CN109943578A - A kind of rice EPSP synthase mutant gene, mutant and its application - Google Patents
A kind of rice EPSP synthase mutant gene, mutant and its application Download PDFInfo
- Publication number
- CN109943578A CN109943578A CN201910216002.7A CN201910216002A CN109943578A CN 109943578 A CN109943578 A CN 109943578A CN 201910216002 A CN201910216002 A CN 201910216002A CN 109943578 A CN109943578 A CN 109943578A
- Authority
- CN
- China
- Prior art keywords
- gene
- rice
- epsp synthase
- glyphosate
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
- C12N9/1092—3-Phosphoshikimate 1-carboxyvinyltransferase (2.5.1.19), i.e. 5-enolpyruvylshikimate-3-phosphate synthase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/743—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Agrobacterium; Rhizobium; Bradyrhizobium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
- C12N15/8275—Glyphosate
Abstract
The invention discloses a kind of rice EPSP synthase mutant gene, mutant and its applications.The nucleotide sequence of the rice EPSP synthase mutant gene is as shown in SEQ ID NO.1, and amino acid sequence is as shown in SEQ ID NO.2.The codon that the 102nd amino acids, the 106th amino acids and the 381st amino acids are encoded in wild rice epsp synthase gene is mutated to obtain by the present invention by artificial mutation technology, so that the 102nd amino acids residue is mutated into isoleucine by threonine, the 106th amino acids residue is mutated into serine, the 381st amino acids residue by proline and is mutated into leucine by proline, rice EPSP synthase mutant gene is obtained；Rice EPSP synthase mutant gene is transferred to the genetically modified crops obtained after receptor has preferable glyphosate resistance, is of great significance to screening and cultivating glyphosate resistant crops new varieties.
Description
Technical field
The present invention relates to field of plant genetic project technology more particularly to a kind of rice EPSP synthase mutant gene, dash forward
Variant and its application.
Background technique
The trade name of glyphosate, scientific name N- (phosphonomethyl) glycine, isopropyl amine salt reaches (Roundup) agriculture, is one
The organophosphorus herbicide of the non-selective inner sucting conduction type cauline leaf process of kind high-efficiency low-toxicity.
Since the beginning of the seventies in last century is developed by Monsanto Company, annual, biennial grass family, Sha are used to prevent and kill off
Careless section and broadleaf weeds also have good preventive effect to perennial bad habit weeds such as cogongrass, the rhizome of nutgrass flatsedge, Bermuda grass, extensively
Chemical weed control (Duke SO and Powles applied to farmland, orchard, mulberry field, tea place, grassland update and no-tillage ground etc.
SB.Mini-review glyphosate:a once-in-a-century herbicide.Pest Manag Sci,2008,
64:319-325；Duke SO.The history and current status of glyphosate.Pest Manag
Sci.2018,74:1027-1034)。
Powles and Yu (Powles SB, Yu Q.Evolution in action:Plants resistan t to
Herbicides.Annual Review of Plant Biology.2010,61:317-347) according to herbicide action mechanism
Existing herbicide is divided into target type and non-target type, glyphosate belongs to the former.In plant cell, 5- enolpyruvyl acyl is big
Oxalic acid -3- phosphate synthase (5-enolpyruvylshiki mate 3-phosphate synthase, abbreviation EPSPS or EPSP
Synzyme) it is a key enzyme in aromatic amino acid (including phenylalanine, tryptophan and tyrosine) route of synthesis, and
The target enzyme of the single-minded inhibition of glyphosate.The enzyme can be by shikimic acid -3- phosphoric acid (Shikimate-3-phophate, S3P) and phosphoric acid
The important as precursors object 5- that enol pyruvic acid (Phosphoenolpyrurate, PEP) catalyzing and condensing is synthesized at aromatic amino acid
Enol pyruvylshikimate -3- phosphoric acid (5-enolpyruvylshikimate 3-phosphate, EPSP).And the change of glyphosate
Credit minor structure is similar with PEP, therefore after plant absorption glyphosate, will combine with epsp synthase and interfere the enzyme
And the combination of normal substrates PEP, cause epsp synthase vigor decline even lose, resultant interference phenylalanine, tryptophan and
The biosynthesis of the ArAAs such as tyrosine, and then the normal growth and development of plant is influenced, eventually lead to Plant death
(Steinrücken HC,Steinruecken HC,Amrhein N,AmrheinN.The herbicide glyphosate
is a potent inhibitor of 5-enolpyruvylshikimic acid-3-phosphate
synthase.Biochemical and Biophysical Research Communications.1980,94:1207-
1212)。
In addition, glyphosate can also inhibit the activity of other plant enzymes, and also there is height in higher plant body
Runnability and slow degradability, thus to plant easily cause height toxicity and become a kind of ideal management of weeds wide spectrum
Steriland herbicide (Malik J, Barry G, Kishor G.The herbicide
glyphosate.Biofactors.1998,2:17-25；Smith EA,Oehme FW.The biological activity
of glyphosate to plants and animals:a literature review.Veterinary and Human
Toxicology.1992,34:531-543；Powles SB,Yu Q.Evolution in action:Plants
resistant to herbicides.Annual Re view of Plant Biology.2010,61:317-347)。
It therefore, is to solve crop resistance glyphosate using the genetically modified crops new varieties that genetic engineering means cultivate resistance glyphosate
Important means.
