CN109932347A - A kind of near-infrared fluorescent albumen smURFP and the method for directly detecting biliverdin - Google Patents
A kind of near-infrared fluorescent albumen smURFP and the method for directly detecting biliverdin Download PDFInfo
- Publication number
- CN109932347A CN109932347A CN201910144442.6A CN201910144442A CN109932347A CN 109932347 A CN109932347 A CN 109932347A CN 201910144442 A CN201910144442 A CN 201910144442A CN 109932347 A CN109932347 A CN 109932347A
- Authority
- CN
- China
- Prior art keywords
- biliverdin
- smurfp
- infrared fluorescent
- solution
- fluorescent albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
Abstract
The present invention discloses a kind of near-infrared fluorescent albumen smURFP gene order and a kind of method of directly detection biliverdin.The present invention carries out covalent bond using the biliverdin in near-infrared fluorescent albumen smURFP and sample, quantitative detection is directly carried out to biliverdin by emitted luminescence intensity at microplate reader detector 670nm after 642nm excitation, to simplify the operation of existing detection means, avoid the use that higher cost operation requires harsher instrument, the sensitivity to biliverdin detection, application value with higher are improved simultaneously.
Description
Technical field
The invention belongs to vitro detection technical fields, and in particular to a kind of near-infrared fluorescent albumen smURFP and directly detect
The method of biliverdin.
Background technique
Biliverdin (BV) is that one is green small-molecule substances naturally occurring in human body, during being regular intracellular metabolite
The terminal metabolite of heme oxidase (Heme Oxygenase, HO) degradation ferroheme is the master in bile and jaundice urine
Bile pigment is wanted, can be aoxidized and be obtained by bilirubin, generally going through after the biliverdin reductase in liver is reduced into bilirubin has liver
It is dirty to be discharged into blood.It is extremely low in the content of normal human blood's mesobiliverdin, and suffer from the blood mesobiliverdin of liver diseases person
Content is higher than normal level.
The method of measurement serum biliverdin mainly has the method detected indirectly and based on high performance liquid chromatography (HPLC) at present
The method directly detected.Wherein, the main policies of indirect determination biliverdin are that biliverdin is reduced into gallbladder by chemical means
Red pigment measurement, or the variation of optical wavelength is absorbed to measure biliverdin by solution after biliverdin reductase and biliverdin effect.
Indirect method is due to needing to carry out reduction treatment to biliverdin, and detection is complicated for operation, and measurement result is largely
On by reducing agent used in it or enzyme activity and the reducing degree of biliverdin is influenced.In addition, recycling chemical hand
When section carries out reduction treatment to biliverdin, it is to be ensured that no side reaction generation or side reaction do not influence last measurement result.
To which the time of selection and the reaction of reducing agent will be by strict control come exclusive PCR.
Based on the method for high performance liquid chromatography (HPLC) detection biliverdin, the operation requirement of high performance liquid chromatograph is used
It is higher, it is higher to the processing requirement of sample, and the use cost of instrument is also higher, so as to cause the testing cost of this method
It is higher.
Near-infrared fluorescent albumen is the fluorescin that its exciting light of one kind and wavelength of transmitted light are near infrared wavelength region,
Due to its longer excitation wavelength and launch wavelength, near-infrared fluorescent albumen be conducive in the application exclude sample in itself
The interference of fluorescence signal, thus in imaging and family field with good application prospect.
Summary of the invention
The purpose of the invention is to overcome the deficiencies of the prior art and provide near-infrared fluorescent albumen smURFP and directly
The method for detecting biliverdin, this method strong interference immunity, accuracy is high and can directly detect biliverdin.
First technical solution of the invention: a kind of near-infrared fluorescent albumen smURFP, gene order are SEQ ID NO:
1。
Second technical solution of the invention: a method of directly detection biliverdin, comprising the following steps:
1) chemical synthesis near-infrared fluorescent albumen smURFP gene, and by near-infrared fluorescent albumen smURFP in host cell
Middle carry out great expression；
2) it isolates and purifies to obtain the near-infrared fluorescent albumen smURFP solution of purity > 90%, and uses buffer by albumen
Solution is diluted to required concentration；
3) it is incubated for after mixing 50 μ l protein solutions with the solution that 50 μ l contain biliverdin sample；
4) fluorescence intensity of transmitting light is detected under excitation using microplate reader；
5) the biliverdin content of institute's sample is calculated according to standard curve.
