 polyclonal antibodies were purchased from R & D Systems;
9) DKK1 protein was purchased from beijing yinqiao shenzhou technologies ltd;
10) horse radish peroxidase-labeled streptavidin was purchased from R & D Systems;
11) 1mol/l sulfuric acid is adopted as the stop solution;
12) and sealing the plate by using a sealing plate film.
The citric acid, the potassium dihydrogen phosphate dihydrate, the disodium hydrogen phosphate dodecahydrate, the o-phenylenediamine and the sulfuric acid are all chemically pure; the bovine serum albumin, the yeast transport ribonucleic acid and the tween-20 are analytically pure;
the above agents are all available directly from commercial stores.
2. The following materials were prepared:
1) microplate reader (band 450 nm);
2) sample injector, 10. mu.l, 100. mu.l, 1000. mu.l disposable tip;
3) absorbent paper or absorbent towels.
3. Human serum sample preparation and storage: blood sampling is carried out on an empty stomach, and centrifugation is carried out after natural storage for 1-2 hours. Wherein the blood sample collected from the tube filled with the separation gel is directly centrifuged at 3000rmp for 15 minutes; blood collected by a common glass or plastic tube is placed at 37 ℃ for 30 minutes, then is centrifuged at 3000 rpm/min for 10 minutes, and the processed blood sample to be detected is hermetically stored in a refrigerator at 2-8 ℃;
4. the detection was carried out as follows:
1) coating: on the detection day, diluting 5' aminated DKK1 aptamer to 50nmol/l with detection diluent, adding into 96-well succinimidyl modified plate with each well being 100 μ l, sealing with sealing plate film, and standing at room temperature for 30 min;
2) sucking out liquid in the holes of the enzyme-linked plate, washing by shaking with a washing buffer solution for 3 times, and centrifuging and spin-drying after drying each time;
3) and (3) sealing: adding 300ul of sealing buffer solution into each hole, sealing the plate by using a sealing plate membrane, and standing for 1 hour at room temperature;
4) sample adding: blank holes, standard holes, sample holes to be detected and 100 mul/hole are respectively arranged. DKK1 protein was used as a standard, and was diluted in phosphate buffer solution (1: 100; 1: 1000; 1: 2000; 1: 4000; 1: 8000) in a gradient and then allowed to stand at room temperature for 1 hour after sealing with a sealing plate film.
5) Pouring out liquid in the holes of the enzyme-linked plate, washing for 3 times by shaking with a washing buffer solution, and centrifugally drying after drying each time;
6) adding 100 mul of goat anti-human DKK1 polyclonal antibody (diluted by detection diluent) marked by 50ng/ml biotin into each hole, sealing the plate by a sealing plate membrane, and standing for 1 hour at room temperature;
7) pouring out liquid in the holes of the enzyme-linked plate, washing for 3 times by shaking with a washing buffer solution, and centrifugally drying after drying each time;
8) horseradish peroxidase-labeled streptavidin was added to each well (diluted with assay diluent 1: 200 dilution) and then standing for 30 minutes at room temperature after sealing the plate by using a sealing plate film;
9) pouring out liquid in the holes of the enzyme-linked plate, washing for 3 times by shaking with a washing buffer solution, and centrifugally drying after drying each time;
10) color development: 100 mul of TMB color development liquid (used as prepared) is added into each hole, a sealing plate is used for sealing, then a thermostatic water bath at 37 ℃ is carried out for 20 minutes, and 100 mul of stop solution is dripped into each hole to stop the reaction.
11) The microplate is placed in a microplate reader, the blank control hole is used for zero adjustment, and the result is read at the wavelength of 450 nm.
In this example, preliminary verification was performed, and a standard curve for detection (as shown in fig. 1) was plotted using the kit to determine the limit of detection; the result shows that the detection limit of the kit can be as low as 62.5pg/ml, and the detection requirement of an actual sample can be met; then, the kit is used for detecting the DKK1 content of 30 normal human serum and 30 serum of liver cancer patients, and the result shows that the DKK1 positive rate in liver cancer is obviously higher than that of a normal group, the detected p value is 0.0003, and the kit has statistical significance (as shown in figure 2).
