CN109943512B - Escherichia coli genetic engineering bacterium for producing protocatechuic acid and construction method and application thereof - Google Patents

Abstract

The method discloses an escherichia coli genetic engineering bacterium for producing protocatechuic acid and a construction method and application thereof. Which can produce protocatechuic acid by expressing 3-dehydroshikimate dehydratase (aroZ) in Escherichia coli producing 3-dehydroshikimate. The strain can utilize a glucose inorganic salt culture medium to ferment and produce protocatechuic acid, the culture medium cost is reduced, and therefore the production cost of protocatechuic acid is reduced.

Description

Escherichia coli genetic engineering bacterium for producing protocatechuic acid and construction method and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a protocatechuic acid recombinant escherichia coli genetic engineering bacterium, and a construction method and application thereof.

Background

Protocatechuic acid (PCA) has partial effects of resisting bacteria, relieving asthma, eliminating phlegm, removing snake venom, etc., and has astringent and wound healing promoting effects. Can be clinically used for treating chronic tracheitis, burn, infantile pneumonia, bacillary dysentery, acute pyelonephritis, acute pancreatitis and certain ulcer. It is also applied to the fields of medicine, organic intermediate, material and dye synthesis, feed, food, environmental protection and the like. PCA can be formed in one step by the action of 3-dehydroshikimate dehydratase (aroZ) derived from Klebsiella pneumoniae (Klebsiella pneumoniae) on 3-dehydroshikimic acid (DHS) (FIG. 1), which is also an important precursor of a series of important Chemical products such as Catechol (Catechol), gallic acid (Gallate), adipic acid (Adipate) (Li K, front JW.Synthesis of vanillin free glucose. journal of the American Chemical Society,1998,120: 10545-containing 10546; Draths KM, intake JW.environmental reactive composition of the family of chemicals of the family of organic Chemical products of the family of reactions D-glucose. journal of the American Chemical Society, 1995: 95-friendly K, journal of the family of Chemical industries, 400. D-25. of the family of the Chemical industries of the family of the plants of the family of reactions of the family of the plants, see FIG. 400). The protocatechuic acid is synthesized by using 3-dehydroshikimic acid (DHS), so that the use of toxic raw materials such as benzene and toluene can be avoided, and the influence on human bodies and the environment is reduced.

Pugh et al screened mutant aroF of aroF gene by site-directed mutagenesis using Escherichia coli NST74 as starting strain^FBRThe tyrosine feedback inhibition of the 3-deoxy-D-arabinoheptulose-7-phosphate (DAHP) synthetase encoded by the gene is eliminated. The competitive pathway pheA gene of chorismic acid is knocked out, the mutant strain is named E.coli NST74, and the finally obtained E.coli engineering bacterium E.coli NST74/pUbic-PobA can be fermented for 72h by taking glucose as a raw material under an appropriate IPTG addition strategy, and 442mg/L of PCA (found pure, Rebekah McKenna, Marwan Osman, et al.

Li and others screen mutant aroF of aroF gene by ultraviolet mutagenesis by using aroE gene mutant strain Escherichia coli AB2834 as starting strain^FBRThe tyrosine feedback inhibition of 3-deoxy-D-arabinoheptulose-7-phosphate (DAHP) synthetase encoded by the gene is relieved, a mutant strain is named as E.coli AB2.24, and simultaneously a serA gene is carried on a plasmid pKL4.130B, so that the strain can still maintain the stability of the plasmid under the condition of not adding chloramphenicol, and the plasmid also carries tktA and aroF^FBRA gene. The finally obtained Escherichia coli engineering bacterium E.coli KL3/pWL2.46B can be fermented for 48h by taking glucose as a raw material under a proper IPTG extraction agent adding strategy, and 41g/L of PCA is accumulated in a supernatant, which is a cell factory (Wensheng Li, Dongming Xie, and J.W.Frost, et al. Benzene-Free Synthesis of Catechol: Interfacing Microbial and Chemical Catalysis.J.Am.Chem.Soc.,2005,127(9):2874–2882)。

Although the engineered escherichia coli strain constructed by the research can produce high-concentration protocatechuic acid, the related engineered strain contains recombinant plasmids to cause genetic instability, and aromatic amino acid or PCA extractant is required to be added into a culture medium to promote cell growth, so that the industrial application of the product is influenced.

Disclosure of Invention

In view of the above, the present invention aims to provide a recombinant escherichia coli for producing protocatechuic acid, a construction method of the strain and applications thereof.

First, the present invention provides a protocatechuic acid-producing Escherichia coli (Escherichia coli) recombinant strain MA03, which realizes expression of 3-dehydrogenase shikimate dehydratase (aroZ) by introducing a 3-dehydrogenase shikimate dehydratase (aroZ) gene into an original strain.

Preferably, the 3-dehydrogenase shikimate dehydratase (aroZ) gene is introduced in that a P1-aroZ gene fragment with the regulatory element P1 and/or a P2-aroZ gene fragment with the regulatory element P2 and/or a P3-aroZ gene fragment with the regulatory element P3 and/or a P4-aroZ gene fragment with the regulatory element P4 are integrated in the starting strain.

Preferably, the 3-dehydrogenase shikimate dehydratase (aroZ) gene is introduced as a P4-aroZ gene fragment with the regulatory element P4 is integrated in the starting strain.

Preferably, the nucleotide sequence of the 3-dehydrogenase shikimate dehydratase (aroZ) gene is SEQ NO 9.

Preferably, the starting strain is a recombinant Escherichia coli producing 3-dehydroshikimic acid (DHS) or a strain that can be transformed to produce 3-dehydroshikimic acid (DHS);

more preferably, the starting strain is 3-dehydroshikimic acid (DHS) -producing strains WJ004, WJ006, WJ012, WJ038, WJ048, WJ 060;

further preferably, the starting strain is a strain WJ060 producing 3-dehydroshikimic acid (DHS), and the preservation number of the strain WJ060 is CGMCC No. 14602.

Secondly, the invention provides a method for constructing a protocatechuic acid-producing escherichia coli recombinant strain MA03, which comprises the following steps:

3-dehydroshikimate dehydratase (aroZ) gene was introduced into recombinant E.coli producing 3-Dehydroshikimate (DHS) by homologous recombination.

Preferably, the 3-dehydrogenase shikimate dehydratase (aroZ) gene is introduced in such a way that a P1-aroZ gene fragment with the regulatory element P1 and/or a P2-aroZ gene fragment with the regulatory element P2 and/or a P3-aroZ gene fragment with the regulatory element P3 and/or a P4-aroZ gene fragment with the regulatory element P4 are integrated;

preferably, the 3-dehydrogenase shikimate dehydratase (aroZ) gene is introduced as a P4-aroZ gene fragment with the regulatory element P4 integrated.

Preferably, the recombinant strain producing 3-dehydroshikimic acid (DHS) is WJ004, WJ006, WJ012, WJ038, WJ048, WJ 060;

preferably, the recombinant strain producing 3-dehydroshikimic acid (DHS) is WJ 060.

Thirdly, the invention provides an Escherichia coli (Escherichia coli) recombinant strain MA03-50 with high protocatechuic acid yield, and the preservation number is CGMCC No. 14834. The strain is obtained by taking MA03 as an original strain and directionally domesticating and screening in a protocatechuic acid-containing culture medium.

Preferably, the screening is obtained by directional domestication screening in a culture medium containing 5.5g/L protocatechuic acid.

Fourth, the present invention provides the use of the above recombinant strain MA03 or MA03-50 for the production of protocatechuic acid.

Fifth, the present invention provides a method for producing protocatechuic acid by fermentation using the above recombinant strain MA03 or MA 03-50.

The fermentation temperature is 25-42 ℃, or 25 ℃, or 30 ℃, or 37 ℃, or 40 ℃ or 42 ℃;

the pH value of the fermentation system is 6.0-8.0 or 6.0 or 7.0 or 8.0;

the fermentation time is 24 hours to 96 hours or 24 hours or 36 hours or 48 hours or 60 hours or 72 hours or 84 hours or 96 hours;

the volume percentage of the fermentation inoculation amount is 0.05-15%, or 0.05%, or 2%, or 5%, or 10%, or 15%;

the medium for the fermentation has a number of components:

macroelements: glucose, yeast extract, citric acid, KH₂PO₄、(NH₄)₂SO₄、MgSO₄·7H₂O；

Trace elements: FeSO₄·7H₂O、MnSO₄·H₂O、Na₂SO₄、ZnSO₄、CoCl₂·6H₂O

CuSO₄·5H₂O；

The concentrations of the components in the fermentation medium are respectively as follows:

macroelements: starting glucose at 20g/L-50g/L or 20g/L or 30g/L or 40g/L or 50g/L (after fermentation is started, when the glucose concentration in a fermentation tank is reduced to be below 1g/L, feeding with a glucose solution at a concentration of 500g/L-600g/L is started, and the feeding speed is controlled so that the glucose concentration in the fermentation tank is less than 1g/L), yeast extract at 0-2g/L or 0g/L or 0.5g/L or 1g/L or 2g/L, citric acid at 1g/L-5g/L or 2g/L or 3g/L or 5g/L, KH₂PO₄2.5g/L-10g/L, 2.5g/L, 5g/L, 7.5g/L, 10g/L, (NH)₄)₂SO₄0.8g/L-2.4g/L or 0.8g/L or 1.2g/L or 1.6g/L or 2.0g/L or 2.4g/L, MgSO₄·7H₂O1g/L-4g/L or 1g/L or 2g/L or 3g/L or 4 g/L;

trace elements: FeSO₄·7H₂O50 mg/L-100mg/L or 50mg/L or 75mg/L or 100mg/L, MnSO₄·H₂O2.5 mg/L-7.5mg/L or 2.5mg/L or 5mg/L or 7.5mg/L, Na₂SO₄10mg/L-50mg/L or 10mg/L or 20mg/L or 30mg/L or 40mg/L or 50mg/L, ZnSO₄2mg/L-10mg/L or 2mg/L or 4mg/L or 6mg/L or 8mg/L or 10mg/L, CoCl₂·6H₂O1 mg/L-6mg/L or 1mg/L or 2mg/L or 4mg/L or 6mg/L, CuSO₄·5H₂O is 0.2mg/L-1mg/L or 0.2mg/L or 0.4mg/L or 0.6mg/L or 0.8mg/L or 1 mg/L;

the invention provides an escherichia coli recombinant strain for producing protocatechuic acid: the recombinant strain MA03 and the recombinant domesticated strain MA03-50 can both utilize a glucose inorganic salt culture medium to ferment protocatechuic acid under aerobic conditions, so that the cost of the culture medium is reduced, and the production cost of the protocatechuic acid is reduced. Wherein the MA03-50 has the ability of resisting high concentration protocatechuic acid, thereby having the ability of industrialized fermentation production. And the recombinant strains do not contain plasmids and have stable heredity.