The prokaryotic expression carrier containing SEQ ID NO.1 gene order is constructed in the step 1), is transferred to Escherichia coli
E.coli cell expresses near-infrared fluorescent albumen smURFP.
It isolates and purifies to obtain closely using Ni- affinity chromatography, anion-exchange chromatography and sieve chromatography in the step 2)
IR fluorescence albumen smURFP.
Buffer solution system includes: the 50mM Tris-HCL and PBS that pH is 8.0,9.4,11.0 in the step 2).
In the step 2) buffer salinity include: 0mM, 100mM, 200mM, 300mM, 400mM, 500mM, 600mM,
700mM、800mM、900mM、1000mM Nacl。
Near-infrared fluorescent albumen smURFP is most in detection architecture in the step 2) after dilution for detecting biliverdin
It is final concentration of: 0.5 μM -50 μM.
When sample in the step 2) containing biliverdin is serum, serum is diluted to 20% by buffer.
After fluorescin smURFP is mixed with biliverdin solution in the step 3), incubation conditions are 4 DEG C, and incubation time is
20min-240min。
Compared with prior art, the present invention have it is following the utility model has the advantages that
1, the present invention using one kind can directly be carried out with biliverdin covalently bound near-infrared fluorescent albumen smURFP come
Detection assay biliverdin content can directly detect the biliverdin in sample, and the inspection to biliverdin can be improved
Survey sensitivity.
2, the present invention is chromatographed by three steps to egg when handling the near-infrared fluorescent albumen smURFP for detecting biliverdin
It is white to be isolated and purified, the fluorescin of high-purity has been used, has eliminated and participates in Bacillus coli cells impurity pair in detection architecture
It is influenced caused by measurement result.
3, the present invention is near-infrared fluorescent albumen for measuring the fluorescin smURFP that biliverdin uses, and eliminates detection
The interference for the intrinsic fluorescence signal that other albumen and other biomolecule when serum mesobiliverdin in serum issue, and exclude
Phenomena such as scattering and absorption of the light occurred due to these interference.
4, the present invention measures biliverdin by way of fluorescence intensity, avoids complicated detecting step and complexity
Use together simplifies detection means, while reducing testing cost to a certain extent.
5, in detection architecture of the invention other than albumen buffer, without using other changes with redox property
Substance is learned, redox reaction will not occur with biliverdin to be measured, detection is caused to add the biliverdin content of reality and actually contained
Difference occurs for amount.
Detailed description of the invention
Fig. 1 is 1% agarose gel electrophoresis identification smURFP gene PCR product；In figure, M: nucleic acid molecular weight standard
(bp)；1:smURFP gene PCR product；2:smURFP gene PCR product；3:smURFP gene PCR product；4:smURFP gene
PCR product.
Fig. 2 is SDS-PAGE identification Ni- affinity chromatography, anion-exchange chromatography, molecular sieve chromatography purification near-infrared fluorescent
Albumen smURFP electrophoretogram；In figure, M: protein molecular weight standard (kDa)；1:Ni- affinity chromatography washes miscellaneous rear medium samples；2:
Medium samples after ULP enzyme is added in Ni- affinity chromatography；Medium samples after 3:Ni- affinity chromatography ULP enzyme digestion 12h；4:Ni- parent
With chromatographic eluate sample；5: the near-infrared fluorescent protein sample after anion-exchange chromatography；6: passing through sieve chromatography
Near-infrared fluorescent protein sample afterwards；Medium samples after the elution of 7:Ni- affinity chromatography.
Fig. 3 be in different buffer systems fluorescence intensity according to the variation of time.Wherein A: 0.5 μM in PBS solution
After smURFP is mixed with 5 μM of biliverdin fluorescence intensity with the time variation；B；The 50mM Tris-HCL solution for being 8.0 in pH
In 0.5 μM of smURFP mixed with 5 μM of biliverdin after fluorescence intensity with the time variation；C: the 50mM Tris- for being 9.4 in pH
After 0.5 μM of smURFP is mixed with 5 μM of biliverdin in HCL solution fluorescence intensity with the time variation；D: being 11.0 in pH
After 0.5 μM of smURFP is mixed with 5 μM of biliverdin in 50mM Tris-HCL solution fluorescence intensity with the time variation；E: each
After 0.5 μM of smURFP is mixed with 5 μM of biliverdin in kind of solution system fluorescence intensity with the time variation.