Since resistance glyphosate transgene cotton in 1996 is commercialized, cultivated so far resistance glyphosate genetically engineered soybean,
The field crops such as corn and rape.1.21 hundred million hectares of resistance glyphosate crops are about planted in the whole world in 2017, and Zhan Quanqiu transgenosis is made
65% (http://www.isaaa.org/resources/publications/briefs/53/ of object total cultivated area
default.asp)(Bonny S.Genetically modif ied herbicide-tolerant crops,weeds,and
herbicides:Overview and Impact.Environ Manage.2016,57:31-48；Green JM.The rise
and future of gly phosate and glyphosate-resistant crops.Pest Manag Sci.2018,
74:1035-1039)。
Currently, available Antiglyphosate gene includes EPSPS and GOX gene, wherein the former include again CP4-EPSPS and
Improvement corn EPSPS gene (Zhou H, Arrowsmith JW, Fromm ME, Hironaka CM, Taylor ML,
Rodriguez D,Pajeau ME,Brown SM,Santino CG,Fry JE.Glyphosate-tolerant CP4and
GOX genes as a selectable marker in wheat transformation.Plant Cell
Reports.1995,15:159-163；Yu Q,Jalaludin A,Han H,Chen M,Douglas Sammons R,
Powles SB.Evolution of a double amino acid substitution in the 5-enolpyr
uvylshikimate-3-phosphate synthase in Eleusine indica conferring high-level
glyphosate resistance.Plant Physiology.2015,167:1440-1447；Green JM.The rise
and future of glyphosate and glyphosate-resistant crops.Pest Manag Sci.2018,
74:1035-1039)。
Certainly, in order to reduce epsp synthase to the compatibility of glyphosate and improve the glyphosate resistance of the enzyme, Qian Renyan
Study carefully the mutation for confirming epsp synthase partial amino-acid residue, the threonine at the such as the 102nd is mutated into isoleucine, the 106th
The proline at place is mutated into serine, the threonine at the 42nd is mutated into methionine, the proline at the 173rd is mutated into ammonia
Acid etc. can assign higher glyphosate resistance (Yu Q, Jalaludin A, Han H, Chen M, the Douglas Samm of the enzyme
ons R,Powles SB.Evolution of a double amino acid substitution in the 5-
enolpyruvylshikimate-3-phosphate synthase in Eleusine indica conferring high-
level glyphosate resistance.Plant Physiology.2015,167:1440-1447；Fartyal D,
Agarwal A,James D,Borphukan B,Ram B,Sheri V,Yadav R,Manna M,Varakumar P,
Achary VMMM,Reddy MK.Co-expression of P173S mutant rice EPSPS and igrA genes
results in higher glyphosate tolerance in transgenic rice.Frontiers in Plant
Science.2018,9:144；A kind of rice EPSP synthase mutant of Zhu Zhen and Zhou Min and its encoding gene, preparation method with
Using Chinese invention patent 20051002739.7) and the 102nd at threonine be mutated at isoleucine and the 106th
Proline is mutated into double-mutant (the Heap I and Duke SO.Ove rview of glyphosate- of serine
resistant weeds worldwide.Pest Manag Sci.2018,74:1040-1049；Wang Jiansheng, He Yunwei, Cui Hong
A kind of cotton EPSP synthetase mutant gene of will and its application.Chinese invention patent 201010277667.8；Meter Xie Erli
Blang, A Lansailande, George Si Fulaixinaite, Eric Dege Li Xi.The 5- enolpyruvyl acyl thick grass of mutation
Acid -3- phosphate synthase and the gene for encoding this albumen.Chinese invention patent 96196889.3).
Moreover, research confirms, (threonine at the 102nd is mutated into the mutation of the proline at isoleucine and the 106th to TIPS
At the double-mutant of serine) being significantly higher than P106S to the resistance of glyphosate, (proline at the 106th is mutated into serine
Single mutant) (Yu Q, Jalaludin A, Han H, Chen M, Douglas Sammons R, Powles SB.Evolution
of a double aminoacid substitution in the 5-enolpyruvylshikimate-3-phosphate
synthase in Eleusine indica conferring high-level glyphosate resistance.Plant
Physiology.2015,167:1440-1447)。
However, above-mentioned double-mutant is still to be improved to the resistance of glyphosate；Therefore, it is necessary to obtain sweeter than the grass of TIPS
The higher EPSPS mutant of phosphine resistance, this will provide new genetic resources to cultivate high-resistance glyphosate New Crop Varieties.
Summary of the invention
The present invention provides a kind of rice EPSP synthase mutant gene, mutant and its application, rice EPSP synthesis
Enzyme mutant gene can further increase the glyphosate resistance of genetically modified crops on the basis of existing technology, to cultivate highly resistance
Glyphosate New Crop Varieties provide new genetic resources.