Drawings

FIG. 1 shows the biosynthetic pathway of 3-dehydroshikimic acid in E.coli (Glucose: Glucose; E4P: erythrose-4-phosphate; PEP: phosphoenolpyruvate; PYR: pyruvate; DAHP: 3-deoxy-D-arabinoheptulose-7-phosphate; DHS: 3-dehydroshikimic acid; Shikimate: shikimic acid; Tyrosine: Tyrosine; Phenylaline: phenylalanine; Tryptophan: Tryptophan; PykAF: pyruvate kinase; TktA: transketolase; GalP: galactose MFS transporter; Glk: glucokinase; PtsI: enzyme I of phosphoenolpyruvate-sugar phosphotransferase; Pgi: Glucose-6-phosphate isomerase; AroF: 3-deoxy-D-arabinoheptulosynthetase-7-phosphate; AroE: 3-dehydroshikimic acid dehydrogenase; AroZ: 3-dehydroshikimic acid dehydratase).

FIG. 2 is plasmid pEASY-cat-sacB containing chloramphenicol resistance gene cat and levan sucrose transferase gene sacB;

FIG. 3 is a plasmid pEASY-aroF containing 3-deoxy-D-arabinoheptulose 7-phosphate synthase gene aroF (or pEASY-aroF wherein the base C at position 443 of the aroF gene is changed to T)

FIG. 4 is the plasmid pET28a-aroZ containing 3-dehydroshikimate dehydratase (aroZ)

FIG. 5 is a growth curve of MA03 with different concentrations of PCA added

FIG. 6 shows acclimatization screening with 5.5g/LPCA addition

FIG. 7 shows the yield of protocatechuic acid produced by shaking flask fermentation of Escherichia coli of different domesticated genes

FIG. 8 shows the production of protocatechuic acid by fed-batch fermentation in 5L fermentor containing domesticated strain MA03-50

Detailed Description

The technical solutions in the embodiments of the present invention are clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified, and materials, reagents and the like used therein are commercially available from commercial routes unless otherwise specified.

Example 1 construction of Escherichia coli genetically engineered bacterium WJ004

The Escherichia coli genetic engineering bacterium WJ004 is obtained by performing attenuation expression regulation construction on a 3-dehydrogenase shikimate dehydrogenase gene (aroE), a synthetic regulation element P1 (shown as SEQ ID NO:1) is inserted into the upstream of an aroE initiation codon by adopting a two-step homologous recombination method, and the original initiation codon ATG is replaced by a rare initiation codon TTG. The specific construction steps are as follows:

the fragment aroE1 of the first step of homologous recombination was amplified using the primer aroE1-up/aroE1-down using plasmid pEASY-cat-sacB (FIG. 2) containing chloramphenicol resistance gene cat and levan sucrose transferase gene sacB (cat-sacB cassette, shown in SEQ ID NO:7) as a template. The primer sequence is as follows:

aroE1-up：GATGCCCTGACGGGTGAACTGTTTCGACAGGGGTAACATAG TGACGGAAGATCACTTC

aroE1-down：CTGTGGGCTATCGGATTACCAAAAACAGCATAGGTTTCCAATCAAAGGGAAAACTGTCC

an amplification system: 5 × TransStart^TMFastPfu Buffer 10. mu. L, dNTPs (2.5mmol/L of dNTP each) 4. mu. L, DNA template 1. mu.L (20-50ng), forward primer (10. mu. mol/L) 2. mu.L, reverse primer (10. mu. mol/L) 2. mu.L, 100% DMSO 1. mu. L, TransStart^TMFastPfu DNA Polymerase (2.5U/. mu.L) 1. mu.L, deionized water 29. mu.L, total volume 50. mu.L.

The amplification conditions were: pre-denaturation at 94 ℃ for 5 min (1 cycle); denaturation at 95 ℃ for 20 seconds, annealing at 55 ℃ for 30 seconds, and extension at 72 ℃ for 3 minutes (30 cycles); extension at 72 ℃ for 5 min (1 cycle). The amplified aroE1 product contained the cat-sacB cassette (FIG. 2) and 40 bases upstream of the aroE start codon and 40 bases from the aroE start codon at both ends, respectively.

The obtained aroE1 amplification product is introduced into Escherichia coli DSM 1576 containing pKD46 and then subjected to homologous recombination to insert the cat-sacB cassette in front of the aroE start codon (Bacillus coli DSM 1576 and pKD46 publicly available from the institute of Biotechnology in Tianjin Industrial, Chinese academy of sciences, GUnsalus IC is a non-patent document describing Escherichia coli DSM 1576, and Gunsalus IC is a non-patent document describing Bacillus in the chemical determination of total vimin C.Jbiolchem 1941,141:853-858, and Datsenko KA is a non-patent document describing pKD46 plasmid, Wanner BL.one-step actuation of chromosomal genes in Escherichia coli K-12using PCR products.

The pKD46 plasmid was transformed into E.coli DSM 1576 by calcium chloride transformation.

The aroE1 fragment was electroporated into E.coli DSM 1576 containing pKD 46. The electrotransfer conditions were: first, an electrotransformation competent cell of E.coli DSM 1576 containing pKD46 was prepared; 50 μ L of competent cells were placed on ice, 50-100ng of aroE1 fragment was added, placed on ice for 2 min, and transferred to a 0.2em Bio-Rad electric rotor. A MicroPulser (Bio-Rad) electroporator was used, and the voltage was 2.5kv as the electric shock parameter. After electric shock, 1mL of LB liquid medium was quickly transferred to an electric cuvette, mixed about 5 times with a pipette, transferred to a 15mL test tube, and incubated for 2 hours in a shaker at 30 ℃ and 100 rpm. And (3) coating 200 mu L of the incubated bacterial liquid on an LB solid culture medium containing chloramphenicol and ampicillin, culturing at 30 ℃ until a single colony which is visible to naked eyes grows out, and selecting 5-10 single colonies for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

2-aroE-1-up：TTCAGAAATCCGCGATGCCCTGA

2-aroE-T-down：CAGTTGCATACCATTCACGAGAG

an appropriate single colony was selected and designated E.coli aroE1 (containing pKD46) as the starting bacterium for the next round of homologous recombination.

The fragment aroE2 of the second homologous recombination was amplified using the primer aroE-P1-s/aroE-P1T-a with the artificially synthesized DNA of regulatory element P1 (SEQ ID NO:1) as template. The primer sequence is as follows:

aroE-P1-s：GATGCCCTGACGGGTGAACTGTTTCGACAGGGGTAACATAT TATCTCTGGCGGTGTTG

aroE-P1T-a：CTGTGGGCTATCGGATTACCAAAAACAGCATAGGTTTCCA TAGCTGTTTCCTGGTTTAAAC

an amplification system: 5 × TransStart^TMFastPfu Buffer 10. mu. L, dNTPs (2.5mmol/L of dNTP each) 4. mu. L, DNA template 1. mu.L (20-50ng), forward primer (10. mu. mol/L) 2. mu.L, reverse primer (10. mu. mol/L) 2. mu.L, 100% DMSO 1. mu. L, TransStart^TMFastPfu DNA Polymerase (2.5U/. mu.L) 1. mu.L, deionized water 29. mu.L, total volume 50. mu.L.

Amplification conditions were 94 ℃ pre-denaturation for 5 min (1 cycle); denaturation at 95 ℃ for 20 seconds, annealing at 55 ℃ for 30 seconds, and extension at 72 ℃ for 30 seconds (30 cycles); extension at 72 ℃ for 5 min (1 cycle). The amplified aroE2 product contained synthetic regulatory element P1 and 40 bases upstream of the aroE start codon and 40 bases beginning with the aroE start codon at both ends, respectively. The obtained aroE2 amplification product was introduced into E.coli aroE1 and subjected to a second step of homologous recombination to synthesize the regulatory element P1 in front of the aroE start codon and to replace A of the start codon with T.

The second homologous recombination step is the electrotransformation of the aroE2 fragment to E.coli aroE 1. The electrotransfer conditions were: firstly, preparing an electric transformation competent cell of escherichia coli aroE 1; 50 μ L of competent cells were placed on ice, 50-100ng of aroE2 fragment was added, placed on ice for 2 min, and transferred to a 0.2em Bio-Rad electric rotor. A MicroPulser (Bio-Rad) electroporator was used with a shock parameter of 2.5 kv. After the electric shock, 1mL of LB liquid medium was immediately transferred to an electric cuvette, mixed 5 times or so with a pipette, transferred to a 15mL test tube, and incubated in a shaker at 37 ℃ and 200rpm for 2 hours to remove the pKD46 plasmid.

Transferring 300. mu.L of the incubated bacterial liquid into 30mL of LB liquid culture medium containing 10% sucrose and no sodium chloride at 37 ℃, culturing overnight at 250rpm, then streaking on an LB plate containing 10% sucrose and no sodium chloride, and culturing at 37 ℃ to grow colonies. And selecting about 10-20 single colonies for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

w-promoter-s：TTATCTCTGGCGGTGTTG

2-aroE-T-down：CAGTTGCATACCATTCACGAGAG

a correct single colony is selected and named as escherichia coli WJ004 to be used for 3-dehydroshikimic acid production test or spawn running bacteria constructed in the next round of strains.