Fig. 4 is 5 μM of smURFP and 5 μM of mixed fluorescence signal intensities of biliverdin under with the salinity of gradient dilution.
Fig. 5 is the smURFP and the mixed fluorescence intensity of biliverdin in various concentration.Wherein, A: with gradient dilution
SmURFP and 0.1 μM of mixed fluorescence intensity of biliverdin；B: mixed glimmering with the smURFP of gradient dilution and 1 μM of biliverdin
Luminous intensity；C: with smURFP and 10 μM of mixed fluorescence intensity of biliverdin of gradient dilution.
Fig. 6 is the standard curve that biliverdin content is measured in the smURFP system of Individual concentrations.Wherein, A: detection architecture
In protein concentration be 5 μM when detect biliverdin standard curve；B: the protein concentration in detection architecture detects gallbladder when being 25 μM
The standard curve of green element.
Fig. 7 is the standard curve that biliverdin content is measured in the system containing serum: the smURFP concentration in system is 5
μM。
Specific embodiment
Below with reference to embodiment and attached drawing, the invention will be further described.
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Quantitative test in subordinate's embodiment, by many experiments, results are averaged.
The artificial synthesized near-infrared fluorescent albumen smURFP gene of embodiment 1
According to near-infrared fluorescent albumen smURFP's but the sequence of calculation, referring to Codon usage database, select large intestine
The highest codon of bacillus Codon usage designs optimal near-infrared fluorescent albumen smURFP nucleic acid sequence, and student on commission
Object company carries out the artificial synthesized of gene.Wherein, the gene order such as SEQ ID of the near-infrared fluorescent albumen smURFP is encoded
Shown in NO.1.
The prokaryotic expression carrier of the building of embodiment 2 near-infrared fluorescent albumen smURFP
According to molecular cloning method, the upstream and downstream primer pairing for being respectively provided with I restriction enzyme site sequence of BamH I and Xho is utilized
At gene carry out PCR.The upstream primer is F1, and downstream primer R1, PCR reaction product carries out 1% Ago-Gel electricity
Target gene fragment is recycled in swimming.
F-smURFP:5 '-CGGGATCCatggctaagacttccgaacag-3’
R-smURFP:5 '-CCGCTCGAGttagctcatagccttaataatgtaatcaaagtagg-3’
It is after recycling that near-infrared is glimmering with BamH I and the above-mentioned PCR product of I double digestion of Xho and carrier pET-28b (+)-SUMO
Photoprotein smURFP gene is connected with carrier pET-28b (+)-SUMO, is built into carrier pET-28b (+)-SUMO-
SmURFP converts bacillus coli DH 5 alpha.Using kanamycin resistance screening positive colony, sequencing identification carrier sequence is correct.
1 list of genes of table
| Gene Name | SEQ ID NO. | Length (bp) |
| smURFP | SEQ ID NO.1 | 402 |
| F-smURFP | SEQ ID NO.2 | 29 |
| R-smURFP | SEQ ID NO.3 | 44 |
SEQ ID NO.1:
atggcgaaaaccagcgaacagcgcgtgaacattgcaaccctgctgaccgaaaacaaaaagaagatcgt
ggataaagcgagccaggatttatggcgccgccatccggatttaattgcgcctggcggcattgcatttagccagcgt
gatcgtgcgctgtgcttacgcgattatggctggtttctgcatctgattaccttttgcctgctggcgggtgataaag
gcccgattgaaagcattggcctgattagcattcgcgaaatgtataacagcctgggcgttcctgttcctgcgatgat
ggaaagcattcgctgcctgaaagaagcgagcctgagcctgctggatgaagaagatgcgaacgaaaccgcgccgtac
tttgattatatcatcaaggcgatgagctaa
SEQ ID NO.2:
F-smURFP:5 '-cgggatccatggctaagacttccgaacag-3’
SEQ ID NO.3:
R-smURFP:5 '-ccgctcgagttagctcatagccttaataatgtaatcaaagtagg-3’
Embodiment 3 screens high efficient expression near-infrared fluorescent albumen smURFP bacterial strain
Expression vector pET-28b (+)-SUMO plasmid is prepared using alkalinity-SDS cracking process, converts e. coli bl21, benefit
With kanamycins (KAN) resistance screening positive colony, the different monoclonal of picking is inoculated into 100mL LB-KAN culture medium, and 37
DEG C, inducer IPTG induction destination protein expression is added in 220r/min, culture bacterial strain to OD600=0.6 after being cooled to 16 DEG C,
Utilize the expression of SDS-PAGE detection near-infrared fluorescent albumen smURFP.