Specific technical solution is as follows:
A kind of rice EPSP synthase mutant gene, i.e. mutated gene OsmEPSPS1, nucleotide sequence such as SEQ ID
Shown in NO.1.
The nucleotide sequence of the wild type OsEPSPS1 gene of above-mentioned mutated gene is as shown in SEQ ID NO.3, wild
On the basis of type OsEPSPS1 gene, the codon (ACT) for encoding the 102nd amino acids residue T is sported into coding amino acid
The codon (ATT) of residue I, the codon (CCA) for encoding the 106th amino acids residue P sport coding amino acid residue S's
Codon (TCA), the 381st amino acids residue of coding are sported the password of coding amino acid residue L by the codon (CCT) of P
Sub (CTG), obtains above-mentioned rice EPSP synthase mutant gene.
In the prior art, the 381st amino acid residue in wild type EPSPS gene is mutated by proline (P)
This single mutation mode of leucine (L) has been found (Baerson SR., et unrelated with glyphosate resistance
al.Glyphosate-resistant goosegrass.identification of a mutation in the target
enzyme 5-enolpyruvylshikimate-3-phosphate synthase.Plant Physiology,2002,129:
1265–1275)；If the present invention has been surprisingly found that when carrying out the research of EPSPS gene-correlation by the 102nd amino acids, the 106th ammonia
Base acid and the 381st amino acids carry out three mutation, can significantly improve the glyphosate resistance of genetically modified plants.
Mutated gene OsmEPSPS1 in the present invention be by artificial mutation rice EPSP synzyme the 102nd, 106 and
What 381 equal 3 amino acid residues obtained；Using transgenic paddy rice comparative analysis OsmEPSPS1, OsmEPSPS2, (rice EPSP is closed
Sport I and S respectively at the 102nd and 106 amino acid of enzyme), OsmEPSPS3 (the 102nd and 381 ammonia of rice EPSP synzyme
Base acid sports I and L respectively) and OsmEPSPS4 (the 106th and 381 amino acid of rice EPSP synzyme sport respectively S and
L), the glyphosate resistance for turning the transgenic paddy rice of OsmEPSPS1 as the result is shown is best；Therefore, OsmEPSPS1 can be applied to crop
Breeding field is of great significance to screening and cultivating glyphosate resistant crops new varieties.
Preferably, the rice EPSP synthase mutant, amino acid sequence is as shown in SEQ ID NO.2.
The present invention also provides a kind of recombinant expression carriers, the purpose base including initial carrier and the insertion initial carrier
Cause, the nucleotide sequence of the target gene is as shown in SEQ ID NO.1.
Further, the initial carrier is pCAMBIA1300 or pSB326-Actin-NOS；Wherein, overexpression vector
PSB326-Actin-NOS is double T-DNA carrier, is remarkably improved the expression quantity of target gene, and cultivate Marker-free
Transgenic progeny.
The present invention also provides a kind of transformants comprising the recombinant expression carrier.
Further, the host strain is Agrobacterium.When transformation receptor plant, the side of agrobacterium mediation converted can be used
Method, specifically, the Agrobacterium are Agrobacterium EHA105.
The present invention also provides rice EPSP synthase mutant genes in the glyphosate resistance for improving genetically modified crops
Using.
Further, the crop is rice or cotton.
The present invention by artificial mutation technology will in wild rice epsp synthase gene encode the 102nd amino acids,
The codon of 106th amino acids and the 381st amino acids is mutated to obtain, so that the 102nd amino acids residue is by Soviet Union's ammonia
Acid mutation is mutated into serine, the 381st amino acids residue by dried meat by proline at isoleucine, the 106th amino acids residue
Histidine mutations obtain rice EPSP synthase mutant gene OsmEPSPS1 at leucine；By rice EPSP synthase mutant gene
OsmEPSPS1, which is transferred to the genetically modified crops obtained after receptor, has preferable glyphosate resistance, to screening and cultivates resistance glyphosate
New Crop Varieties are of great significance.
Detailed description of the invention
Fig. 1 is the sequencing result of epsp synthase mutated gene OsmEPSPS1 of the present invention.
The over-express vector pmEPSPS1-pmEPSPS4 that Fig. 2 is OsmEPSPS1-OsmEPSPS4 of the present invention constructs schematic diagram.
Fig. 3 is the PCR identification of the target gene of transgenic paddy rice of the present invention；
Wherein, M is DNA marker；P is plasmid；CK is non-transgenic paddy DNA；1-20 is transgenic paddy rice DNA.
Fig. 4 is separation situation of the T1 for transgene cotton that the present invention sprays 20mM glyphosate.Arrow meaning single plant is point
Separate out the glyphosate sensitive plant come.
Specific embodiment
The invention will be further described combined with specific embodiments below, and what is be exemplified below is only specific implementation of the invention
Example, but protection scope of the present invention is not limited only to this.
Molecular biology used in following embodiment and biochemical method are known technology, and are compiled in Ausubel
Write by John Wiley and Sons company publish Current Protocols in Molecular Biology and
J.Sambrook etc. write by the Molecular published by Cold Spring Harbor Laboratory Press (2001)
The documents such as Cloning:A Laboratory Mannual, 3rd ED. are described in detail.It is tested used in following embodiment
Material is commercially available products unless otherwise specified.