Example 2 construction of Escherichia coli genetically engineered bacterium WJ006

The engineered Escherichia coli WJ006 is obtained by mutating 3-deoxy-D-arabinoheptulose 7-phosphate synthase gene (aroF) and constructing expression regulation based on Escherichia coli WJ004, replacing original aroF gene (such as SEQ ID NO:6) with mutant gene aroF (such as SEQ ID NO:5) of which the 443 th base C is changed into T to relieve tyrosine feedback inhibition of 3-deoxy-D-arabinoheptulose 7-phosphate synthase encoded by the gene by adopting a two-step homologous recombination method, and inserting a synthetic regulatory element P2 (such as SEQ ID NO:2) upstream of an initiation codon. The specific construction steps are as follows:

the aroF gene was amplified using the primers aroF-F/aroF-R using E.coli DSM 1576 genomic DNA as template. The primer sequence is as follows:

aroF-F：ATGCAAAAAGACGCGCTGAA

aroF-R：TTAAGCCACGCGAGCCGTCAG

the amplification system was the same as in example 1, to obtain a recombinant plasmid pEASY-aroF (FIG. 3). Then using pEASY-aroF as a template, and using a primer aroF-Fm/aroF-Rm for reverse amplification, wherein the sequence of the primer is as follows:

aroF-Fm：GGCGACGGAAGCGTTAGATCTGAATAGCCCGCAATACCT GGG

aroF-Rm：AGTGGCAGTCCCATATTCACCAGCTCAAGC

the amplification system was the same as in example 1, and the DNA fragments obtained by reverse amplification were self-ligated to form the recombinant plasmid pEASY-aroF. The aroF gene on the plasmid is obtained by using overlap extension PCR to obtain aroF containing point mutation sequence^FBRThe gene replaces the original aroF gene with the base C at position 443 changed to T.

Plasmid pEASY-cat-sacB (shown in figure 2) containing chloramphenicol resistance gene cat and levan sucrose transferase gene sacB (cat-sacB box, see sequence 7 in the sequence table) is used as a template, and a fragment aroF1 of the first step of homologous recombination is amplified by using a primer aroF1-up/aroF 1-down. The primer sequence is as follows:

aroF1-up：GGATCAACTATCGCAAACGAGCATAAACAGGATCGCCATCG TGACGGAAGATCACTTC

aroF1-down：ATCGCGTAATGCGGTCAATTCAGCAACCATAATAAACCTCATCAAAGGGAAAACTGTCC

the amplification system was as in example 1, and the amplified aroF1 product contained the cat-sacB cassette (FIG. 2) and 40 bases upstream of the aroF start codon and 40 bases downstream of the aroF stop codon at both ends. The obtained aroF1 amplified product is introduced into Escherichia coli WJ004 containing pKD46 and then homologous recombination is carried out, so that the aroF gene fragment is replaced by a cat-sacB box.

The pKD46 plasmid was transformed into E.coli WJ004 by calcium chloride transformation.

The electrotransformation method is the same as example 1, and the single colony is cultured at 30 ℃ until the single colony which is visible to naked eyes grows out, 5-10 single colonies are picked for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

aroF-1-up：TATCGTTACGTCATCCTCGCTG

aroF-T-down：CATAAATAGGCAGTCCAAAGCGGC

an appropriate single colony was selected and designated E.coli aroF1 (containing pKD46) as the starting bacterium for the next round of homologous recombination.

The pEASY-aroF plasmid DNA constructed above was used as a template to amplify the second homologous recombination fragment aroF 2using the primer aroF2-up/aroF 2-down. The primer sequence is as follows:

aroF2-up：

GGATCAACTATCGCAAACGAGCATAAACAGGATCGCCATCATGCAAAAAGACGCGCTGAAT AAC

aroF2-down：ATCGCGTAATGCGGTCAATTCAGCAACCATAATAAACCTCTTAAGCCACGCGAGCCGTCAGC

the amplification system was the same as that of example 1, and the amplified aroF2 product contained aroF (see sequence 5 in the sequence listing) and 40 bases upstream of the aroF start codon and 40 bases downstream of the aroF stop codon at both ends. The obtained aroF2 amplified product was introduced into E.coli aroF1 and then subjected to a second homologous recombination to replace the original aroF with aroF.

The second homologous recombination step is the electrotransformation of the aroF2 fragment to E.coli aroF 1. The electrotransformation method is the same as example 1, after colonies grow out, streaking culture is carried out on corresponding dot plates on chloramphenicol plates and ampicillin plates, about 10-20 single colonies which only grow on the ampicillin plates but not on the chloramphenicol plates are picked for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

aroF-1-up：TATCGTTACGTCATCCTCGCTG

aroF-T-down：CATAAATAGGCAGTCCAAAGCGGC

a single correct colony was selected and designated E.coli aroF2 (containing pKD46) as the next development strain with synthetic regulatory element P2 inserted before the aroF start codon.

The fragment aroF1 of the first step of homologous recombination was amplified using the primer aroF1-up/aroF3-down using plasmid pEASY-cat-sacB (FIG. 2) containing chloramphenicol resistance gene cat and levan sucrose transferase gene sacB (cat-sacB cassette, shown in SEQ ID NO:7) as a template. The primer sequence is as follows:

aroF1-up：GGATCAACTATCGCAAACGAGCATAAACAGGATCGCCATCG TGACGGAAGATCACTTC

aroF3-down：CGTCGGTAATATGTACGTTATTCAGCGCGTCTTTTTGCATATCAAAGGGAAAACTGTCC

the amplification system was as in example 1, and the amplified aroF3 product contained the cat-sacB cassette (FIG. 2) and 40 bases upstream of the aroF start codon and 40 bases from the aroF start codon at both ends. The obtained aroF3 amplification product was introduced into E.coli aroF2 and subjected to homologous recombination to insert the cat-sacB cassette before the aroF start codon. The aroF3 fragment was electroporated into E.coli aroF 2. The electrotransformation method is the same as example 1, 200. mu.L of the incubated bacterial liquid is coated on LB solid culture medium containing chloramphenicol and ampicillin, the culture is carried out at 30 ℃ until single colonies which are visible to naked eyes grow out, 5-10 single colonies are selected for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

aroF-1-up：TATCGTTACGTCATCCTCGCTG

aroF-T-down：CATAAATAGGCAGTCCAAAGCGGC

an appropriate single colony was selected and designated E.coli aroF3 (containing pKD46) as the starting bacterium for the next round of homologous recombination.

The fragment aroE2 of the second homologous recombination was amplified using the primer aroF-P1-s/aroF-P1T-a with the artificially synthesized DNA of regulatory element P2 (SEQ ID NO:2) as template. The primer sequence is as follows:

aroF-P2-up：GGATCAACTATCGCAAACGAGCATAAACAGGATCGCCATCTTATCTCTGGCGGTGTTGAC

aroF-P2-down：CGTCGGTAATATGTACGTTATTCAGCGCGTCTTTTTGCATAGCTGTTTCCTGGTTTAAAC

the amplification system was the same as in example 1, and the obtained aroF4 amplification product was introduced into E.coli aroF3 and then subjected to a second homologous recombination to synthesize the regulatory element P2 in front of the aroF start codon.

The second homologous recombination step is the electrotransformation of the aroF4 fragment to E.coli aroF 3. The electrotransformation method is the same as example 1, 300. mu.L of the incubated bacterial liquid is transferred to 30mL LB liquid medium containing 10% sucrose and no sodium chloride and cultured at 37 ℃ and 250rpm overnight, and then the bacterial colony is streaked on LB plate containing 10% sucrose and no sodium chloride and cultured at 37 ℃. About 10-20 single colonies are picked for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

w-promoter-s：TTATCTCTGGCGGTGTTG

aroF-T-down：CATAAATAGGCAGTCCAAAGCGGC

a correct single colony is selected and named as Escherichia coli WJ006 to be used for 3-dehydroshikimic acid production test or spawn of the next round of strain construction.

Example 3 construction of Escherichia coli genetically engineered bacterium WJ012

The Escherichia coli genetic engineering bacterium WJ012 is obtained by expression regulation and construction of a transketolase gene (tktA) on the basis of Escherichia coli WJ006, and is obtained by inserting a synthetic regulatory element P4 (shown as SEQ ID NO:4) at the upstream of an initiation codon of tktA by a method of two-time homologous recombination. The specific construction steps are as follows:

plasmid pEASY-cat-sacB (FIG. 2) containing chloramphenicol resistance gene cat and levan sucrose transferase gene sacB (cat-sacB box, see sequence 7 in the sequence table) was used as a template to amplify the fragment tktA1 of the first step of homologous recombination using primers tktA1-up/tktA 1-down. The primer sequence is as follows:

tktA1-up：GCCCAAAACGCGCTGTCGTCAAGTCGTTAAGGGCGTGCCCTTCATCATGTGACGGAAGATCACTTC

tktA1-down：CATGCTCAGCGCACGAATAGCATTGGCAAGCTCTTTACGTGAGGACATATCAAAGGGAAAACTGTCC

the amplification system was the same as in example 1, and the amplified tktA1 product contained the cat-sacB cassette (FIG. 2) and 40 bases upstream of the tktA start codon and 40 bases from the tktA start codon at both ends. The resulting amplification product, tktA1, was introduced into pKD 46-containing E.coli WJ006 and subjected to homologous recombination to effect insertion of the cat-sacB cassette before the tktA start codon. Most preferably, pKD46 plasmid is transformed into E.coli WJ006 by calcium chloride transformation, and then the tktA1 fragment is electrically transformed into E.coli WJ006 containing pKD 46. The electrotransformation method is the same as example 1, 200. mu.L of the incubated bacterial liquid is coated on LB solid culture medium containing chloramphenicol and ampicillin, the culture is carried out at 30 ℃ until obvious single colonies are grown out, 5-10 single colonies are selected for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

tktA-1-up：ACATGCGAGCATGATCCAG

tktA-T-down：CGCAAACGGACATATCAAG

a single correct colony was selected and designated E.coli tktA1 (containing pKD46) as the initiating strain for the next round of homologous recombination.

The fragment tktA2 of the second homologous recombination was amplified using the primer tktttttttttA-P4-up/tktA-P4-down, using the artificially synthesized DNA of regulatory element P4 (as shown in SEQ ID NO:4) as a template. The primer sequence is as follows:

tktA-P4-up：GCCCAAAAC-GCGCTGTCGTCAAGTCGTTAAGGGCGTGCCCTTCATCATTTATCTCTGGCGGTGTTG

tktA-P4-down：CATGCTCAGCGCACGAATAGCATTGGCAAGCTCTTTACGTGAG- GACATAGCTGTTTCCTGGTTTAA

the amplification system was the same as in example 1, and the amplified tktA2 product contained synthetic regulatory element P4 and 40 bases at both ends, upstream of the tktA start codon by 40 bases and beginning of the tktA start codon, respectively. The obtained amplification product of tktA2 was introduced into escherichia coli aroE1 and subjected to a second homologous recombination to synthesize the regulatory element P4 in front of the tktA start codon.