Embodiment 4 is expressed and purifies near-infrared fluorescent albumen smURFP
The expression bacterial strain obtained using screening expands culture scale, great expression smURFP albumen.It collects thin after cultivating
Bacterium, high pressure are crushed bacterium, and 18000rpm is centrifuged 30min, separate supernatant, purify smURFP egg by the Ni- affinity chromatography first step
White, eluent passes sequentially through anion-exchange chromatography after salt reduction and sieve chromatography is further isolated and purified.
The selection of 5 biliverdin of embodiment detection buffer system
A kind of method for present embodiments providing directly detection biliverdin, comprising the following steps:
(1) protein solution is diluted to required concentration using buffer；
(2) 50 μ l protein solutions are contained with 50 μ l and is incubated for after being mixed with the biliverdin solution of the concentration of gradient dilution；
(3) fluorescence intensity of transmitting light is detected under excitation using microplate reader；
In the present embodiment, it is 8.0,9.4,11.0 that step (1), which includes: pH for the buffer solution system of diluted protein solution,
50mM Tris-HCL and PBS.
In the present embodiment, buffer salinity of the step (1) for diluted protein solution is tentatively set as 0mM Nacl.
In the present embodiment, it is used to detect the outer fluorescin smURFP of near-infrared in the detection architecture of biliverdin after dilution most
Final concentration is tentatively set as 0.5 μM.
In the present embodiment, the biliverdin concentration in final detection architecture is tentatively set as 5 μM.
In the present embodiment, the detection architecture of step (2) mixing is as carrying out fluorescence detection in 96 orifice plate of black flat-bottom.
In the present embodiment, after step (2) fluorescin smURFP is mixed with biliverdin solution, incubation conditions are 4 DEG C, are incubated for
Time is 20min-240min.
In the present embodiment, excitation light wave a length of 642nm, wavelength of transmitted light 670nm of step (3) fluorescence intensity.
The selection of 6 biliverdin detection architecture salinity of embodiment
A kind of method for present embodiments providing directly detection biliverdin, comprising the following steps:
(1) protein solution is diluted to required concentration using buffer；
(2) 50 μ l protein solutions are contained with 50 μ l and is incubated for after being mixed with the biliverdin solution of the concentration of gradient dilution；
(3) fluorescence intensity of transmitting light is detected under excitation using microplate reader；
In the present embodiment, it is 8.0,9.4,11.0 that step (1), which includes: pH for the buffer solution system of diluted protein solution,
50mM Tris-HCL and PBS.
In the present embodiment, step (1) for diluted protein solution buffer salinity include: 0mM, 100mM, 200mM,
300mM、400mM、500mM、600mM、700mM、800mM、900mM、1000mM Nacl。
In the present embodiment, it is used to detect the outer fluorescin smURFP of near-infrared in the detection architecture of biliverdin after dilution most
Final concentration is tentatively set as 5 μM.
In the present embodiment, the biliverdin concentration in final detection architecture is tentatively set as 5 μM.
In the present embodiment, the detection architecture of step (2) mixing is as carrying out fluorescence detection in 96 orifice plate of black flat-bottom.
In the present embodiment, after step (2) fluorescin smURFP is mixed with biliverdin solution, incubation conditions are 4 DEG C, are incubated for
Time is 20min-240min.
In the present embodiment, excitation light wave a length of 642nm, wavelength of transmitted light 670nm of step (3) fluorescence intensity.
The selection of 7 biliverdin detection architecture incubation time of embodiment
A kind of method for present embodiments providing directly detection biliverdin, comprising the following steps:
(1) protein solution is diluted to required concentration using buffer；
(2) 50 μ l protein solutions are contained with 50 μ l and is incubated for after being mixed with the biliverdin solution of the concentration of gradient dilution；
(3) fluorescence intensity of transmitting light is detected under excitation using microplate reader；
In the present embodiment, buffer solution system of the step (1) for diluted protein solution is set as 50mM Tris-HCL, and pH is
8.0。
In the present embodiment, step (1) is 900mM Nacl for the salinity of the buffer system of diluted protein solution.
In the present embodiment, it is used to detect the outer fluorescin smURFP of near-infrared in the detection architecture of biliverdin after dilution most
Final concentration is tentatively set as 0.5 μM.