Claims (3)
1. The human serum DKK1 enzyme-linked aptamer adsorption detection kit is characterized by comprising:
1) a succinimidyl-modified 96-well plate for coating aptamers;
2) phosphate buffered saline solution;
3) blocking the buffer solution;
4) TMB color development liquid;
5) detecting the diluent;
6) washing the buffer solution;
7) a 5' aminated aptamer recognizing DKK1 protein, having the sequence
5’- catatgattaggctgtaacggggctaggcggggatcatt -3’ ；
8) A biotin-labeled goat anti-human DKK1 polyclonal antibody;
9) a standard substance;
10) horse radish peroxidase is labeled with streptavidin;
11) a stop solution; and (c) and (d),
12) and (5) sealing a plate film.
2. The human serum DKK1 enzyme-linked aptamer adsorption detection kit according to claim 1, wherein the kit is further prepared from the following materials:
1) an enzyme-linked immunosorbent assay (ELIASA) with the band of 450 nm;
2) sample injector, 10. mu.l, 100. mu.l, 1000. mu.l disposable tip;
3) absorbent paper or absorbent towels.
3. The human serum DKK1 enzyme-linked aptamer adsorption detection kit according to claim 1, wherein the DKK1 protein-related diseases comprise lung cancer, liver cancer, esophageal cancer, pancreatic cancer, myeloma, endometrial cancer, cervical cancer or rheumatoid arthritis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711436359.3A CN109959796B (en) | 2017-12-26 | 2017-12-26 | Human serum DKK1 enzyme-linked aptamer adsorption detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711436359.3A CN109959796B (en) | 2017-12-26 | 2017-12-26 | Human serum DKK1 enzyme-linked aptamer adsorption detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109959796A CN109959796A (en) | 2019-07-02 |
| CN109959796B true CN109959796B (en) | 2022-05-10 |
Family
ID=67022518
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711436359.3A Active CN109959796B (en) | 2017-12-26 | 2017-12-26 | Human serum DKK1 enzyme-linked aptamer adsorption detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109959796B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112748247A (en) * | 2020-12-23 | 2021-05-04 | 复旦大学附属华山医院 | Application of antibody binding agent in preparation of auxiliary detection product for vitiligo stage and detection kit for vitiligo stage identification |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102081092A (en) * | 2009-11-30 | 2011-06-01 | 武汉大学 | Kit and detection method for mycobacterium tuberculosis |
| CN102507951A (en) * | 2011-11-25 | 2012-06-20 | 广东药学院 | Enzyme-linked immuno sorbent assay (ELISA) kit for performing joint detection on tumor marker |
| CN103487580A (en) * | 2012-06-08 | 2014-01-01 | 上海市肿瘤研究所 | Application of DKK1 as diagnostic marker |
| CN104830867A (en) * | 2015-06-07 | 2015-08-12 | 杨洋 | Aptamer capable of being specifically combined with DKK1 protein in cancer cells |
| CN105203760A (en) * | 2015-07-24 | 2015-12-30 | 中国人民解放军第二军医大学 | PSMD4 protein ELISA detection kit as well as detection method and application thereof |
| CN105588941A (en) * | 2015-02-28 | 2016-05-18 | 苏州飞康生物医药有限公司 | Enzyme-linked immunosorbent assay kit for detecting concentration of tumor marker DKK1 |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103608037B (en) * | 2011-02-01 | 2016-04-13 | 香港大学 | Anti-DKK1 monoclonal antibody is used for the treatment of the purposes of hepatocarcinoma |
-
2017
- 2017-12-26 CN CN201711436359.3A patent/CN109959796B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102081092A (en) * | 2009-11-30 | 2011-06-01 | 武汉大学 | Kit and detection method for mycobacterium tuberculosis |