The second homologous recombination step was to electroporate the tktA2 fragment to E.coli aroE 1. The electrotransformation method is the same as example 1, 300. mu.L of the incubated bacterial liquid is transferred to 30mL LB liquid medium containing 10% sucrose and no sodium chloride and cultured at 37 ℃ and 250rpm overnight, and then the bacterial colony is streaked on LB plate containing 10% sucrose and no sodium chloride and cultured at 37 ℃. About 10-20 single colonies are picked for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

w-promoter-s：TTATCTCTGGCGGTGTTG

tktA-T-down：CGCAAACGGACATATCAAG

a correct single colony is selected and named as Escherichia coli WJ012 and is used for 3-dehydroshikimic acid production test or spawn of the next round of strain construction.

Example 4 construction of Escherichia coli Gene engineering bacterium WJ038

The engineered Escherichia coli WJ038 is constructed by performing combined expression regulation on a galactose MFS transporter gene (galP) related to glucose transfer and a glucokinase gene (glk) on the basis of Escherichia coli WJ012, and performing traceless knockout on an enzyme I gene (ptsI) of phosphoenolpyruvate sugar phosphotransferase (PTS system) by inserting a synthetic regulatory element P1 (such as SEQ ID NO:1) upstream of a galP start codon, inserting a synthetic regulatory element P4 (such as SEQ ID NO:4) upstream of a glk start codon and performing traceless knockout on ptsI by a homologous recombination method. The specific construction steps are as follows:

plasmid pEASY-cat-sacB (FIG. 2) containing chloramphenicol resistance gene cat and levan sucrose transferase gene sacB (cat-sacB cassette, as shown in SEQ ID NO:7) was used as a template to amplify the first step homologous recombination fragment tktA1 using the primers galP1-up/galP 1-down. The primer sequence is as follows:

galP1-up：GTACTCACCTATCTTAATTCACAATAAAAAATAACCATAT GTGACGGAAGATCACTTC

galP1-down：TTGCCTTGTTTGACCGCCCCTGTTTTTTAGCGTCAGGCATATCAAAGGGAAAACTGTCC

the amplification system was the same as in example 1, and the amplified galP1 product contained the cat-sacB cassette (FIG. 2) and 40 bases upstream of the galP start codon and 40 bases from the galP start codon at both ends. The resulting galP1 amplification product was introduced into pKD 46-containing E.coli WJ012 and subjected to homologous recombination to insert the cat-sacB cassette before the galP start codon. The pKD46 plasmid was first transformed into E.coli WJ012 by calcium chloride transformation, and the galP1 fragment was then electroporated into E.coli WJ012 containing pKD 46. The electrotransformation method is the same as example 1, 200. mu.L of the incubated bacterial liquid is coated on LB solid culture medium containing chloramphenicol and ampicillin, the culture is carried out at 30 ℃ until obvious single colonies are grown out, 5-10 single colonies are selected for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

galp-1-up：CGTCGTACTCACCTATCT

galp-T-down：CCCCACATTTGCTCGGTA

a single correct colony was selected and designated E.coli galP1 (containing pKD46) as the starting bacterium for the next round of homologous recombination.

The fragment galP2 of the second step of homologous recombination was amplified using the primer galP-P1-up/galP-P1-down with the artificially synthesized DNA of regulatory element P1 (SEQ ID NO:1) as template. The primer sequence is as follows:

galP-P1-up：GTACTCACCTATCTTAATTCACAATAAAAAATAACCATATTTATCTCTGGCGGTGTTG

galP-P1-down：TTGCCTTGTTTGACCGCCCCTGTTTTTTAGCGTCAGGCATAGCTGTTTCCTGGTTTAA

the amplification system was the same as in example 1, and the amplified galP2 product contained synthetic regulatory element P1 and 40 bases upstream of the galP initiation codon and 40 bases beginning with the galP initiation codon at each end. The amplification product galP2 was introduced into E.coli galP1 and subjected to a second homologous recombination step to synthesize the regulatory element P1 in front of the galP start codon.

The second homologous recombination step is to electrically transfer the galP2 fragment to E.coli galP 1. The electrotransformation method is the same as example 1, 300. mu.L of the incubated bacterial liquid is transferred to 30mL LB liquid medium containing 10% sucrose and no sodium chloride, and cultured overnight at 30 ℃ and 250rpm, and then streaked on LB plate containing 10% sucrose and no sodium chloride, and colonies are grown at 30 ℃. About 10-20 single colonies are picked for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

w-promoter-s：TTATCTCTGGCGGTGTTG

galp-T-down：CCCCACATTTGCTCGGTA

a single correct colony was selected and designated E.coli galP2 (containing pKD46) as the starter for the next glk modification.

Plasmid pEASY-cat-sacB (FIG. 2) containing chloramphenicol resistance gene cat and levan sucrose transferase gene sacB (cat-sacB cassette, as shown in SEQ ID NO:7) was used as a template to amplify the first step homologous recombination fragment tktA1 using primers glk1-up/glk 1-down. The primer sequence is as follows:

glk1-up：CCCAGGTATTTACAGTGTGAGAAAGAATTATTTTGACTTT GTGACGGAAGATCACTTC

glk1-down：TGGTGCCGCCCACATCACCGACTAATGCATACTTTGTCATATCAAAGGGAAAACTGTCC

the amplification system was the same as in example 1, and the amplified glk1 product contained the cat-sacB cassette (FIG. 2) and 40 bases upstream of the glk initiation codon and 40 bases beginning with the glk initiation codon at each end. The obtained amplification product of glk1 was introduced into E.coli galP2 for homologous recombination to insert the cat-sacB cassette before the glk initiation codon. The glk1 fragment was electroporated into E.coli galP 2. The electrotransformation method is the same as example 1, 200. mu.L of the incubated bacterial liquid is coated on LB solid culture medium containing chloramphenicol and ampicillin, the culture is carried out at 30 ℃ until single colonies which are visible to the naked eye grow out, 5-10 single colonies are selected for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

glk-1-up：ATTTACAGGGAGCCTGCC

glk-T-down：AGATTGAGCGCCAGATTG

a single correct colony was selected and designated E.coli glk1 (containing pKD46) as the starting bacterium for the next round of homologous recombination.

The fragment glk2 of the second homologous recombination step was amplified using primer glk-P4-up/glk-P4-down with the artificially synthesized DNA of regulatory element P4 (SEQ ID NO:4) as template. The primer sequence is as follows:

glk-P4-up：CCCAGGTATTTACAGTGTGAGAAAGAATTATTTTGACTTT TTATCTCTGGCGGTGTTG

glk-P4-down：TGGTGCCGCCCACATCACCGACTAATGCATACTTTGTCATAGCTGTTTCCTGGTTTAA

the amplification system was the same as in example 1, and the amplified glk2 product contained synthetic regulatory element P4 and 40 bases upstream of the glk initiation codon and 40 bases beginning with the glk initiation codon. The obtained amplification product of glk2 was introduced into E.coli glk1 and then subjected to a second homologous recombination to synthesize the regulatory element P4 in front of the glk initiation codon.

The second homologous recombination step is to electrically transfer the glk2 fragment to E.coli glk 1. The electrotransformation method is the same as example 1, 300. mu.L of the incubated bacterial liquid is transferred to 30mL LB liquid medium containing 10% sucrose and no sodium chloride for 30 ℃, and cultured overnight at 250rpm, and then the bacterial colony is obtained by drawing a line on an LB plate containing 10% sucrose and no sodium chloride for culture at 30 ℃. About 10-20 single colonies are picked for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

w-promoter-s：TTATCTCTGGCGGTGTTG

glk-T-down：AGATTGAGCGCCAGATTG

a single correct colony was picked and designated E.coli glk2 (containing pKD46) as the next traceless knockout ptsI-producing strain.

Plasmid pEASY-cat-sacB (FIG. 2) containing chloramphenicol resistance gene cat and levan sucrose transferase gene sacB (cat-sacB cassette, as shown in SEQ ID NO:7) was used as a template to amplify the fragment tktA1 of the first step of homologous recombination using primers ptsI1-up/ptsI 1-down. The primer sequence is as follows:

ptsI1-up：CCGGGTTCTTTTAAAAATCAGTCACAAGTAAGGTAGGGTT GTGACGGAAGATCACTTC

ptsI1-down：GATCTTCTCCTAAGCAGTAAATTGGGCCGCATCTCGTGGAATCAAAGGGAAAACTGTCC

the amplification system was the same as in example 1, and the amplified ptsI1 product contained the cat-sacB cassette (FIG. 2) and 40 bases upstream of the ptsI start codon and 40 bases downstream of the ptsI stop codon at both ends. The obtained ptsI1 amplification product is introduced into Escherichia coli glk2 for homologous recombination, so that the cat-sacB box is used for replacing the ptsI gene. The ptsI1 fragment was electroporated into E.coli glk 2. The electrotransformation method is the same as example 1, 200. mu.L of the incubated bacterial liquid is coated on LB solid culture medium containing chloramphenicol and ampicillin, the culture is carried out at 30 ℃ until single colonies which are visible to the naked eye grow out, 5-10 single colonies are selected for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

ptsI-1-up：AGCGGTTGAACATCTGGT

ptsI-T-down：CTTGTCGTCGGAAACCAG

an appropriate single colony was selected and designated E.coli ptsI1 (containing pKD46) as the starting bacterium for the next round of homologous recombination.

The artificially synthesized DNA fragment ptsI2 (as shown in SEQ ID NO:8) was used as a fragment for the second homologous recombination. The second homologous recombination step was to electroporate the ptsI2 fragment into E.coli ptsI 1. The electrotransformation method is the same as example 1, 300. mu.L of the incubated bacterial liquid is transferred to 30mL LB liquid medium containing 10% sucrose and no sodium chloride and cultured at 37 ℃ and 250rpm overnight, and then the bacterial colony is streaked on LB plate containing 10% sucrose and no sodium chloride and cultured at 37 ℃. About 10-20 single colonies are picked for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

ptsI-F：TGGCATTGATTCAGCCTG

ptsI-R：TCACTGCGGCAAGAATTA

a correct single colony is selected and named as Escherichia coli WJ038 for 3-dehydroshikimic acid production test or spawn of the next round of strain construction.