In the present embodiment, the detection architecture of step (2) mixing is as carrying out fluorescence detection in 96 orifice plate of black flat-bottom.
In the present embodiment, after step (2) fluorescin smURFP is mixed with biliverdin solution, incubation conditions are 4 DEG C, are incubated for
Time is 20min-240min, every 20min fluorescence intensity.
In the present embodiment, excitation light wave a length of 642nm, wavelength of transmitted light 670nm of step (3) fluorescence intensity.
The selection of near-infrared fluorescent albumen smURFP concentration in 8 biliverdin detection architecture of embodiment
A kind of method for present embodiments providing directly detection biliverdin, comprising the following steps:
(1) protein solution is diluted to required concentration using buffer；
(2) 50 μ l protein solutions are contained with 50 μ l and is incubated for after being mixed with the biliverdin solution of the concentration of gradient dilution；
(3) fluorescence intensity of transmitting light is detected under excitation using microplate reader；
In the present embodiment, buffer solution system of the step (1) for diluted protein solution is set as 50mM Tris-HCL, and pH is
8.0。
In the present embodiment, step (1) is 900mM Nacl for the salinity of the buffer system of diluted protein solution.
In the present embodiment, the ultimate density of step (2) detection architecture mesobiliverdin is set as 0.1 μM, 1 μM, 10 μM.
In the present embodiment, it is used to detect the outer fluorescin smURFP of near-infrared in the detection architecture of biliverdin after dilution most
Final concentration gradient is set as 0.5 μM, 1 μM, 5 μM, 10 μM, 15 μM, 20 μM, 25 μM, 50 μM.
In the present embodiment, the detection architecture of step (2) mixing is as carrying out fluorescence detection in 96 orifice plate of black flat-bottom.
In the present embodiment, after step (2) fluorescin smURFP is mixed with biliverdin solution, incubation conditions are 4 DEG C, are incubated for
Time is set as 180min.
In the present embodiment, excitation light wave a length of 642nm, wavelength of transmitted light 670nm of step (3) fluorescence intensity.
The measurement of 9 biliverdin of embodiment detection body standard curve
A kind of method for present embodiments providing directly detection biliverdin, comprising the following steps:
(1) protein solution is diluted to required concentration using buffer；
(2) 50 μ l protein solutions are contained with 50 μ l and is incubated for after being mixed with the biliverdin solution of the concentration of gradient dilution；
(3) fluorescence intensity of transmitting light is detected under excitation using microplate reader；
In the present embodiment, buffer solution system of the step (1) for diluted protein solution is set as 50mM Tris-HCL, and pH is
8.0。
In the present embodiment, step (1) is 900mM Nacl for the salinity of the buffer system of diluted protein solution.
In the present embodiment, it is used to detect the outer fluorescin smURFP of near-infrared in the detection architecture of biliverdin after dilution most
Final concentration gradient is set as 5 μM and 25 μM.
In the present embodiment, the detection architecture of step (2) mixing is as carrying out fluorescence detection in 96 orifice plate of black flat-bottom.
In the present embodiment, after step (2) fluorescin smURFP is mixed with biliverdin solution, incubation conditions are 4 DEG C, are incubated for
Time is set as 180min.
In the present embodiment, excitation light wave a length of 642nm, wavelength of transmitted light 670nm of step (3) fluorescence intensity.
The measurement of 10 serum mesobiliverdin of embodiment detection body standard curve
A kind of method for present embodiments providing directly detection biliverdin, comprising the following steps:
(1) protein solution is diluted to required concentration using buffer；
(2) 50 μ l protein solutions are contained with 50 μ l and is incubated for after being mixed with the biliverdin solution of the concentration of gradient dilution；
(3) fluorescence intensity of transmitting light is detected under excitation using microplate reader；
In the present embodiment, buffer solution system of the step (1) for diluted protein solution is set as 50mM Tris-HCL, and pH is
8.0。
In the present embodiment, step (1) is 900mM Nacl for the salinity of the buffer system of diluted protein solution.
In the present embodiment, it is used to detect the outer fluorescin smURFP of near-infrared in the detection architecture of biliverdin after dilution most
Final concentration gradient is set as 5 μM and 25 μM.
In the present embodiment, when the sample containing biliverdin is serum, serum is diluted with the buffer in above-mentioned steps (2)
At 20%.
In the present embodiment, the detection architecture of step (2) mixing is as carrying out fluorescence detection in 96 orifice plate of black flat-bottom.