1 artificial mutation rice EPSP synthase gene of embodiment
Step 1: the clone of rice leaf Total RNAs extraction and wild type OsEPSPS1 gene
The B of rice varieties Qianjiang 6 takes 3-4 leaf phase seedling leaves 50mg, pulverizes rapidly in liquid nitrogen after germinateing
End is added 750 μ l NucleoZOL (NEB) and mixes, then adds 300 μ l DEPC-H2O and acutely concussion mix；Room temperature is put
It is centrifuged 10min after setting 15min, 500 μ l supernatants are transferred to new centrifuge tube；Isometric isopropanol is added；It is placed at room temperature for
It is centrifuged 10min after 10min, removes supernatant；The alcohol washes of 1ml75% are added；Centrifugation is added 20 after going supernatant, room temperature slightly to dry
μlDEPC-H2O dissolves RNA.
1 μ g RNA is taken, with 3 end reverse primer EPSP-R3 (5 '-of EPSPS gene
CAGTGGTACCTCAGTTCCTGACGAAAGTGC-3 ' SEQ ID NO.4) it is primer, cDNA is synthesized using M-MLV reverse transcriptase
First chain.Reverse transcription reaction program are as follows: 37 DEG C, 60min；99℃,5min.
Then with 5 end forward primer EPSPS-R5 (5 '-AAGGCGGAGGAGATCGTGCTC-3 ' of OsEPSPS1 gene；
SEQ ID NO.5) and EPSPS-R3 be primer, utilize high fidelity enzyme Phanta Max (Vazyme) amplification obtain OsEPSPS1
(sequence is shown in SEQ ID NO.3) gene.
PCR reaction condition is as follows:
PCR reacted constituent:
Response parameter: 95 DEG C, 3 points；95 DEG C, 10 seconds, 56 DEG C, 15 seconds, 72 DEG C, 2 points, 40 circulations；72 DEG C extend 5 points
Clock.
PCR product recycles respective segments and utilizes gel purification kit after purification, recycle after agarose gel electrophoresis
Clontech'sAbove-mentioned 2 kinds of DNA fragmentations are cloned into pMD20-T carrier by HD Cloning Kit, then digestion
Identify simultaneously sequence verification (PE company, 377 sequenators；Shanghai Sangon Biological Engineering Technology And Service Co., Ltd), correct plasmid
Name into pMD-EPSPS1.
Step 2: artificial mutation rice Os EPSPS1 gene obtains OsmEPSPS1-OsmEPSPS4, and constructs plant expression
Carrier
Firstly, synthesizing following primer:
P1:AAGGCGGAGGAGATCGTGCTC(SEQ ID NO.5)
(sequence contains the 102nd and 106 amino acid to P2:CAATGATCGCATTGCAATTCCAGCATTCCCCAAGAAGAG
The base of mutation) (SEQ ID NO.6)；
P3:CTCTTCTTGGGGAATGCTGGAATTGCAATGCGATCATTG (complementary series that the sequence is P2) (SEQ
ID NO.7)
(it is prominent that the sequence contains the 381st amino acid to P4:GGTGATGATGCAGTAGTCCAGTCCTTCCTCGACCGACGCTC
The base of change) (SEQ ID NO.8)；
P5:GAGCGTCGGTCGAGGAAGGACTGGACTACTGCATCATCACC (complementary series that the sequence is P4)
(SEQ ID NO.9)；
P6:CAGTGGTACCTCAGTTCCTGACGAAAGTGC (restriction enzyme site containing KpnI) (SEQ ID NO.4).
3 pairs of primer (i.e. primers are used respectively using pMD-EPSPS1 as template using high fidelity enzyme Phanta Max (Vazyme)
P1 and P2, P3 and P4, P5 and P6) amplification three segments of acquisition, recycling Overlap extension PCR (An Y., Ji J,
Wu W,Lv A,Huang R,Wei Y.A rapid and efficient method for multiple-site
mutagenesis with a modified overlap extension PCR.Appl Microbiol
Biotechnol.2005,68:774-778) technology by these three segment compositions at a segment, i.e. OsmEPSPS1.
It is confirmed through sequencing, the 102nd amino acid residue of the segment becomes I, the 106th amino acid residue from T and sported by P
S, the 381st amino acid residue is mutated into L (Fig. 1) by P.On the basis of OsmEPSPS1 tri- dashes forward gene, continue with
Overlap extension PCR obtains three double prominent genes, is that (the 102nd amino acid residue is by T by OsmEPSPS2 respectively
Become I, the 106th amino acid residue and S sported from P), (the 102nd amino acid residue becomes I, the 381st from T to OsmEPSPS3
A amino acid residue is mutated into L by P) and OsmEPSPS4 (the 106th amino acid residue sports S, the 381st amino by P
Sour residue is mutated into L by P).