Example 5 construction of Escherichia coli Gene engineering bacterium WJ048

The escherichia coli genetic engineering bacterium WJ048 is obtained by performing attenuation expression regulation and construction on a pyruvate kinase gene (pykA) on the basis of escherichia coli WJ038, and is obtained by inserting a synthetic regulatory element P1 (such as SEQ ID NO:1) at the upstream of a pykA start codon by a two-time homologous recombination method and replacing an original start codon ATG with a rare start codon TTG. the specific construction steps are as follows:

plasmid pEASY-cat-sacB (FIG. 2) containing chloramphenicol resistance gene cat and levan sucrose transferase gene sacB (cat-sacB cassette, as shown in SEQ ID NO:7) is used as a template, and a fragment pykA1 of the first step of homologous recombination is amplified by using primers pykA1-up/pykA 1-down. The primer sequence is as follows:

pykA1-up：CATTCGGATTTCATGTTCAAGCAACACCTGGTTGTTTCAG GTGACGGAAGATCACTTC

pykA1-down：AACGTGGTAACGATTTTTGTTCTGCGAAGCCTTCTGGACAATCAAAGGGAAAACTGTCC

the amplification system was as in example 1, and the amplified pykA1 product contained the cat-sacB cassette (FIG. 2) and 40 bases upstream of the pykA start codon and 40 bases beginning with the pykA start codon, respectively, at both ends. The obtained amplification product pykA1 is introduced into Escherichia coli WJ038 containing pKD46 and then subjected to homologous recombination, so that a cat-sacB box is inserted before the pykA initiation codon. The pKD46 plasmid was first transformed into E.coli WJ038 by calcium chloride transformation, and the aroE1 fragment was then electroporated into the E.coli WJ038 harboring pKD 46. The electrotransformation method is the same as example 1, 200. mu.L of the incubated bacterial liquid is coated on LB solid culture medium containing chloramphenicol and ampicillin, the culture is carried out at 30 ℃ until single colonies which are visible to the naked eye grow out, 5-10 single colonies are selected for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

pykA-1-up：ACCAGGTGTTGCTTGAACATG

pykA-T-down：ATGTGGCGTTTTCGCCGCATC

a single correct colony was selected and designated E.coli pykA1 (containing pKD46) as the starting bacterium for the next round of homologous recombination.

The second homologous recombination fragment aroE2 was amplified using the primer pykA-P1-s/pykA-P1T-a with the artificially synthesized regulatory element P1 (SEQ ID NO:1) DNA as template. The primer sequence is as follows:

pykA-P1-s：CATTCGGATTTCATGTTCAAGCAACACCTGGTTGTTTCAG TTATCTCTGGCGGTGTTG

pykA-P1T-a：AACGTGGTAACGATTTTTGTTCTGCGAAGCCTTCTGGACATAGCTGTTTCCTGGTTTAAAC

the amplification system was as in example 1, and the amplified product of pykA2 contained the synthetic regulatory element P1 and 40 bases upstream of the pykA start codon and 40 bases beginning with the pykA start codon, respectively, at both ends. The obtained pykA2 amplification product is introduced into E.coli pykA1 and subjected to a second step of homologous recombination to achieve the synthesis of the regulatory element P1 in front of the pykA start codon and the replacement of the A of the start codon by T.

The second homologous recombination step is the electrotransformation of the pykA2 fragment to E.coli pykA 1. The electrotransformation method is the same as example 1, 300. mu.L of the incubated bacterial liquid is transferred to 30mL LB liquid medium containing 10% sucrose and no sodium chloride for overnight culture at 37 ℃ and 250rpm, and then the bacterial colony is streaked on LB plate containing 10% sucrose and no sodium chloride for culture at 37 ℃. About 10-20 single colonies are picked for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

w-promoter-s：TTATCTCTGGCGGTGTTG

pykA-T-down：ATGTGGCGTTTTCGCCGCATC

a correct single colony is selected and named as Escherichia coli WJ048 and is used for 3-dehydroshikimic acid production test or a spawn of the next round of strain construction.

Example 6 construction of Escherichia coli genetically engineered bacterium WJ060

The Escherichia coli genetically engineered bacterium WJ060 is obtained by performing attenuation expression regulation and construction on a phosphoglucose isomerase gene (pgi) on the basis of Escherichia coli WJ048, a synthetic regulatory element P1 (shown as SEQ ID NO:1) is inserted into the upstream of a pgi initiation codon by a two-time homologous recombination method, and the original initiation codon ATG is replaced by a rare initiation codon TTG. The specific construction steps are as follows:

plasmid pEASY-cat-sacB (FIG. 2) containing chloramphenicol resistance gene cat and levan sucrose transferase gene sacB (cat-sacB cassette, as shown in SEQ ID NO:7) is used as a template, and a fragment pgi1 of the first step of homologous recombination is amplified by using primers pgi1-up/pgi 1-down. The primer sequence is as follows:

pgi1-up：ACTGGCGCTACAATCTTCCAAAGTCACAATTCTCAAAATC GTGACGGAAGATCACTTC

pgi1-down：GCCTGCCAGGCAGCGGTCTGCGTTGGATTGATGTTTTTCAATCAAAGGGAAAACTGTCC

the amplification system was as in example 1, and the amplified pgi1 product contained the cat-sacB cassette (FIG. 2) and 40 bases upstream of the pgi start codon and 40 bases from the beginning of the pgi start codon, respectively, at both ends. The resulting amplification product, pgi1, was introduced into pKD 46-containing E.coli WJ048 and subjected to homologous recombination to insert the cat-sacB cassette before the pgi start codon. The pKD46 plasmid was first transformed into E.coli WJ048 by calcium chloride transformation and then the pgi1 fragment was electroporated into E.coli WJ048 containing pKD 46. The electrotransformation method is the same as example 1, 200. mu.L of the incubated bacterial liquid is coated on LB solid culture medium containing chloramphenicol and ampicillin, the culture is carried out at 30 ℃ until single colonies which are visible to the naked eye grow out, 5-10 single colonies are selected for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

pgi-1-up：CGCTACAATCTTCCAAAGTCAC

pgi-T-down：CGGCATCAGGCATGAACGATG

an appropriate single colony was selected and designated as E.coli pgi1 (containing pKD46) as the starting bacterium for the next round of homologous recombination.

The fragment pgi2 of the second homologous recombination step was amplified using the primer pgi-P1-s/pgi-P1T-a with the artificially synthesized DNA of regulatory element P1 (SEQ ID NO:1) as template. The primer sequence is as follows:

pgi-P1-s：ACTGGCGC-TAC-AATCTTCCAAAGTCACAATTCTCAAAATCTTATCTCTGGCGGTGTTG

pgi-P1T-a：GCCTGCCAGGCAGCGGTCTGCGTT-GGATTGATGTTTTTCATAGCTGTTTCCTGGTTTAAAC

the amplification product was as in example 1, the amplified pgi2 product comprising the synthetic regulatory element P1 and 40 bases upstream of the pgi start codon and 40 bases from the pgi start codon, respectively. The resulting amplification product pgi2 was introduced into E.coli pgi1 and subjected to a second homologous recombination, which resulted in the synthesis of the regulatory element P1 in front of the pgi start codon and the replacement of the A of the start codon by T.

The second homologous recombination step is the electrotransformation of the pgi2 fragment to E.coli pgi 1. The electrotransformation method is the same as example 1, 300. mu.L of the incubated bacterial liquid is transferred to 30mL LB liquid medium containing 10% sucrose and no sodium chloride and cultured at 37 ℃ and 250rpm overnight, and then the bacterial colony is obtained by drawing a line on an LB plate containing 10% sucrose and no sodium chloride and culturing at 37 ℃. About 10-20 single colonies are picked for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

w-promoter-s：TTATCTCTGGCGGTGTTG

pgi-T-down：CGGCATCAGGCATGAACGATG

a correct single colony was picked and designated E.coli WJ060 for 3-dehydroshikimic acid production testing.

The genetically engineered Escherichia coli WJ060 has been preserved in the general microorganism center of China Committee for culture Collection of microorganisms (CGMCC for short, the address: institute 3, Microbiol research institute 100101, Japan academy of sciences, Beijing, Kogyo-No. 1, Beijing) within 6 months and 10 days 2015, and the preservation number is CGMCC No. 10976.

Example 7 construction of Escherichia coli genetically engineered bacterium MA03

The Escherichia coli genetic engineering bacterium MA03 is obtained by inserting synthetic regulatory element P4-aroZ (shown as SEQ ID NO: 10) into upstream and downstream stop codons TAA of an initiation codon ATG of a lactate dehydrogenase gene ldhA on the basis of Escherichia coli WJ060 by a method of homologous recombination twice. The specific construction steps are as follows:

the fragment ldhA1 of the first step of homologous recombination was amplified using primers ldhA-up/ldhA-down using plasmid pEASY-cat-sacB (FIG. 2) containing chloramphenicol resistance gene cat and levan sucrose transferase gene sacB (cat-sacB cassette, shown in SEQ ID NO:7) as templates. The primer sequence is as follows:

ldhA-up：TAAAATATTTTTAGTAGCTTAAATGTGATTCAACATCACT GTGACGGAAGATCACTTC

ldhA-down：ATCTGAATCAGCTCCCCTGGAATGCAGGGGAGCGGCAAGAATCAAAGGGAAAACTGTCC

the amplification system was as in example 1, and the ldhA1 product after amplification contained the cat-sacB cassette (FIG. 2) and 40 bases upstream of the ldhA start codon and 40 bases after the ldhA stop codon at both ends. The thus-obtained amplification product ldhA1 was introduced into E.coli WJ060 containing pKD46 and subjected to homologous recombination to insert the cat-sacB cassette into ldhA. The electrotransformation method is the same as example 1, 200. mu.L of the incubated bacterial liquid is coated on LB solid culture medium containing chloramphenicol and ampicillin, the culture is carried out at 30 ℃ until single colonies which are visible to the naked eye grow out, 5-10 single colonies are selected for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

ldhA-1-up：CGCCTACACTAAGCATAG

ldhA-T-down：GGCTACTTTCTTCATTGTG

a single correct colony was selected and designated E.coli ldhA-sacB (containing pKD46) as the starting bacterium for the next round of homologous recombination.