In the present embodiment, after step (2) fluorescin smURFP is mixed with biliverdin solution, incubation conditions are 4 DEG C, are incubated for
Time is set as 180min.
In the present embodiment, excitation light wave a length of 642nm, wavelength of transmitted light 670nm of step (3) fluorescence intensity.
Fig. 1 is 1% agarose gel electrophoresis identification smURFP gene PCR product；In figure, M: nucleic acid molecular weight standard
(bp)；1:smURFP gene PCR product；2:smURFP gene PCR product；3:smURFP gene PCR product；4:smURFP gene
PCR product.
Fig. 2 is SDS-PAGE identification Ni- affinity chromatography, anion-exchange chromatography, molecular sieve chromatography purification near-infrared fluorescent
Albumen smURFP electrophoretogram；In figure, M: protein molecular weight standard (kDa)；1:Ni- affinity chromatography washes miscellaneous rear medium samples；2:
Medium samples after ULP enzyme is added in Ni- affinity chromatography；Medium samples after 3:Ni- affinity chromatography ULP enzyme digestion 12h；4:Ni- parent
With chromatographic eluate sample；5: the near-infrared fluorescent protein sample after anion-exchange chromatography；6: passing through sieve chromatography
Near-infrared fluorescent protein sample afterwards；Medium samples after the elution of 7:Ni- affinity chromatography.
Fig. 3 be in different buffer systems fluorescence intensity according to the variation of time.Wherein A: 0.5 μM in PBS solution
After smURFP is mixed with 5 μM of biliverdin fluorescence intensity with the time variation；B；The 50mM Tris-HCL solution for being 8.0 in pH
In 0.5 μM of smURFP mixed with 5 μM of biliverdin after fluorescence intensity with the time variation；C: the 50mM Tris- for being 9.4 in pH
After 0.5 μM of smURFP is mixed with 5 μM of biliverdin in HCL solution fluorescence intensity with the time variation；D: being 11.0 in pH
After 0.5 μM of smURFP is mixed with 5 μM of biliverdin in 50mM Tris-HCL solution fluorescence intensity with the time variation；E: each
After 0.5 μM of smURFP is mixed with 5 μM of biliverdin in kind of solution system fluorescence intensity with the time variation.
From figure 3, it can be seen that 0.5 μM of smURFP and 5 μM of gallbladders are green when pH is 8.0 in the four pH conditions implemented
The fluorescence intensity issued after element mixing is most strong.And it is changed with time by fluorescence intensity in each experiment as it can be seen that can
The incubation time that the fluorescence intensity of system reaches maximum value is at least 180min.Therefore the buffer system sent out in experiment
PH selection 8.0, incubation time selects 180min.
Fig. 4 is 5 μM of smURFP and 5 μM of mixed fluorescence signal intensities of biliverdin under with the salinity of gradient dilution.
Figure 4, it is seen that smURFP when salinity is 900mM in the buffer condition of different salinity in solution
Sending volume fluorescence intensity is high relative to the fluorescence intensity under other salt concentration conditions.Therefore the buffer system in experiment below
Salinity selection 900mM salinity is further tested.
Fig. 5 is the smURFP and the mixed fluorescence intensity of biliverdin in various concentration.Wherein, A: with gradient dilution
SmURFP and 0.1 μM of mixed fluorescence intensity of biliverdin；B: mixed glimmering with the smURFP of gradient dilution and 1 μM of biliverdin
Luminous intensity；C: with smURFP and 10 μM of mixed fluorescence intensity of biliverdin of gradient dilution.
In Fig. 5, the biliverdin of 0.1 μM of selection represents the biliverdin of low concentration, selects 1 μM of biliverdin for intermediate concentration
The biliverdin of biliverdin, 10 μM of selection represents the biliverdin of high concentration.And as seen in Figure 5, in low concentration biliverdin body
When smURFP concentration is 5 μM in system, the fluorescence intensity under the relatively other smURFP concentration conditions of the fluorescence intensity of system is high；Suitable
When smURFP concentration is 25 μM in the biliverdin system of middle concentration, the fluorescence intensity of system is relative to other sURFP concentration conditions
Under fluorescence intensity it is high；And in the biliverdin system of high concentration, the fluorescence intensity of system with the concentration of smURFP increase
And increase.But in view of the biliverdin content in reagent sample is lower, 5 μM of smURFP concentration initial option in experiment in next step
With 25 μM.