Then, following primer is synthesized:
Upstream primer:
P7:CAGTCTAGACCATGGCGTCCAACGCCGCG (restriction enzyme site containing XbaI) (SEQ ID NO.10)；
Downstream primer:
P8:ACGATCTCCTCCGCCTTCGCCGCCGGCGCTGCCAC (SEQ ID NO.11)；
It clones the signal peptide sequence (signal peptide, SP) of epsp synthase gene: using primer P7 and P8 from long-grained nonglutinous rice
The total PCR amplification of the 1 B gene group of Qianjiang 6 obtains SP.SP segment is merged with OsmEPSPS1-OsmEPSPS4 respectively again, is finally obtained
Obtain the mEPSPS1-mEPSPS4 genetic fragment containing SP.
Finally, with XbaI and KpnI double digestion mEPSPS1-mEPSPS4 genetic fragment, and be inserted into through XbaI and KpnI enzyme
1300-Actin::NOS overexpression binary vector (Wang Y, Zhang X, Lu S, Wang M, Wang L, the Wang W, et cut
al.Inhibition of a basal transcription factor 3-like gene Osj10gBTF3in rice
results in significant plant miniaturization and typical pollen
Abortion.Plant and Cell Physiology.2012,53:2073-2089) or double T-DNA overexpression vector
In pSB326-Actin-NOS, digestion identification, correct carrier name into respectively pmEPSPS1, pmEPSPS2, pmEPSPS3 and
PmEPSPS4 (Fig. 2).
Finally, above-mentioned 4 kinds of Agrobacterium plasmids are transferred to EHA105 using electrotransformation, it to be used for subsequent genetic transformation test.
The cultivation of 2 high-resistance glyphosate transgenic paddy rice of embodiment
Step 1: the genetic transformation of transgenic paddy rice
Rice transformation is with reference to (Pan G, Zhang X, Liu K, et al.2006, M ap-based such as Pan
cloning of a novel rice cytochrome P450gene CYP81A6that confers resistance to
Two different classes of herbicides.Plant Molecular Biology, 61:933-943) method
And make to change.
Be summarized as follows: the OryzasativaLcv.Nipponbare seed after disinfection is inoculated into L containing 2.5mg-1The N of 2,4-D6Culture medium, in 32 DEG C of companies
Continuous illumination condition callus induction 10 days；The EHA105 agriculture for taking about 40 μ L to contain pEPSP1, pEPSP2, pEPSP3 or pEPSP4 plasmid
L containing 25mg is added in bacillus bacterium solution-1Rif and 50mg L-1In the 20mL LB liquid medium of Kan, after 28 DEG C of overnight shake cultures
Thalline were collected by centrifugation, with 10mM MgSO4By resuspended bacterium solution and it is centrifuged；The AA fluid nutrient medium containing 200 μM of AS is used after removing supernatant
It is resuspended, adjusts bacterium solution OD600It is worth to 0.1~0.2；10 days callus will be induced to infect 10min in bacterium solution；It will after infecting
Callus, which is transferred in sterilizing filter paper, blots extra bacterium solution；Callus is transferred to CC-AS again to co-culture on base, 28 DEG C of 55~60h of dark culture
After be transferred to L containing 250mg-1The N of Cef6Culture medium；Callus is gone into L containing 250mg after 28 DEG C of dark culture 7d-1Cef and 50mg L- 1The N of Hyg6Continue screening and culturing on culture medium and obtains kanamycin-resistant callus tissue；Kanamycin-resistant callus tissue is cultivated through regeneration and obtains transgenic seedlings simultaneously
It plants in field, T2 is for seed for selfing harvest.
Step 2: the Molecular Identification of transgenic paddy rice
T2 is planted for transgenic paddy rice in crop field, routinely liquid manure is managed.Paddy growth to the 3-4 leaf phase takes children
Leaf, CTAB method extract genomic DNA, utilize a pair of of special primer (forward primer: 5 '-CTTCGTCAGGCTTAGATGTG-3 '
SEQ ID NO.12), reverse primer: 5 '-CAACAACTACCGCTCTTTTG-3 ' SEQ ID NO.13) carry out external source
The identification of OsmEPSPS1-OsmEPSPS4 gene PCR.The results show that foreign gene has been integrated into rice genome (Fig. 3).
In addition, taking transgenic paddy rice and its control of growth 7 days, total serum IgE is extracted using NucleoZOL (NEB).Using
Q RT Supermix for qPCR kit (Vazyme, USA) carries out reverse transcription and obtains the first chain cDNA.Then utilize
FastStart Essential DNA Green Master (Roche, USA) kit,
96Instrument fluorescent quantitation instrument carry out q RT-PCR amplification and1.1 software of 96SW is analyzed.
Each sample technology is in triplicate.
QRT-PCR system: 32 μ L, Master mix of μ L, primers of PCR grade water, 10 5 μ L of μ L, cDNA
(20 μ L of total system).QRT-PCR program: 95 DEG C of preincubate 10min；45 amplification cycles: 95 DEG C of denaturation l0s, 60 DEG C of annealing
L0s, 72 DEG C of extension 20s；It melts: 95 DEG C of 10s, 65 DEG C of 60s, 97 DEG C of 1s.