Fragment A was amplified using an artificially synthesized regulatory element P4 (shown in SEQ ID NO:4) DNA as a template and a primer ldhA-P4-s/ldhA-P1T-a. A homologous recombination fragment C was amplified using the synthetic plasmid pET28a-aroZ (shown in SEQ ID NO: 9) DNA as a template, primers aroZ-s and ldhA-P4-s for fragment B, and primers ldhA-P4-s and ldhA-P4-s for fragment A and B, and the sequence of the primers:

ldhA-P4-s：TAAAATATTTTTAGTAGCTTAAATGTGATTCAACATCACT TTATCTCTGGCGGTGTTG

ldhA-P4T-a：GGCGATAGAGCGCAGCATTTAGTCAAACTTAACTTGC

aroZ-s：ATGCTGCGCTCTATCGCC

aroZ-a：ATCTGAATCAGCTCCCCTGGAATGCAGGGGAGCGGCAAGA CTAACAATACTGCATCGC

the amplification system was as in example 1, and fragments A and B were obtained after amplification, respectively.

A second round of PCR was performed using A and B as templates, and the amplification system was the same as in example 1,

after amplification, fragment C was obtained as a second homologous recombination fragment ldhA2, and electrically transferred to E.coli ldhA-sacB. The electrotransformation method is the same as example 1, 300. mu.L of the incubated bacterial liquid is transferred to 30mL LB liquid medium containing 10% sucrose and no sodium chloride and cultured at 37 ℃ and 250rpm overnight, and then the bacterial colony is streaked on LB plate containing 10% sucrose and no sodium chloride and cultured at 37 ℃. About 10-20 single colonies are picked for colony PCR amplification and DNA sequencing verification. The PCR amplification and DNA sequencing primers are as follows:

w-promoter-s：TTATCTCTGGCGGTGTTG

aroZ-T-down：CTAACAATACTGCATCGC

a single correct colony was picked and designated E.coli MA03 for protocatechuic acid production testing.

Example 8 determination of PCA addition concentration by domestication screening of genetically engineered Escherichia coli MA03

The shake flask fermentation medium is an NBS medium and consists of the following components:

glucose 20g/L, KH₂PO₄3.5g/L，K₂HPO₄·3H₂O6.5g/L，(NH₄)₂HPO₄3.5g/L，MgSO₄0.120g/L， CaCl₂ 11mg/L，Thiamine HCl 5mg/L，FeCl₃·6H₂O 0.16mg/L，CoCl₂·6H₂O 0.2mg/L， CuSO₄·5H₂O 0.015mg/L，Na₂MoO4·2H₂O0.02mg/L，ZnCl₂0.02mg/L，H₃BO₃0.005mg/L。

The NBS medium was supplemented with 0g/L, 5g/L, 5.5g/L, 6g/L, and 7g/LPCA as the screening concentrations, respectively.

Adding 0g/L, 5g/L, 5.5g/L, 6g/L and 7g/L PCA into genetic engineering Escherichia coli MA03, and comprising the following steps:

(1) seed culture: the seed medium in a 15mL tube was 3mL and sterilized at 121 ℃ for 15 minutes. After cooling, a single colony of E.coli MA03 was inoculated into 3mL of seed medium and shaken overnight at 30 ℃ and 250rpm for 16 hours for inoculation of shake flask fermentation medium.

(2) And (3) shake flask fermentation culture: 200 mu L of the seed bacterial liquid is taken and inoculated into a 100mL sterilized conical flask containing 10mL shake flask fermentation medium, the 100mL sterilized conical flasks with different concentrations of 0g/L, 5g/L, 5.5g/L, 6g/L and 7g/L are respectively added for filtration and sterilization, the initial glucose concentration is 20g/L, the shaking culture is carried out at 37 ℃ and 250rpm for 24 hours, the thallus concentration OD600 is respectively measured with 4h, 8h, 12 h and 24h, and the growth curve with different concentrations of PCA is drawn.

As a result: the results of growth curves of genetically engineered E.coli MA03 with different concentrations of PCA are shown in FIG. 5. As is clear from the results in FIG. 5, the cell growth concentration at which 5.5g/LPCA was added was half of the cell growth concentration at which PCA was added. Therefore, the concentration of PCA tolerated by the acclimatized strain was determined by adding 5.5 g/LPCA.

Example 9 MA03 selection of strains that tolerate high concentrations of PCA by directed acclimation

The shake flask fermentation medium is an NBS medium and consists of the following components:

glucose 20g/L, KH₂PO₄3.5g/L，K₂HPO₄·3H₂O6.5g/L，(NH₄)₂HPO₄3.5g/L，MgSO₄0.120g/L， CaCl₂ 11mg/L，Thiamine HCl 5mg/L，FeCl₃·6H₂O 0.16mg/L，CoCl₂·6H₂O 0.2mg/L， CuSO₄·5H₂O 0.015mg/L，Na₂MoO4·2H₂O0.02mg/L，ZnCl₂0.02mg/L，H₃BO₃0.005mg/L。

The method comprises the following steps:

(1) first-order seed culture: 3mL of the primary seed medium was placed in a 15mL tube and sterilized at 121 ℃ for 15 minutes. After cooling, the genetically engineered E.coli MA03 single colony was inoculated into 3mL of seed medium and shaken overnight at 30 ℃ and 250rpm for 16 hours for secondary seed medium inoculation.

(2) And (3) shake flask fermentation culture: 200 mu L of the seed bacterial liquid is inoculated into a 100mL sterilized conical flask containing 10mL shake flask fermentation medium, wherein the concentration of PCA is 5.5 g/L. The initial glucose concentration was 20g/L, the cells were shake-cultured at 37 ℃ and 250rpm for 24 hours, and the OD600 of the cell concentration was measured every 24 hours to plot a growth curve. Then, the culture was continued for 24 hours by transferring to a new NBS medium, and this was repeated 105 times.

As a result: the results of the growth curve of the acclimatized Escherichia coli MA03 tolerance PCA are shown in FIG. 6. As shown in FIG. 6, the results of total co-acclimation for 105 generations showed that the highest growth concentration of the cells was increased from 1.5 to 2.91 in the culture conditions in which 5.5g/LPCA was added, and that the strains MA03-25, MA03-50, MA03-75, and MA03-100 were obtained.

The genetic engineering Escherichia coli MA03-50 has been deposited in China general microbiological culture Collection center (CGMCC for short, address: Beijing, Kyowa sunward, Xilu No.1, Ministry of microbiology, China academy of sciences, postal code 100101) in 25.10.2017, with a collection number of CGMCC No.14834, and is classified and named as Escherichia coli.

Example 10 production of protocatechuic acid by fermentation of genetically engineered Escherichia coli with different acclimatized strains in Shake flask

The shake flask fermentation medium is an NBS medium and consists of the following components:

glucose 20g/L, KH₂PO₄3.5g/L，K₂HPO₄·3H₂O6.5g/L，(NH₄)₂HPO₄3.5g/L，MgSO₄0.120g/L， CaCl₂ 11mg/L，Thiamine HCl 5mg/L，FeCl₃·6H₂O 0.16mg/L，CoCl₂·6H₂O 0.2mg/L， CuSO₄·5H₂O 0.015mg/L，Na₂MoO4·2H₂O0.02mg/L，ZnCl₂0.02mg/L，H₃BO₃0.005mg/L。

The method comprises the following steps:

(1) seed culture: 3mL of the primary seed medium was placed in a 15mL tube and sterilized at 121 ℃ for 15 minutes. After cooling, single colonies of genetic engineering Escherichia coli MA03, MA03-25, MA03-50, MA03-75 and MA03-100 were inoculated into 3mL seed culture medium, respectively, and cultured overnight in a shaker at 30 ℃ and 250rpm for 16 hours for inoculation in shake flask fermentation medium.

(2) And (3) shake flask fermentation culture: 200. mu.L of the seed bacterial liquid was inoculated into a 100mL sterilized Erlenmeyer flask containing 10mL of shake flask fermentation medium. The initial glucose concentration was 20g/L, and the fermentation broth was obtained by shake cultivation at 37 ℃ and 250rpm for 24 hours. And respectively measuring the OD600 of different thallus concentrations, and drawing a growth curve in a liquid phase.

The analysis method comprises the following steps:

the components in the fermentation broth were analyzed and determined using an Agilent (Agilent-1200) high performance liquid chromatograph. The concentration of glucose and organic acid in the fermentation broth was measured using an Aminex HPX-87H organic acid analytical column (300 mm. times.7.8 mm, 9 μm) from Bohler (Bio-Rad); the mobile phase is 5mM sulfuric acid, the flow rate is 0.6mL/min, the column temperature is 63 ℃, and the detection wavelength is 210 nm. The protocatechuic acid standard was purchased from Sigma-Aldrich, catalog No. 37580-25G-F.

As a result: the yield of protocatechuic acid produced by different domesticated strain genetic engineering escherichia coli through shake flask fermentation is shown in figure 7

EXAMPLE 11 domestication of Strain genetically engineered Escherichia coli MA03-50 fed-batch fermentation in 5L fermentor to produce protocatechuic acid

The primary seed culture medium is an LB culture medium containing 0.5 percent of glucose and consists of the following components:

5g/L glucose, 5g/L yeast extract, 10g/L tryptone and 10g/L sodium chloride (NaCl).

The secondary seed culture medium is an LB culture medium containing 2% glucose and consists of the following components:

20g/L glucose, 5g/L yeast extract, 10g/L tryptone and 10g/L sodium chloride (NaCl).

The initial fermentor medium consisted of the following components:

macroelements: 20g/L of initial glucose and 2g/L, KH g of citric acid₂PO₄7.5g/L、(NH₄)₂SO₄1.6g/L、MgSO₄·7H₂O2 g/L or;

trace elements: FeSO₄·7H₂O 75mg/L、MnSO₄·H₂O 4.5mg/L、Na₂SO₄20mg/L、ZnSO₄6mg/L、 CoCl₂·6H₂O 4mg/L、CuSO₄·5H₂O 0.6mg/L。

The protocatechuic acid is produced by feeding and fermenting in a fermentation tank of genetic engineering Escherichia coli MA03-50, and the method comprises the following steps:

(1) first-order seed culture: 3mL of the primary seed medium was placed in a 15mL tube and sterilized at 121 ℃ for 15 minutes. After cooling, the genetically engineered E.coli MA03-50 single colony was inoculated into 3mL seed medium and shaken overnight at 30 ℃ and 250rpm for 16 hours for secondary seed medium inoculation.

(2) Secondary seed culture: the secondary seed medium in 1L shake flask was 200mL and sterilized at 121 ℃ for 15 minutes. After cooling, 2mL of the primary seed culture broth was inoculated into 200mL of the secondary seed culture medium, and shake-cultured at 37 ℃ and 250rpm for 24 hours for inoculation of the fermenter culture medium.