Fig. 6 is the standard curve that biliverdin content is measured in the smURFP system of Individual concentrations.Wherein, A: detection architecture
In protein concentration be 5 μM when detect biliverdin standard curve；B: the protein concentration in detection architecture detects gallbladder when being 25 μM
The standard curve of green element.
By the calculated detectable limit of standard curve and institute in Fig. 6, the inspection under 5 μM of smURFP concentration is obtained
It is low to survey the detectable limit detected under than 25 μM smURFP concentration of detectable limit of biliverdin.Therefore it is detected in experiment later
The smURFP concentration of system selects 5 μM.
Fig. 7 is the standard curve that biliverdin content is measured in the system containing serum: the smURFP concentration in system is 5
μM。
Sequence table
<110>University Of Tianjin
<120>a kind of near-infrared fluorescent albumen smURFP and the method for directly detecting biliverdin
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 402
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
atggcgaaaa ccagcgaaca gcgcgtgaac attgcaaccc tgctgaccga aaacaaaaag 60
aagatcgtgg ataaagcgag ccaggattta tggcgccgcc atccggattt aattgcgcct 120
ggcggcattg catttagcca gcgtgatcgt gcgctgtgct tacgcgatta tggctggttt 180
ctgcatctga ttaccttttg cctgctggcg ggtgataaag gcccgattga aagcattggc 240
ctgattagca ttcgcgaaat gtataacagc ctgggcgttc ctgttcctgc gatgatggaa 300
agcattcgct gcctgaaaga agcgagcctg agcctgctgg atgaagaaga tgcgaacgaa 360
accgcgccgt actttgatta tatcatcaag gcgatgagct aa 402
<210> 2
<211> 29
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
cgggatccat ggctaagact tccgaacag 29
<210> 3
<211> 44
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
ccgctcgagt tagctcatag ccttaataat gtaatcaaag tagg 44
Claims (9)
1. a kind of for directly detecting the near-infrared fluorescent albumen smURFP of biliverdin, which is characterized in that gene order SEQ
ID NO:1.
2. a kind of method for directly detecting biliverdin, which comprises the following steps:
1) chemical synthesis near-infrared fluorescent albumen smURFP gene, and by near-infrared fluorescent albumen smURFP in host cell into
Row great expression；
2) it isolates and purifies to obtain the near-infrared fluorescent albumen smURFP solution of purity > 90%, and uses buffer by protein solution
It is diluted to required concentration；
3) it is incubated for after mixing 50 μ l protein solutions with the solution that 50 μ l contain biliverdin sample；
4) fluorescence intensity of transmitting light is detected under excitation using microplate reader；
5) the biliverdin content of institute's sample is calculated according to standard curve.
3. according to the method described in claim 2, containing SEQ ID NO.1 gene it is characterized by: constructing in the step 1)
The prokaryotic expression carrier of sequence is transferred to E. coli cell, expresses near-infrared fluorescent albumen smURFP.
4. according to the method described in claim 2, it is characterized by: being handed in the step 2) using Ni- affinity chromatography, anion
It changes chromatography and sieve chromatography isolates and purifies to obtain near-infrared fluorescent albumen smURFP.
5. according to the method described in claim 2, it is characterized by: in the step 2) buffer solution system include: pH be 8.0,
9.4,11.0 50mM Tris-HCL and PBS.
6. according to the method described in claim 2, it is characterized by: in the step 2) buffer salinity include: 0mM,
100mM、200mM、300mM、400mM、500mM、600mM、700mM、800mM、900mM、1000mM Nacl。
7. according to the method described in claim 2, it is characterized by: for detecting the inspection of biliverdin after dilution in the step 2)
The ultimate density of near-infrared fluorescent albumen smURFP in survey system are as follows: 0.5 μM -50 μM.
8. according to the method described in claim 2, it is characterized by: the sample in the step 2) containing biliverdin is serum
When, serum is diluted to 20% by buffer.