QRT-PCR technology confirms that all transgenic paddy rices overexpress exomutation gene.Then select turning for 4 kinds of plasmids
Target gene gene expression dose is almost the same in progeny, and expression quantity is the strain of 80 times or so of control for subsequent
Field glyphosate resistance.
The glyphosate resistance of 3 transgenic paddy rice of embodiment
Selection foreign gene height expresses and expresses consistent transgenic progeny (3 different conversion things of each carrier selection
Part) it plants in crop field, 220mM glyphosate solution is sprayed after rice seedling field growing 30 days, and rice survival is counted after 3 weeks
Rate.
(table 1) as the result is shown, the offspring's survival rate for turning pmEPSPS1 are up to 88.01% or more, and pmEPSPS2,
The offspring's survival rate of pmEPSPS3 and pmEPSPS4 is respectively lower than 75.47%, 37.21% and 12.11%, t-test analysis shows
The offspring for turning pmEPSPS1 and the glyphosate survival rate difference for turning pmEPSPS2 are at least up to the level of signifiance or more, and turn
The offspring of pmEPSPS1 reaches extremely significant with the glyphosate survival rate difference for turning pmEPSPS3 and pmEPSPS4.
In short, the resistance of OsmEPSP1 gene pairs glyphosate is most strong.
Table 1 sprays 220mM glyphosate 3 weeks different transgenic paddy rice survival rates
Note: " -1, -2 or -3 " refer to different transformation events.
The cultivation of 4 resistance glyphosate transgene cotton of embodiment
Step 1: the building of carrier
According to the sequence of SEQ ID NO.1, being respectively synthesized two primers, (primer sequence entrusts extra large Sani's biotechnology limited
Company's synthesis), go out the OsmEPSP1 gene containing SP through PCR amplification using plasmid pmEPSPS1 as template, primer sequence is as follows:
Upstream primer: 5 '-CACGGGGGACTCTAGAACAATGAACATGAACAACACTAAG-3 ' (SEQ ID NO:
14)；
Downstream primer: 5 '-CGGGGGATCCTCTAGTCACTCCTTAACAAGGGAAAC-3 ' (SEQ ID NO:15)；
PCR reaction system are as follows:
PCR response parameter: 95 DEG C, 3 points；95 DEG C, 10 seconds, 56 DEG C, 15 seconds, 72 DEG C, 2 points, 40 circulations；72 DEG C extend 5
Minute.
PCR product is after PCR product Purification Kit, with XbaI enzyme cutting binary T-DNA vectors pLM-B001 (Lu
L,Dong C,Liu R,Zhou B,Wang C,Shou H.Roles of soybeanplasmamembraneintrinsicp
roteinGmPIP2；9in droughttolerance and seeddevelopment.Front Plant Sci.2018,9:
530), with Clontech'sThe segment is cloned into pLM-B001 by HD Cloning Kit, is reflected with XbaI enzyme cutting
Fixed, (PE company, 377 sequenators are sequenced in the positive colony of acquisition again；Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) it tests
Card, is sequenced correct plasmid and is named as pLM-mEPSPS1.
Step 2: Agrobacterium preparation and Cotton Transformation
Plasmid pLM-mEPSPS1 is imported into Agrobacterium LBA4404 by electrization.Take the Agrobacterium containing pLM-mEPSPS1
Plate is drawn, single colonie is chosen and is incubated overnight at 28 DEG C of LB culture medium, prepares Agrobacterium bacterium solution for Cotton Transformation.Cotton transgenic operates such as
Under:
1) hypocotyl for choosing 312 aseptic seedling of Upland Cotton Ke word, is cut into 0.5-0.6cm segment with scalpel, is inoculated with
In (MS+B in induced medium5Vitamins+0.1mg/L 2,4-D+0.1mg/L KT+30g/L glucose+phytagel
2.5g/L, pH=5.8) evoked callus；
2) callus is in subculture medium (MS (containing 2 × KNO3,1/2NH4NO3)+B5Vitamins+
0.1mg/L 2,4-D+0.1mg/L KT+30g/L glucose+phytagel 2.5g/L, pH=5.8) subculture, then select
Rice-shaped Granulous callus is transferred to differential medium (MS+B5Vitamins+30g/L glucose+2.5g/L phytagel+
0.15mg/L KT+0.5mg/L IBA) it is trained embryoid；
3) glycerol tube that the agrobacterium strains saved are taken out in ultra low temperature freezer is melted on ice, the flat lining out of LB,
After 26.5 DEG C of dark culture 36-48hr, picking single colonie in other LB plate streaking and in 26.5 DEG C of dark culture 36-48hr, to
Grown on plate in the MGL fluid nutrient medium scraped surface colony after enough bacterium colonies in triangular flask, 27 DEG C, 200r/min after
Continuous culture 2hr to OD600=0.5-1.5；
4) callus of embryoid is dried up naturally in sterile petri dish and is transferred in above-mentioned Agrobacterium bacterium solution after five minutes,
Standing outwells bacterium solution after infecting 5-10 minutes, blots remaining bacterium solution with filter paper, callus is laid on to the co-cultivation for being lined with filter paper
In culture medium, 19-21 DEG C of dark culture 38-42hr；
5) callus after co-cultivation is cleaned 2-3 times in the sterile water of the Cef containing 500mg/L, each 10-
20min is then used sterile water wash three times again, and filter paper blots excessive moisture；
6) it is transferred on Selective agar medium, normal illumination culture 30- on Selective agar medium is transferred to after low light culture 20 days or so
It is 40 days (period replace culture medium 2-3 time), smaller and grow normal callus to grow pale yellow coloured particles in black death callus
Afterwards by its squamous subculture 20-30 days (period replaces culture medium 1-2 times)；
7) kanamycin-resistant callus tissue grown from Selective agar medium be inoculated on pre- differential medium (first dark culture 5-7 days, then
The differentiation of illumination in 16 hours germination) 4-6 weeks, it is transferred on root media and takes root after resistance seedling grows up to, finally plant regeneration
Strain is washed away culture and is cultivated based on greenhouse or field, until harvest T1 seed；
By T1 for seed kind in crop field, with special primer (forward primer: 5 '-CTTCGTCAGGCTTAGATGTG-3 ' SEQ
ID NO.12), reverse primer: 5 '-CAACAACTACCGCTCTTTTG-3 ' SEQ ID NO.13) it identifies in transgenic progeny
Target gene, then spraying transgene cotton with 20mM resistance glyphosate confirms transgene cotton resistance glyphosate (Fig. 4).