(3) Fermentation production by fermentation tank feed supplement: 200mL of the secondary seed bacterial liquid was inoculated into a 5L Biotech-5BG fermentor (Shanghai Baoxin BioEquipment engineering Co., Ltd.) containing 2L of the initial fermentor medium, and fermented at 37 ℃ and pH6.5 (pH was controlled by concentrated ammonia water) with dissolved oxygen of 20%. After the fermentation is started, when the glucose concentration in the fermentation tank is reduced to be less than 1g/L, feeding is started by using a glucose solution with the concentration of 500g/L, and the feeding speed is controlled so that the glucose concentration in the fermentation tank is less than 1 g/L. Sampling at fixed time and analyzing the fermentation production condition.

The analysis method comprises the following steps: the same analysis method as in example 10 was used.

As a result: the results of the fermentation in the fermentation tank with genetically engineered Escherichia coli MA03-50 are shown in FIG. 8. According to the results shown in FIG. 8, after the fermentation is carried out for 37 hours under the fed-batch fermentation condition, the protocatechuic acid accumulated in the fermentation broth reaches the highest concentration of 33.3g/L, the molar conversion rate of the sugar and the acid is 16%, the fermentation broth is basically free of the accumulation of byproducts such as acetic acid, and the concentration of the residual glucose in the fermentation broth is 0.55 g/L.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> escherichia coli genetic engineering bacterium for producing protocatechuic acid and construction method and application thereof

<130> 2017.12.08

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 88

<212> DNA

<213> Artificial Synthesis P1(Unknown)

<400> 1

ttatctctgg cggtgttgac aagagataac aacgttgata taattgagcc cttttggtgc 60

gtcagtcagt ttaaaccagg aaacagct 88

<210> 2

<211> 88

<212> DNA

<213> Artificial Synthesis P2(Unknown)

<400> 2

ttatctctgg cggtgttgac aagagataac aacgttgata taattgagcc tgaggtggct 60

tattattcgt ttaaaccagg aaacagct 88

<210> 3

<211> 88

<212> DNA

<213> Artificial Synthesis P3(Unknown)

<400> 3

ttatctctgg cggtgttgac aagagataac aacgttgata taattgagcc actggctcgt 60

aatttattgt ttaaaccagg aaacagct 88

<210> 4

<211> 88

<212> DNA

<213> Artificial Synthesis P4(Unknown)

<400> 4

ttatctctgg cggtgttgac aagagataac aacgttgata taattgagcc cgtattgtta 60

gcatgtacgt ttaaaccagg aaacagct 88

<210> 5

<211> 1071

<212> DNA

<213> Artificial Synthesis of aroF (Artificial Sequence)

<400> 5

atgcaaaaag acgcgctgaa taacgtacat attaccgacg aacaggtttt aatgactccg 60

gaacaactga aggccgcttt tccattgagc ctgcaacaag aagcccagat tgctgactcg 120

cgtaaaagca tttcagatat tatcgccggg cgcgatcctc gtctgctggt agtatgtggt 180

ccttgttcca ttcatgatcc ggaaactgct ctggaatatg ctcgtcgatt taaagccctt 240

gccgcagagg tcagcgatag cctctatctg gtaatgcgcg tctattttga aaaaccccgt 300

accactgtcg gctggaaagg gttaattaac gatccccata tggatggctc ttttgatgta 360

gaagccgggc tgcagatcgc gcgtaaattg ctgcttgagc tggtgaatat gggactgcca 420

ctggcgacgg aagcgttaga tctgaatagc ccgcaatacc tgggcgatct gtttagctgg 480

tcagcaattg gtgctcgtac aacggaatcg caaactcacc gtgaaatggc ctccgggctt 540

tccatgccgg ttggttttaa aaacggcacc gacggcagtc tggcaacagc aattaacgct 600

atgcgcgccg ccgcccagcc gcaccgtttt gttggcatta accaggcagg gcaggttgcg 660

ttgctacaaa ctcaggggaa tccggacggc catgtgatcc tgcgcggtgg taaagcgccg 720

aactatagcc ctgcggatgt tgcgcaatgt gaaaaagaga tggaacaggc gggactgcgc 780

ccgtctctga tggtagattg cagccacggt aattccaata aagattatcg ccgtcagcct 840

gcggtggcag aatccgtggt tgctcaaatc aaagatggca atcgctcaat tattggtctg 900

atgatcgaaa gtaatatcca cgagggcaat cagtcttccg agcaaccgcg cagtgaaatg 960

aaatacggtg tatccgtaac cgatgcctgc attagctggg aaatgaccga tgccttgctg 1020

cgtgaaattc atcaggatct gaacgggcag ctgacggctc gcgtggctta a 1071

<210> 6

<211> 1071

<212> DNA

<213> Artificial Synthesis of aroF (Artificial sequence)

<400> 6

atgcaaaaag acgcgctgaa taacgtacat attaccgacg aacaggtttt aatgactccg 60

gaacaactga aggccgcttt tccattgagc ctgcaacaag aagcccagat tgctgactcg 120

cgtaaaagca tttcagatat tatcgccggg cgcgatcctc gtctgctggt agtatgtggt 180

ccttgttcca ttcatgatcc ggaaactgct ctggaatatg ctcgtcgatt taaagccctt 240

gccgcagagg tcagcgatag cctctatctg gtaatgcgcg tctattttga aaaaccccgt 300

accactgtcg gctggaaagg gttaattaac gatccccata tggatggctc ttttgatgta 360

gaagccgggc tgcagatcgc gcgtaaattg ctgcttgagc tggtgaatat gggactgcca 420

ctggcgacgg aagcgttaga tccgaatagc ccgcaatacc tgggcgatct gtttagctgg 480

tcagcaattg gtgctcgtac aacggaatcg caaactcacc gtgaaatggc ctccgggctt 540

tccatgccgg ttggttttaa aaacggcacc gacggcagtc tggcaacagc aattaacgct 600

atgcgcgccg ccgcccagcc gcaccgtttt gttggcatta accaggcagg gcaggttgcg 660

ttgctacaaa ctcaggggaa tccggacggc catgtgatcc tgcgcggtgg taaagcgccg 720

aactatagcc ctgcggatgt tgcgcaatgt gaaaaagaga tggaacaggc gggactgcgc 780

ccgtctctga tggtagattg cagccacggt aattccaata aagattatcg ccgtcagcct 840

gcggtggcag aatccgtggt tgctcaaatc aaagatggca atcgctcaat tattggtctg 900

atgatcgaaa gtaatatcca cgagggcaat cagtcttccg agcaaccgcg cagtgaaatg 960

aaatacggtg tatccgtaac cgatgcctgc attagctggg aaatgaccga tgccttgctg 1020

cgtgaaattc atcaggatct gaacgggcag ctgacggctc gcgtggctta a 1071

<210> 7

<211> 2932

<212> DNA

<213> Artificial Synthesis of cat-sacB (Artificial sequence)