9. according to the method described in claim 1, it is characterized by: fluorescin smURFP and biliverdin are molten in the step 3)
After liquid mixing, incubation conditions are 4 DEG C, incubation time 20min-240min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910144442.6A CN109932347A (en) | 2019-02-27 | 2019-02-27 | A kind of near-infrared fluorescent albumen smURFP and the method for directly detecting biliverdin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910144442.6A CN109932347A (en) | 2019-02-27 | 2019-02-27 | A kind of near-infrared fluorescent albumen smURFP and the method for directly detecting biliverdin |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109932347A true CN109932347A (en) | 2019-06-25 |
Family
ID=66986079
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910144442.6A Pending CN109932347A (en) | 2019-02-27 | 2019-02-27 | A kind of near-infrared fluorescent albumen smURFP and the method for directly detecting biliverdin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109932347A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103282765A (en) * | 2011-01-04 | 2013-09-04 | 皇家飞利浦电子股份有限公司 | An apparatus for optical analysis of an associated tissue |
| CN105461787A (en) * | 2015-12-29 | 2016-04-06 | 深圳先进技术研究院 | Large stokes displacement fluorescent protein CyOFP and application thereof |
| US20180201655A1 (en) * | 2016-11-22 | 2018-07-19 | The Regents Of The University Of California | ALLOPHYCOCYANIN ALPHA-SUBUNIT EVOLVED LABELING PROTEINS (smURFPs) |
-
2019
- 2019-02-27 CN CN201910144442.6A patent/CN109932347A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103282765A (en) * | 2011-01-04 | 2013-09-04 | 皇家飞利浦电子股份有限公司 | An apparatus for optical analysis of an associated tissue |
| CN105461787A (en) * | 2015-12-29 | 2016-04-06 | 深圳先进技术研究院 | Large stokes displacement fluorescent protein CyOFP and application thereof |
| US20180201655A1 (en) * | 2016-11-22 | 2018-07-19 | The Regents Of The University Of California | ALLOPHYCOCYANIN ALPHA-SUBUNIT EVOLVED LABELING PROTEINS (smURFPs) |
Non-Patent Citations (2)
| Title |
|---|
| ERIK A RODRIGUEZ等: "《A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein》", 《NATURE METHODS》 * |
| 王飞: "《远红外荧光蛋白smURFP的初步晶体学研究》", 《中国优秀硕士学位论文全文数据库 基础科学辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102344494B (en) | Nicotinamide adenine dinucleotide gene coding fluorescent probe as well as preparation method and application thereof | |
| CN110684789B (en) | Fusion gene, recombinant vector and preparation method thereof, cadmium ion whole-cell biosensor and preparation method and application thereof | |
| CN108251446A (en) | A kind of construction method of lead ion responsive type whole-cell biological sensor | |
| CN108220318A (en) | The construction method of the whole-cell biological sensor of lead ion check with high sensitivity | |
| CN113061591A (en) | Novel firefly luciferase mutant, preparation method and application thereof | |
| CN112501173A (en) | GPC1DNA aptamer and application thereof | |
| CN109161582A (en) | It is a kind of for the reagent and its kit of ring mediated isothermal amplification and application | |
| CN116732205A (en) | New target for detecting malonate Cronobacter cloacae, LMTIA primer pair, kit, detection method and application | |
| CN115032379A (en) | Quick quantitative determination card of type B botulinum toxin | |
| CN115096880A (en) | Polypeptide-modified gold nanocluster, preparation method thereof and application thereof in detection of micro-plastics | |
| CN105585625B (en) | Enhanced green fluorescent protein | |
| CN109932347A (en) | A kind of near-infrared fluorescent albumen smURFP and the method for directly detecting biliverdin | |
| CN105177023B (en) | Photosensitive degradant desVVD with stability regulated by blue light in eukaryotic cell | |
| CN116287139A (en) | Method for detecting staphylococcus aureus | |
| KR100950064B1 (en) | Metagenome-derived blue fluorescent protein, mbfp, applicable as the probe and reporter | |
| CN115028743A (en) | Fluorescent sensor for detecting D-2-hydroxyglutaric acid and construction method and application thereof | |
| CN105403558B (en) | A kind of method of quick detection lead ion | |
| CN110511283B (en) | Detection kit for detecting protein with green fluorescence activity | |
| CN113321717B (en) | LOV protein mutant and application thereof | |
| Shrestha et al. | Simultaneous detection of analytes based on genetically engineered whole cell sensing systems | |
| CN114015664B (en) | Luciferase mutant and application thereof | |
| CN110615844A (en) | Multi-species universal detection protein with green fluorescence activity and application thereof | |
| CN115181167B (en) | Screening method of ethanol production strain based on BmoR mutant | |
| CN115991757B (en) | Fluorescent protein probe for detecting mercury ions through signal enhancement, and preparation and application thereof | |
| CN110437341B (en) | Detection protein with red fluorescence activity and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190625 |
|
| WD01 | Invention patent application deemed withdrawn after publication |