Claims (9)
1. a kind of rice EPSP synthase mutant gene, which is characterized in that nucleotide sequence is as shown in SEQ ID NO.1.
2. rice EPSP synthase mutant described in claim 1, which is characterized in that amino acid sequence such as SEQ ID NO.2
It is shown.
3. a kind of recombinant expression carrier, the target gene including initial carrier and the insertion initial carrier, which is characterized in that institute
The nucleotide sequence of target gene is stated as shown in SEQ ID NO.1.
4. recombinant expression carrier as claimed in claim 3, which is characterized in that the initial carrier be pCAMBIA1300 or
pSB326-Actin-NOS。
5. a kind of transformant comprising any one of claim 3 or 4 recombinant expression carrier.
6. transformant as claimed in claim 5, which is characterized in that host strain is Agrobacterium.
7. as claim 6 transformant, which is characterized in that the Agrobacterium be Agrobacterium EHA105.
8. rice EPSP synthase mutant gene as described in claim 1 is in the glyphosate resistance for improving genetically modified plants
Using.
9. application as claimed in claim 8, which is characterized in that the plant is rice or cotton.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910216002.7A CN109943578A (en) | 2019-03-21 | 2019-03-21 | A kind of rice EPSP synthase mutant gene, mutant and its application |
| CN202010174117.7A CN111154787B (en) | 2019-03-21 | 2020-03-13 | Rice EPSP synthetase mutant gene, mutant and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910216002.7A CN109943578A (en) | 2019-03-21 | 2019-03-21 | A kind of rice EPSP synthase mutant gene, mutant and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109943578A true CN109943578A (en) | 2019-06-28 |
Family
ID=67010457
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910216002.7A Pending CN109943578A (en) | 2019-03-21 | 2019-03-21 | A kind of rice EPSP synthase mutant gene, mutant and its application |
| CN202010174117.7A Active CN111154787B (en) | 2019-03-21 | 2020-03-13 | Rice EPSP synthetase mutant gene, mutant and application thereof |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010174117.7A Active CN111154787B (en) | 2019-03-21 | 2020-03-13 | Rice EPSP synthetase mutant gene, mutant and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN109943578A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592039A (en) * | 2019-08-30 | 2019-12-20 | 浙江新安化工集团股份有限公司 | Application of hybridoma cell and monoclonal antibody generated by hybridoma cell in detection of AM79 EPSPS protein |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112899392B (en) * | 2021-03-10 | 2022-05-13 | 浙江大学 | Primer group for specific identification molecular marker of transgenic insect-resistant and glyphosate-resistant cotton and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012148275A1 (en) * | 2011-04-29 | 2012-11-01 | Keygene N.V. | Glyphosate resistance enhancement |
| CN106467909A (en) * | 2015-08-14 | 2017-03-01 | 中国科学院遗传与发育生物学研究所 | A kind of method that acquisition glyphosate-resistant rice is replaced by nucleotide fixed point |
| CN106636025A (en) * | 2016-12-28 | 2017-05-10 | 四川天豫兴禾生物科技有限公司 | Rice EPSPS mutant and encoding gene and application thereof |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100404670C (en) * | 2005-01-26 | 2008-07-23 | 中国科学院遗传与发育生物学研究所 | Rice EPSP synthase mutant and its coding gene, obtaining method and application |
| EP2449108A1 (en) * | 2009-07-01 | 2012-05-09 | Bayer BioScience N.V. | Methods and means for obtaining plants with enhanced glyphosate tolerance |
| CN102766609B (en) * | 2012-06-14 | 2013-10-23 | 重庆市农业科学院 | Glyphosate resistant EPSP synthetase GmEPSPS, and coding gene and application thereof |
| CN105063068A (en) * | 2015-07-17 | 2015-11-18 | 河南省农业科学院 | Encoding mutation EPSPS (5-enolpyruvyl-shikimate-3-phosphate synthase) gene, and expression vector, expression product and application of encoding mutation EPSPS gene |
| CA3023994C (en) * | 2016-05-17 | 2022-05-31 | Gevoto Llc | Glyphosate-resistant gene screening method, epsps mutant gene and deficient strain and use |
| CN109182291B (en) * | 2017-11-02 | 2020-02-14 | 四川天豫兴禾生物科技有限公司 | Plant EPSPS mutant containing K85 mutation and encoding gene and application thereof |
-
2019
- 2019-03-21 CN CN201910216002.7A patent/CN109943578A/en active Pending
-
2020
- 2020-03-13 CN CN202010174117.7A patent/CN111154787B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012148275A1 (en) * | 2011-04-29 | 2012-11-01 | Keygene N.V. | Glyphosate resistance enhancement |
| CN106467909A (en) * | 2015-08-14 | 2017-03-01 | 中国科学院遗传与发育生物学研究所 | A kind of method that acquisition glyphosate-resistant rice is replaced by nucleotide fixed point |
| CN106636025A (en) * | 2016-12-28 | 2017-05-10 | 四川天豫兴禾生物科技有限公司 | Rice EPSPS mutant and encoding gene and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| QIN YU等: "Evolution of a Double Amino Acid Substitution in the 5-Enolpyruvylshikimate-3-Phosphate Synthase in Eleusine indica Conferring High-Level Glyphosate Resistance", 《PLANT PHYSIOLOGY》 * |
| SCOTT R. BAERSON等: "Glyphosate-Resistant Goosegrass. Identification of a Mutation in the Target Enzyme 5-Enolpyruvylshikimate-3-Phosphate Synthase", 《PLANT PHYSIOLOGY》 * |
| XM_015787560: "PREDICTED: Oryza sativa Japonica Group 3-phosphoshikimate 1-carboxyvinyltransferase 2 (LOC4340026), mRNA", 《GENBANK数据库》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592039A (en) * | 2019-08-30 | 2019-12-20 | 浙江新安化工集团股份有限公司 | Application of hybridoma cell and monoclonal antibody generated by hybridoma cell in detection of AM79 EPSPS protein |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111154787A (en) | 2020-05-15 |
| CN111154787B (en) | 2020-10-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108103092B (en) | System for modifying OsHPH gene by using CRISPR-Cas system to obtain dwarf rice and application thereof | |
| CN110904071B (en) | Application of RAF49 protein and encoding gene thereof in regulation and control of plant drought resistance | |
| CN111635892B (en) | Glutamine synthetase mutant with glufosinate-ammonium resistance and application thereof | |
| CA3048731C (en) | Rice epsps mutant, encoding gene and use thereof | |
| US20200263193A1 (en) | Plant epsp synthases and methods of use | |
| CN109943578A (en) | A kind of rice EPSP synthase mutant gene, mutant and its application | |
| CN101812462B (en) | Application of rice GT transcription factor family gene OsGT gamma-1 in controlling salt tolerance of rice | |
| CN106318958A (en) | Fusion gene of compound antibody type with glyphosate and glufosinate, encoded protein and application thereof | |
| CN109180791B (en) | Gene related to plant drought tolerance, and coding protein and application thereof | |
| CN110699374B (en) | Cultivation method of glyphosate-resistant rape | |
| CN110881367A (en) | Corn event Ttrans-4 and methods of use thereof | |
| CN112626111A (en) | Herbicide resistance gene expression vector and application thereof | |
| CN102373217A (en) | Paddy DREBs (dehydration-responsive element binding) transcription factor and application thereof | |
| CN112813064A (en) | Method for creating endogenous herbicide-resistant rice with high and stable resistance | |
| CN103898078B (en) | The heat-resisting gene TOG1 of paddy rice and application thereof | |
| CN111386035A (en) | Plant promoters for transgene expression | |
| CN113136398B (en) | GsHA24 protein and application of related biological material thereof in regulation and control of stress tolerance of plants | |
| CN110759978A (en) | Mutant PSII D1 or psbA D1 protein, nucleic acid encoding same and application thereof | |
| CN112322633B (en) | Rice root-knot nematode resistance gene OsBetvI and application thereof | |
| CN109486840A (en) | The NmeCas9 gene of codon vegetalization transformation and its application | |
| CN112143744B (en) | Application of OsPLDdelta 3 gene in controlling drought resistance of rice | |
| CN112094857B (en) | Rape EPSPS gene containing three mutation sites and cloning method and application thereof | |
| CN116789780B (en) | Chloroplast transit peptide for glyphosate-resistant herbicide gene and application thereof | |
| CN116789785B (en) | High-yield and high-light-efficiency gene FarL a of long stamen wild rice and application thereof | |
| CN110760524B (en) | Specific DNA fragment com58276 and application thereof in regulating and controlling plant stress resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190628 |
|
| WD01 | Invention patent application deemed withdrawn after publication |