<400> 7

gtgacggaag atcacttcgc agaataaata aatcctggtg tccctgttga taccgggaag 60

ccctgggcca acttttggcg aaaatgagac gttgatcggc acgtaagagg ttccaacttt 120

caccataatg aaataagatc actaccgggc gtattttttg agttatcgag attttcagga 180

gctaaggaag ctaaaatgga gaaaaaaatc actggatata ccaccgttga tatatcccaa 240

tggcatcgta aagaacattt tgaggcattt cagtcagttg ctcaatgtac ctataaccag 300

accgttcagc tggatattac ggccttttta aagaccgtaa agaaaaataa gcacaagttt 360

tatccggcct ttattcacat tcttgcccgc ctgatgaatg ctcatccgga attccgtatg 420

gcaatgaaag acggtgagct ggtgatatgg gatagtgttc acccttgtta caccgttttc 480

catgagcaaa ctgaaacgtt ttcatcgctc tggagtgaat accacgacga tttccggcag 540

tttctacaca tatattcgca agatgtggcg tgttacggtg aaaacctggc ctatttccct 600

aaagggttta ttgagaatat gtttttcgtc tcagccaatc cctgggtgag tttcaccagt 660

tttgatttaa acgtggccaa tatggacaac ttcttcgccc ccgttttcac catgggcaaa 720

tattatacgc aaggcgacaa ggtgctgatg ccgctggcga ttcaggttca tcatgccgtt 780

tgtgatggct tccatgtcgg cagaatgctt aatgaattac aacagtactg cgatgagtgg 840

cagggcgggg cgtaattttt ttaaggcagt tattggtgcc cttaaacgcc tggtgctacg 900

cctgaataag tgataataag cggatgaatg gcagaaattc gaaagcaaat tcgacccggt 960

cgtcggttca gggcagggtc gttaaatagc cgctagatct aagtaaatcg cgcgggtttg 1020

ttactgataa agcaggcaag acctaaaatg tgtaaagggc aaagtgtata ctttggcgtc 1080

accccttaca tattttaggt ctttttttat tgtgcgtaac taacttgcca tcttcaaaca 1140

ggagggctgg aagaagcaga ccgctaacac agtacataaa aaaggagaca tgaacgatga 1200

acatcaaaaa gtttgcaaaa caagcaacag tattaacctt tactaccgca ctgctggcag 1260

gaggcgcaac tcaagcgttt gcgaaagaaa cgaaccaaaa gccatataag gaaacatacg 1320

gcatttccca tattacacgc catgatatgc tgcaaatccc tgaacagcaa aaaaatgaaa 1380

aatatcaagt tcctgaattc gattcgtcca caattaaaaa tatctcttct gcaaaaggcc 1440

tggacgtttg ggacagctgg ccattacaaa acgctgacgg cactgtcgca aactatcacg 1500

gctaccacat cgtctttgca ttagccggag atcctaaaaa tgcggatgac acatcgattt 1560

acatgttcta tcaaaaagtc ggcgaaactt ctattgacag ctggaaaaac gctggccgcg 1620

tctttaaaga cagcgacaaa ttcgatgcaa atgattctat cctaaaagac caaacacaag 1680

aatggtcagg ttcagccaca tttacatctg acggaaaaat ccgtttattc tacactgatt 1740

tctccggtaa acattacggc aaacaaacac tgacaactgc acaagttaac gtatcagcat 1800

cagacagctc tttgaacatc aacggtgtag aggattataa atcaatcttt gacggtgacg 1860

gaaaaacgta tcaaaatgta cagcagttca tcgatgaagg caactacagc tcaggcgaca 1920

accatacgct gagagatcct cactacgtag aagataaagg ccacaaatac ttagtatttg 1980

aagcaaacac tggaactgaa gatggctacc aaggcgaaga atctttattt aacaaagcat 2040

actatggcaa aagcacatca ttcttccgtc aagaaagtca aaaacttctg caaagcgata 2100

aaaaacgcac ggctgagtta gcaaacggcg ctctcggtat gattgagcta aacgatgatt 2160

acacactgaa aaaagtgatg aaaccgctga ttgcatctaa cacagtaaca gatgaaattg 2220

aacgcgcgaa cgtctttaaa atgaacggca aatggtacct gttcactgac tcccgcggat 2280

caaaaatgac gattgacggc attacgtcta acgatattta catgcttggt tatgtttcta 2340

attctttaac tggcccatac aagccgctga acaaaactgg ccttgtgtta aaaatggatc 2400

ttgatcctaa cgatgtaacc tttacttact cacacttcgc tgtacctcaa gcgaaaggaa 2460

acaatgtcgt gattacaagc tatatgacaa acagaggatt ctacgcagac aaacaatcaa 2520

cgtttgcgcc aagcttcctg ctgaacatca aaggcaagaa aacatctgtt gtcaaagaca 2580

gcatccttga acaaggacaa ttaacagtta acaaataaaa acgcaaaaga aaatgccgat 2640

attgactacc ggaagcagtg tgaccgtgtg cttctcaaat gcctgattca ggctgtctat 2700

gtgtgactgt tgagctgtaa caagttgtct caggtgttca atttcatgtt ctagttgctt 2760

tgttttactg gtttcacctg ttctattagg tgttacatgc tgttcatctg ttacattgtc 2820

gatctgttca tggtgaacag ctttaaatgc accaaaaact cgtaaaagct ctgatgtatc 2880

tatctttttt acaccgtttt catctgtgca tatggacagt tttccctttg at 2932

<210> 8

<211> 100

<212> DNA

<213> Artificial Synthesis of ptsI (artificial sequence)

<400> 8

acaaacccat gatcttctcc taagcagtaa attgggccgc atctcgtgga aaccctacct 60

tacttgtgac tgatttttaa aagaacccgg gaaattactc 100

<210> 9

<211> 1854

<212> DNA

<213> Artificial Synthesis of aroZ (Artificial sequence)

<400> 9

atgctgcgct ctatcgccac cgtttcgatt tccggcaccc tgcctgagaa gctgcacgct 60

attgcggcgg cggggtatca gggggtggaa attttcgaga acgatctgct ctattatacg 120

gggacgccgg cggaaatccg ccagcttgcc gccgatttag ggttaaaaat cacgcttttt 180

caaccctttc gcgattttga aggcgccagt cgggcgcagt ttgcgacgaa tatggcccgc 240

gctcggcgca agtttgctct gatgcgcgag ctgggctgcg agacgctgct gctgtgcagc 300

aatgtacagc cggactgctc ggcggatagc gaattgcagg tcgcggacct gcgggcgctg 360

gccacgctgg cggaagagga ggggatcgct atcggctatg aggccctggc ctggggaacc 420

catgtgaacc gctggcagca ggcctgggag cgggtgcggc gggtggacag cccggcgttg 480

ggcctggtgc tcgacagctt ccatattctg gcccgcggcg acacgctgga cgcgctaccg 540

tcggtgccgg tggagaaaat cacctttgta cagctcgccg atgcgccgta tatgaaaatg 600

gatttgctgg agtggagccg ccacttccgc tgctttcccg gacaggggga gctgccgctg 660

gaggcgtttg ccgagcagat cacccgctgt ggctaccgcg gcccctggtc gctggagatc 720

ttcaatgacg gttttcgcgc ctcgccgaac ggcgcgacgg ccaaagatgg ttatcgttcg 780

ctgctgtggc tggaggagca aacccgccgt cggctcccga cgtgcgatgc cgatctgttt 840

tcaccgccgc cgctgccggt ctatcacggg ctggagttta tcgaattcgc cgccagcgcc 900

gccgaggcgc agcgcctggg gcaacatctg caggcgctgg gttttcagca cgagggaagc 960

caccgctcca gacaggtgac gctgtggcgc aacggcgggg cgcggatcgt catcaaccat 1020

cagccgcaca gctgggccga ccatttttat caacgccacg gggtatcgct ctgcgcgatg 1080

gcgctgcggg tcgagcacag cgcgtcgctt gtcgcccgcg cccgcgcgct ggggtatgcc 1140

acctggcagg gcgacgccgg gccgaacgaa acgccgatcc cggcgatctg cgcccccgac 1200

ggcagcctta tctatctcat cgacgccggg gaggctatct acgagcgcga ttttcatctg 1260

cgtgatggcg tgacggtgcg cgaggattat ctcggtatcg atcatctggc gctgggaatg 1320

gaggccgaca gccgcgataa ctgggtgatg ttcttccgta cggtgtttgg tttttccctt 1380

gagcatgagc agacgctgcc ggacccgtat ggactggtgc gcagcctggc ggtgcgcagc 1440

ccgcagggcg atatccgtct ggcgctgaat atttcgcaga gccggacgac gcagatcgcc 1500

cgctccgtcg cttgctacca gggggcgggg ctgcagcatg ccgcctttgc ctgccgcgat 1560

ctgccggccg cctgcgacca gcttgccgag gttgcccgcc atacgctgcc gatcccggcc 1620

aattattatg acgatctgct ggcgcgcttt ggcggcgagc tggacgtcgg gcagcttcag 1680

cgccagcagc tcctctatga ccgcgatccg caggggggag atttcctgca tctttacacc 1740

cggccgttta ccgccggccg ctttttcttt gagttaaccg agcgccgggc tggctatgcg 1800

ctctatggcg cagcgaatgc ggccgtccgt ctggcggcga tgcagtattg ttag 1854

<210> 10

<211> 1942

<212> DNA

<213> Artificial Synthesis of P4-aroZ (Artificial sequence)

<400> 10

ttatctctgg cggtgttgac aagagataac aacgttgata taattgagcc cgtattgtta 60

gcatgtacgt ttaaaccagg aaacagctat gctgcgctct atcgccaccg tttcgatttc 120

cggcaccctg cctgagaagc tgcacgctat tgcggcggcg gggtatcagg gggtggaaat 180

tttcgagaac gatctgctct attatacggg gacgccggcg gaaatccgcc agcttgccgc 240

cgatttaggg ttaaaaatca cgctttttca accctttcgc gattttgaag gcgccagtcg 300

ggcgcagttt gcgacgaata tggcccgcgc tcggcgcaag tttgctctga tgcgcgagct 360

gggctgcgag acgctgctgc tgtgcagcaa tgtacagccg gactgctcgg cggatagcga 420

attgcaggtc gcggacctgc gggcgctggc cacgctggcg gaagaggagg ggatcgctat 480

cggctatgag gccctggcct ggggaaccca tgtgaaccgc tggcagcagg cctgggagcg 540

ggtgcggcgg gtggacagcc cggcgttggg cctggtgctc gacagcttcc atattctggc 600

ccgcggcgac acgctggacg cgctaccgtc ggtgccggtg gagaaaatca cctttgtaca 660

gctcgccgat gcgccgtata tgaaaatgga tttgctggag tggagccgcc acttccgctg 720

ctttcccgga cagggggagc tgccgctgga ggcgtttgcc gagcagatca cccgctgtgg 780

ctaccgcggc ccctggtcgc tggagatctt caatgacggt tttcgcgcct cgccgaacgg 840

cgcgacggcc aaagatggtt atcgttcgct gctgtggctg gaggagcaaa cccgccgtcg 900

gctcccgacg tgcgatgccg atctgttttc accgccgccg ctgccggtct atcacgggct 960

ggagtttatc gaattcgccg ccagcgccgc cgaggcgcag cgcctggggc aacatctgca 1020

ggcgctgggt tttcagcacg agggaagcca ccgctccaga caggtgacgc tgtggcgcaa 1080

cggcggggcg cggatcgtca tcaaccatca gccgcacagc tgggccgacc atttttatca 1140

acgccacggg gtatcgctct gcgcgatggc gctgcgggtc gagcacagcg cgtcgcttgt 1200

cgcccgcgcc cgcgcgctgg ggtatgccac ctggcagggc gacgccgggc cgaacgaaac 1260

gccgatcccg gcgatctgcg cccccgacgg cagccttatc tatctcatcg acgccgggga 1320

ggctatctac gagcgcgatt ttcatctgcg tgatggcgtg acggtgcgcg aggattatct 1380

cggtatcgat catctggcgc tgggaatgga ggccgacagc cgcgataact gggtgatgtt 1440

cttccgtacg gtgtttggtt tttcccttga gcatgagcag acgctgccgg acccgtatgg 1500

actggtgcgc agcctggcgg tgcgcagccc gcagggcgat atccgtctgg cgctgaatat 1560

ttcgcagagc cggacgacgc agatcgcccg ctccgtcgct tgctaccagg gggcggggct 1620

gcagcatgcc gcctttgcct gccgcgatct gccggccgcc tgcgaccagc ttgccgaggt 1680

tgcccgccat acgctgccga tcccggccaa ttattatgac gatctgctgg cgcgctttgg 1740

cggcgagctg gacgtcgggc agcttcagcg ccagcagctc ctctatgacc gcgatccgca 1800

ggggggagat ttcctgcatc tttacacccg gccgtttacc gccggccgct ttttctttga 1860

gttaaccgag cgccgggctg gctatgcgct ctatggcgca gcgaatgcgg ccgtccgtct 1920

ggcggcgatg cagtattgtt ag 1942

Claims (5)

1. Escherichia coli (Escherichia coli) recombinant strain MA03-50 with high protocatechuic acid yield is CGMCC No. 14834.

2. The recombinant strain MA03-50 of claim 1, which is obtained by directional domestication screening in a protocatechuic acid-containing medium using MA03 as an original strain.

3. The recombinant strain MA03-50 of claim 2, which is obtained by directional domestication screening in a culture medium containing 5.5g/L protocatechuic acid, using MA03 as starting strain.

4. Use of a recombinant strain according to any one of claims 1 to 3 for the production of protocatechuic acid.

5. A method for producing protocatechuic acid by fermentation using the recombinant strain according to any one of claims 1 to 3.

Images