| CN102507951A (en) * | 2011-11-25 | 2012-06-20 | 广东药学院 | Enzyme-linked immuno sorbent assay (ELISA) kit for performing joint detection on tumor marker |
| CN103487580A (en) * | 2012-06-08 | 2014-01-01 | 上海市肿瘤研究所 | Application of DKK1 as diagnostic marker |
| CN105588941A (en) * | 2015-02-28 | 2016-05-18 | 苏州飞康生物医药有限公司 | Enzyme-linked immunosorbent assay kit for detecting concentration of tumor marker DKK1 |
| CN104830867A (en) * | 2015-06-07 | 2015-08-12 | 杨洋 | Aptamer capable of being specifically combined with DKK1 protein in cancer cells |
| CN105203760A (en) * | 2015-07-24 | 2015-12-30 | 中国人民解放军第二军医大学 | PSMD4 protein ELISA detection kit as well as detection method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109959796A (en) | 2019-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2018000902A1 (en) | Chemiluminiscence immuno-assay kit for 25-hydroxyl vitamin d and preparation method therefor | |
| JPWO2008120684A1 (en) | Prognosis determination method for acute central nervous system disorder | |
| JP6458087B2 (en) | Method for determining susceptibility to nosocomial infections | |
| CN111474348B (en) | Novel detection kit and detection method for coronavirus | |
| CN102043058A (en) | Detection kit of acetyl amantadine for predicting tumors | |
| Arnold et al. | Presence of hepcidin-25 in biological fluids: bile, ascitic and pleural fluids | |
| CN109959796B (en) | Human serum DKK1 enzyme-linked aptamer adsorption detection kit | |
| Luterotti et al. | Contribution to diagnostics/prognostics of tuberculosis in children. II. Indicative value of metal ions and biochemical parameters in serum | |
| CN111630381A (en) | PRO-ADM-based guidance for antibiotic therapy | |
| Kawamura et al. | New Sandwich‐Type Enzyme‐Linked Immunosorbent Assay for Human MxA Protein in a Whole Blood Using Monoclonal Antibodies Against GTP‐Binding Domain for Recognition of Viral Infection | |
| CN103608676A (en) | Method for determining prognosis of renal failure | |
| JP2018128378A (en) | Inspection method and test reagent for intrahepatic bile duct cancer | |
| JPWO2020004244A1 (en) | Marker for determining pancreatic cancer | |
| CN111650381B (en) | Application of protein marker or combination thereof in preparation of acute mastitis diagnosis kit | |
| Gupta et al. | Quantitative estimation of lactoferrin and leukocytes contents in bovine, sheep and goat milks | |
| Saifer et al. | Photometric microdetermination of total serum globulins by means of a tryptophan reaction | |
| CN110687285B (en) | Diagnostic kit and application of MAK16 in preparation of early diagnosis reagent for systemic lupus erythematosus | |
| WO2018000900A1 (en) | Anti-sperm antibody chemiluminescence immunoassay kit and preparation method thereof | |
| JP5456056B2 (en) | Detection of IFI16 in body fluids | |
| Meng et al. | Development and validation of an Enzyme Linked Immunosorbent Assay (ELISA) for gentamicin quantification in dried blood spot samples | |
| CN110261618A (en) | Application and its kit of the SPRR4 albumen as gastric cancer serum biomarker | |
| Lyons et al. | Salivary oncofoetal fibronectin and oral squamous cell carcinoma | |
| Wienecka et al. | Detection of Giardia antigen in stool samples by a semi-quantitative enzyme immunoassay (EIA) test | |
| AU2021105747A4 (en) | Application of diagnostic kit and MAK16 in preparation of reagent for early diagnosis of systemic lupus erythematosus | |
| WO2011088740A1 (en) | Enzyme linked immunosorbent assay (elisa) method and kit for detecting soluble programmed cell death protein 5 (pdcd5) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |